Virology Journal, 2005; 2: 23-23 (más artículos en esta revista)

Origen de replicación independiente plásmido ocurre en el virus vaccinia citoplásmica fábricas y requiere de los cinco factores de replicación conocido poxvirus

BioMed Central
Frank De Silva S (fdesilva@niaid.nih.gov) [1], Bernard Moss (bmoss@nih.gov) [1]
[1] Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892-0445, USA

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

De la replicación del genoma del virus de vaccinia se produce en la fábrica frente al citoplasma de las zonas y depende de los virus de la DNA polimerasa codificada y por lo menos otros cuatro proteínas virales. Síntesis de ADN parece comenzar cerca de los extremos del genoma, pero secuencias específicas de origen no se han definido. Sorprendentemente, transfectadas circular de ADN que carecen de secuencias específicas viral también es replicado en poxvirus de las células infectadas. Origen de la replicación del plásmido independiente depende de la DNA polimerasa viral, pero ni el número de nuevas proteínas virales ni el sitio de la replicación ha sido determinado.

Resultados

Uso de una novela en tiempo real de ensayo de reacción en cadena de la polimerasa, que detectó un> 400 veces más reciente reproducido en el plásmido en las células infectadas con el virus vaccinia. Estudios con mutantes condicionales letales del virus vaccinia indicó que cada una de las cinco proteínas que se sabe que son necesarios para la replicación del genoma viral es también necesaria para la replicación del plásmido. El sitio de replicación intracelular se determinó a través de un plásmido conteniendo 256 repeticiones de la Escherichia coli lac operador y tinción con una E. Coli represor lac-maltosa vinculante proteína de fusión seguido de un anticuerpo a la proteína de unión de maltosa. El operador lac plásmido fue localizado en citoplásmica viral fábricas trazada por tinción de ADN y encuadernación de anticuerpos a la uracil ADN viral glycosylase, una proteína esencial replicación. Además, la replicación del operador lac plásmido se visualiza continuamente en las células vivas infectadas con el virus vaccinia recombinante que expresa el represor lac fundido a mejorar la proteína verde fluorescente. Discreta fluorescencia citoplásmica se detectó en citoplásmica juxtanuclear sitios a las 6 horas después de la infección y de la zona y el aumento de la intensidad de fluorescencia durante las próximas horas.

Conclusión

La replicación de un plásmido circular que carecen de las secuencias de ADN específicas poxvirus imita genoma viral por que se forman en la replicación viral frente al citoplasma de las fábricas y que requieren conocer las cinco proteínas de la replicación viral. Por lo tanto, los pequeños plásmidos pueden ser utilizados como sucedáneos de las grandes poxvirus genoma para estudiar los factores que actúan transeuropeas y el mecanismo de replicación del ADN viral.

Antecedentes

Virus de la vacuna (VAC), el prototipo de la familia Poxviridae, es un gran doble varados virus ADN que codifica las enzimas y los numerosos factores necesarios para la síntesis de ADN y ARN, que le permiten replicar en el citoplasma de las células infectadas [1]. Más de 20 proteínas virales incluido un multi-subunidad de ARN polimerasa y fase específicas son factores de transcripción que participan en la síntesis de RNA viral [2]. Estudios genéticos y bioquímicos identificado cinco proteínas virales esenciales para la replicación del ADN viral, es decir, la DNA polimerasa viral [3 - 8], la polimerasa procesividad factor [9, 10], independiente de ADN de nucleósidos triphosphatase [11 - 13], serina / threonine proteína quinasa [14 - 17], y uracil DNA glycosylase [18 - 21]. Además, el virus codificado Holliday cruce de endonucleasa es necesaria para la resolución de ADN concatemers en la unidad de longitud de los genomas [22]. Otras proteínas que pueden contribuir a la replicación del ADN viral, incluyen ADN topoisomerasa tipo I, la única proteína de unión de ADN varados, ligase de la DNA, la timidina quinasa, thymidylate quinasa, y dUTPase ribonucleótido reductasa (revisado en referencia [1]].

El VAC genoma consiste en un dúplex de 192 kbp lineales de ADN con covalentemente cerrado horquilla termini [23, 24]. Un modelo de poxvirus la replicación del ADN comienza con la introducción de un nick, cerca de uno o ambos extremos de la horquilla termini, seguida de polimerización de los nucleótidos en el libre 3'-OH fin, el desplazamiento y el capítulo concatemer resolución [25, 26]. Nicking cuenta con el apoyo de los cambios en la sedimentación de los padres del ADN después de la infección, y el etiquetado estudios sugiere que la replicación se inicia cerca de los extremos del genoma [27, 28]. Los esfuerzos para localizar un origen de replicación en el genoma VAC condujo a la sorprendente conclusión de que cualquier ADN circular reproducirse como de cabeza a la cola junto arrays en las células infectadas con el VAC [29, 30]. Origen independiente de la replicación del plásmido fue también demostrado que se producen en el citoplasma de las células infectadas con otros poxviruses incluidos Shope fibroma virus y virus mixoma, así como con el virus de la peste porcina africana [30, 31]. En cambio, los estudios con minichromosomes lineal que contiene horquilla termini presentó pruebas para cis-VAC actuando elementos en la replicación del ADN [32]. Se consideró que el plásmido de replicación podría iniciar no concretamente, tal vez al azar mellas en el ADN.

Aunque transfectadas plásmidos se utilizan para estudiar la resolución de poxvirus concatemer cruces [33 - 37], el sistema no ha sido explotada para el estudio de la síntesis de ADN viral. El objetivo del presente estudio fue determinar cómo estrechamente plásmido de replicación imita la replicación del genoma viral. Por ejemplo, si algunas proteínas virales son necesarios para iniciar la síntesis de ADN en determinados orígenes cerca de los extremos del genoma viral, que podría no ser necesaria para la replicación del plásmido. Además, se nos curioso en cuanto a si la síntesis de ADN plásmido se produce difusa en el citoplasma, ya que el ADN entra en las células transfectadas con independencia de virus y no contiene secuencias virales de orientación. Contrariamente a estas especulaciones, encontramos que cada uno de los cinco proteínas virales que se sabe que son necesarios para la replicación del genoma viral que se necesitaba para el origen independiente de la replicación de los plásmidos. Además, tanto el plásmido y se produjo en la replicación del genoma viral discreto citoplásmica fábrica. Así, los pequeños circular plásmidos son sustitutos útiles para la gran genoma viral en el estudio de poxvirus el mecanismo de replicación del ADN y las transnacionales que actúan factores requeridos.

Resultados
Determinación de la replicación del plásmido por PCR en tiempo real

La replicación de los plásmidos y minichromosomes lineales, que fueron transfectadas en células infectadas por el VAC, fue previamente demostrada por autorradiografía después de la hibridación de 32 P-etiquetados para el Sur de sondas blots [29, 30, 32]. Metiladas entrada ADN preparado en E. Coli se distingue de unmethylated DNA reproducirse en células de mamífero infectado por la digestión con DpnI DpnI y MboI MboI, que cleave G m ATC y secuencias GATC, respectivamente. DeLange y McFadden [30] ha informado de un 8 veces aumento neto de un plásmido circular que carecen de secuencias virales en las células infectadas con el conejo mixoma virus, mientras que Du Traktman y [32] había visto a 2 veces el aumento neto de un lineal minichromosome contengan VAC Termini en el genoma de ratón L células infectadas con el VAC, pero un aumento mucho menor de un plásmido circular que carecen de secuencias virales. Se comparó la reproducción de tres tipos de ADN (super espiral circular, lineal, lineal y minichromosome) en el mono verde africano BS-C-1 células, que se ha convertido en un estándar de la línea de células para la investigación VAC. Southern blot análisis de la DpnI DpnI productos de la digestión del ADN aislado de las células infectadas con el VAC y transfectadas con super enrollado pUC13 reveló un alto peso molecular que emigran por encima de la banda de 23,1-kbp marcador, que representan presumiblemente de cabeza a la cola concatemers (Fig. 1A]. Un prominente DpnI resistentes a la banda, que migran entre el 4,4 y el 6,6 kbp marcadores, se obtuvo mediante la digestión de ADN de infectados BS-C-1 células transfectadas con el minichromosome covalentemente cerrado. Sin embargo, sólo los pequeños productos de la digestión se obtuvieron a DpnI DpnI tratos de ADN de las células transductor lineal pUC13. Además, DpnI DpnI resistentes a las bandas no se detectaron por la digestión del ADN de modelo de las células infectadas con un transductor lineal minichromosome o 10 veces más súper enrollado plásmido (Figura 1A]. Este experimento confirmó la necesidad de VAC y de la infección ya sea un plásmido circular o lineal minichromosome plantilla para la replicación del ADN. Por otra parte, no hemos visto una mayor reproducción de la lineal minichromosome que el plásmido circular como se había informado (32).

Para mejorar la cuantificación de la replicación del plásmido, y establecer un método no radiactivo de un rápido análisis de las múltiples muestras, realizamos un tiempo real utilizando el ensayo de PCR primers 152 bp que aparte flanqueado dos DpnI DpnI / MboI MboI una circular en sitios que carecen de plásmido de ADN VAC Secuencias. En los experimentos iniciales, hemos seguido el protocolo de estudios previos por el plásmido transfecting después de la infección [29, 30]. Sin embargo, MboI MboI resistentes entrada de ADN, así como DpnI DpnI resistentes a repetirse ADN aumentado con el tiempo, lo que sugiere que la entrada de ADN en la célula producido continuamente a pesar de que el medio se cambió a las 4 h (datos no presentados). Para evitar este problema en experimentos posteriores, el ADN se transfectadas 24 h antes de la infección. Total ADN fue aislado en diversas ocasiones, digeridos con DpnI DpnI, MboI MboI, o la izquierda no ha sido cortada y sometido a PCR en tiempo real. En estas condiciones, MboI MboI resistentes ADN no aumentó, mientras que DpnI DpnI resistentes ADN aumento de ~ 18 veces entre los 3 y 6 h y ~ 400 veces por 24 h (Fig. 1B]. Por otra parte, el total de ADN ~ aumentado 10 veces. Mayor DpnI DpnI resistentes ADN no fue detectado en el modelo de las células infectadas (datos no presentados).

Southern Blot estudios anteriores habían indicado que el plásmido de replicación replicación del genoma paralelo [30]. Se comparó la cinética de replicación del plásmido obtenido por PCR en tiempo real con Southern Blot. Para este último análisis, el total de ADN fue digerido con EcoRI EcoRI para resolver de cabeza a la cola concatemers en unidades lineales seguida de la digestión con MboI MboI o DpnI DpnI. Después de la electroforesis, el ADN se transfirió a una membrana de nylon, hibridizada a un 32 P-etiquetados sonda plásmido, y la cantidad de ADN cuantificarán mediante un PhosphorImager. El DpnI DpnI resistentes y ADN total aumentó con el tiempo, mientras que el MboI MboI resistentes ADN no (Fig. 1C]. El Southern blot análisis sugiere que la cantidad de plásmido plateaued repetirse después de 12 h, mientras que sigue aumentando ligeramente según lo determinado por PCR (Figura 1B], lo que sugiere que este último método tiene el mayor rango dinámico, además de ser más cómodo.

Determinación de la trans-actuando factores necesarios para la replicación del plásmido

La dependencia de la replicación del genoma VAC relativa a la expresión de los cinco principios de las proteínas virales fue previamente determinado por el análisis de mutantes condicionales letales. Debido a la ausencia de cis-secuencias de ADN que actúan VAC, hemos considerado que el plásmido de replicación de ADN que sólo imitan los pasos de elongación, y por tanto requieren sólo un subconjunto de proteínas víricas. Para probar esta hipótesis, el plásmido se transfectadas en BS-C-40 células (un derivado de la BS-C-1 que las células han sido pasajes a 40 ° C), que posteriormente fueron infectados con un VAC ts mutante bajo permisiva y no Permisivo condiciones. Plásmido de replicación se cuantificó por PCR en tiempo real. VAC cepa de tipo salvaje y WR Cts16 Cts16 Cts16, que tiene una mutación en el gen que codifica una I7 proteasa necesarios para la morfogénesis VAC, pero no la síntesis de ADN [38], sirvieron como controles positivos. Síntesis de ADN plásmido fue mayor a 39,5 ° C de 31 ° C para ambos WR y Cts16 Cts16 Cts16 (Figura 2A]. En cambio, lo contrario es cierto para cada mutación se sabe que perjudican la replicación del ADN en la temperatura no permisiva. De hecho, apenas el plásmido de replicación se detectó en 39,5 ° C en las células infectadas con el Cts24 Cts24 Cts24, Cts42 Cts42 Cts42, y ts185 ts185, que tienen defectos en el D5 de nucleósidos triphosphatase, E9 la ADN polimerasa, y el factor de procesividad A20 (Fig. 2A ). La reducción de la replicación del plásmido se completa en menos 39,5 ° C en las células infectadas con el Cts25 Cts25 Cts25, que tiene un defecto en la B1 serina / threonine proteína quinasa, que es compatible con observaciones anteriores mostraron que la acumulación de genoma viral se redujo en sólo moderadamente BS - C-40 en células no permisivas temperaturas [15]. El relativamente bajo de replicación del plásmido a 31 ° C en las células infectadas con el Cts42 Cts42 Cts42 y ts185 ts185 (Figura 2A] sugiere que la mutación de la ADN polimerasa y procesividad factor todavía un tanto defectuoso, incluso con "permisivo".

Estudios anteriores habían demostrado que la expresión de VAC uracil DNA glycosylase se requiere para la replicación del genoma [39]. Para determinar si esta proteína es necesaria para la replicación del plásmido, que utiliza virus mutante vD4 ZG-, en la que el uracil DNA glycosylase gen se ha eliminado [39], y que carecen de líneas de células de conejo (RK-13) o que expresan establemente (RKD4R) VAC uracil DNA glycosylase [39]. Se encontró que la replicación del ADN plásmido sólo se detectó en la línea celular estable que expresa la uracil ADN viral glycosylase (Fig. 2B], lo que indica una necesidad de esta proteína, así como cada uno de los otros cuatro factores.

Transfectadas plásmido de ADN viral se acumula en las fábricas

VAC acumula en el ADN genómico especializados citoplásmica fábrica cerca de las zonas núcleo. Sin embargo, la ubicación intra-citoplasmática de plásmido de replicación no se había determinado. Necesitábamos una etiqueta específica para distinguir viral y plásmido de ADN con el fin de localizar a estos últimos en las células infectadas. Varios estudios han utilizado multimerized E. Coli lac operador (lacO lacO) sitios de unión y represor lac (lacI lacI) interacciones proteína de fusión para examinar la organización de la cromatina y la dinámica de los cromosomas en las células vivas [40 - 43]. Para aplicar esta estrategia, las células transfectadas con un 10,5 kbp plásmido pSV2-dhfr-8,32 [44] que contiene 256 lacO lacO repite las células infectadas y 24 h más tarde. Los primeros experimentos confirmaron que se produjeron después de la replicación del plásmido VAC infección como se ha descrito anteriormente para los más pequeños plásmidos (datos no presentados). Luego de esto, las células transfectadas con pSV2-dhfr-8,32 y después infectados con vV5D4, un recombinante que expresa VAC-V5 epítopo etiquetados uracil DNA glycosylase. A las 12 h después de la infección, el ADN en el núcleo y citoplasma fábricas fue visualizado por tinción Hoechst (Fig. 3]. El plásmido que parecía ser excluidos del núcleo y presente exclusivamente en las fábricas citoplásmica viral según lo determinado por la tinción de las células con una proteína de unión maltosa (MBP) - lacI lacI proteína de fusión y un anticuerpo a MBP (Fig. 3]. Además, el plásmido sitios de la figura VAC DNA glycosylase, como lo demuestra la tinción con anticuerpos a la V5 etiqueta de la última proteína (Fig. 3]. No se detectó tinción MBP cuando un plásmido que carecen de control lacO lacO secuencias se transfectadas (datos no presentados).

Visualización de reproducir plásmido de ADN en células vivas

En el experimento anterior, las células fueron fijadas y teñidas con el fin de visualizar el ADN plásmido. Consideramos que estas medidas se podrían evitar por expresar una GFP-lacI lacI proteína de fusión con una señal de localización nuclear (NLS). El GFP permite la visualización de la etiqueta lacI lacI por microscopía de fluorescencia mientras que el NLS servido para trasladar las buenas prácticas agrarias-lacI lacI, que no estaba específicamente vinculado a lacO lacO en secuencias de ADN, desde el citoplasma al núcleo. Con el fin de expresar la proteína de fusión antes y durante la replicación del ADN, que construyó la recombinante vGFP-lacI con el marco de lectura abierta la codificación de GFP-NLS-lacI lacI proteína de fusión regulado por un viral temprana o tardía promotor. Células HeLa fueron transfectadas con pSV2-dhfr-8,32 y 24 h después infectados con vGFP-lacI. Fluorescencia verde brillante se detectó más de la factoría viral zonas y núcleos, que se correlacionaban con la tinción de Hoechst (Fig. 4]. En las células con múltiples fábricas viral, sin embargo, no todos los exhibió una fluorescencia verde. La fábrica viral regiones también fueron visualizados por tinción con un anticuerpo a la RNA polimerasa viral, que rodeado incluido el ADN y los sitios a las 12 h después de la infección (Fig. 4]. Cuando un plásmido control (p716) que carecen de lacO lacO sitios se transfectadas, la fluorescencia verde era estrictamente localizados en el núcleo (Fig. 4].

Después de haber establecido la especificidad de la GFP-lacI lacI vinculante por la co-localización, se examinaron fluorescencia de células vivas por el tiempo transcurrido después de transfección con microscopía pSV2-dhfr-8,32 y de la infección con el vGFP-lacI lacI. GFP fluorescencia débil se detectó en aproximadamente el 5,5 h después de la infección (no se muestra), y es en gran parte sobre el núcleo, lo que refleja la orientación debido a la NLS. Una región de juxtanuclear fluorescencia correspondiente a una fábrica viral se observó claramente en el 7,5 h, y durante las próximas horas aumentado en intensidad (Fig. 5]. El tiempo sugirió que la fábrica de la región fue el sitio de replicación, así como la acumulación de ADN plásmido.

Discusión

La replicación de ADN circular que carecen de secuencias virales como de cabeza a la cola concatemers en el citoplasma de las células infectadas con un poxvirus se informó, hace casi 20 años [29, 30]. Fortuito poxviral orígenes fueron descartadas por la reproducción de la circular 5 diferentes autoridades nacionales designadas y no se obtuvo evidencia para su integración en el genoma viral no por recombinación homóloga. Estos datos sugiere encarecidamente plásmido de replicación autónoma por un círculo de rodadura o theta mecanismo. La importancia de la no secuencia específica de la replicación del ADN fue puesto en tela de juicio por Du y Traktman [32], en la que informó sólo de bajo nivel de replicación de un plásmido super enrollado, frente a la lineal minichromosome telómero que contienen secuencias específicas [32]. Sin embargo, nuestra determinación de multiplicado por 10 en el ADN plásmido netos en comparación con la del 2 veces aumento logrado con la máxima eficiencia minichromosome construir [32]. Además, nuestro hallazgo fue similar a la de 8 veces más en el ADN plásmido netos reportados por DeLange y McFadden [30]. Hay varias diferencias de procedimiento que podrían explicar la disparidad de resultados. Una de las diferencias es el tipo de virus y las células utilizados: Du y Traktman L ratón utiliza células infectadas con VAC, DeLange y McFadden utilizados principalmente para conejo células infectadas con el virus mixoma fibroma o Shope virus y hemos utilizado mono o células HeLa infectadas con el VAC. Una segunda diferencia es el método de aislamiento de ADN. Considerando que nosotros y DeLange y McFadden proteinasa digerido lisados de células enteras, y Du Traktman células lisadas con frío hipotónica buffer que contiene un detergente no iónico y retirado por los núcleos de sedimentación antes de la extracción de ADN. VAC ocurre en la replicación del ADN juxtanuclear fábricas y la pérdida de proteínas de alto peso molecular de ADN complejos, especialmente los que contienen largo de cabeza a cola de ADN plásmido concatemers a la centrifugación es una preocupación. De hecho, y Du Traktman [32] informó de que la presencia de la secuencia de resolución telómero se requiere para la reproducción de alta eficiencia minichromosomes lineales y monomérico productos que sólo se recuperaron. Se necesitan estudios adicionales para determinar si las secuencias cis-actuando en el lineal minichromosomes se actúa como origen de replicación o como concatemer de resolución o de ambos sitios.

La coincidencia temporal del plásmido viral y la replicación del ADN viral sugirió que las proteínas se necesitan para cada una. De hecho, encontramos que cada una de las cinco transnacionales que actúan las proteínas virales que se sabe que son importantes para la replicación del genoma viral es igualmente necesaria para la replicación del plásmido. O bien ninguna de estas proteínas tienen una secuencia específica de papel o algunos tienen doble función y son también necesarias para el origen de replicación independiente. Las proteínas también pueden tener funciones estructurales en el complejo montaje de la reproducción, la existencia de la que ha sido propuesto por la interacción de la A20 con la D4 y D5 proteínas [45] y de la co-purificación de la A20, E9 y D4 proteínas con una forma processive De la DNA polimerasa [46, 47].

VAC núcleos que contienen ADN genómico y una pronta sistema de transcripción de viaje entrada de la celda sitio a lo largo de los microtúbulos a juxtanuclear ámbito en el que la síntesis de las proteínas virales y principios de la replicación del ADN resultado en la formación de las fábricas discreta [48]. Se cree que cada una de las fábricas se debe a una única partícula infecciosa [49]. Es interesante para determinar si se produjo la replicación del plásmido en las fábricas o dispersos en la célula. Para investigar esto, las células transfectadas con un plásmido que contiene múltiples repeticiones de la E. LacO lacO coli, que se une fuertemente lacI lacI. En un método, la lacO lacO ADN se encuentra en las regiones discretas juxtanuclear por tinción de las células permeabilized fija y con un MBP-lacI lacI proteína de fusión seguido de un anticuerpo a la PAM. Las regiones se identificaron como fábricas viral por Hoechst tinción de ADN y la localización de la uracil ADN viral glycosylase, una proteína necesaria para la replicación de los plásmidos y ADN viral. LacO LacO no se detectó ADN en el núcleo o en zonas difusas de la citoplasma. Un segundo enfoque implicaba la construcción de un VAC recombinante, que expresa GFP-lacI lacI proteína de fusión con un NLS para eliminar sin encuadernar proteínas de las citoplasma. Una vez más, la lacO lacO ADN viral se encontró en las fábricas identificadas con la tinción de Hoechst y la RNA polimerasa viral de anticuerpos. Los datos sugieren que para que se produzca el plásmido de replicación, el ADN tiene que estar en el lugar correcto, es decir un sitio que contengan proteínas de la replicación viral. Presumiblemente el plásmido difunde en la fábrica de la región y es captado por las proteínas ADN vinculante. Al tomar lapso de tiempo imágenes de células vivas, el plásmido de ADN se detectó en juxtanuclear sitios a los 6 a 7 h después de la infección y el aumento en la intensidad como la ampliación de las fábricas durante las próximas horas. Fábrica de la ampliación parece que se produzca desde el interior y no por la fusión de varias pequeñas fábricas. Sospechamos que este último podría ocurrir si el virus de mayor multiplicidades se utilizaron.

En contraste con la citoplásmica de la replicación del genoma y el ADN plásmido en las células infectadas-VAC, Sourvinos et al. [50] visualizado nuclear de replicación del virus del herpes simple amplicones que contienen tetraciclina operador secuencia y Fraefel et al. [51] incorporado lacO lacO sitios en el genoma de adenovirus y virus asociados discreta replicación visualizar sitios en el núcleo que fusionados para formar estructuras más grandes. El último estudio nos animó a tratar de incorporar a largo tándem arrays de lacO lacO VAC repite en el genoma, pero son inestables.

Conclusión

Se presenta una delicada y cuantitativa en tiempo real PCR método de medición de la replicación del plásmido en las células infectadas con el VAC y demostrado que el origen de replicación independiente requiere que todos conocida la replicación viral proteínas. Además, se visualiza el plásmido en las células de vida y de fijo mediante la incorporación de secuencias tándem lacO lacO y determinó que la replicación viral se produjo en citoplásmica fábricas. Este sistema debería ser útil para estudiar el mecanismo y los requisitos mínimos de poxvirus la replicación del ADN.

Métodos
Células, plásmidos y virus

RK-13, BS-C-1, C-BS-40, HuTK - 143B, y células HeLa se mantuvieron en el mínimo esencial Eagle medio (EMEM; Calidad de Biológicos, Inc Gaithersburg, MD) o Dulbecco modificada del medio Eagle (MEDM; Calidad de Biológicos, Inc), que contiene un 10% de suero fetal bovino (SFB). Una línea celular de riñón de conejo (RKD4R) estable expresando la VAC uracil ADN recombinante y glycosylase VAC vD4 ZG-que carecen de un gen funcional D4R [39] fueron los regalos de FG Falkner. Plásmido pSV9 contiene dos copias de un 2,6 kbp insertar derivados de la VAC concatemer cruce y dos copias de pUC13 ADN [33]. Lineal minichromosomes contiene 1,3 kbp de VAC telómero secuencias fueron preparados por la ligadura de broche de enfriado, EcoRI digerido EcoRI pSV9 esencialmente descrita por Du y Traktman [32]. Ligadura dio lugar a tres productos, de 8 kbp, 2,6 kbp y 5,3 kbp. El 5,3 kbp minichromosome fragmento fue aislado por electroforesis en gel y de la extracción de gel Qiaex II Kit (Qiagen). Plásmido p716 [52] fue proporcionado amablemente por A. McBride; plásmidos pSV2-dhfr-8,32 y p3'SS dímero-Cl-EGFP [44] fueron los regalos de A. Belmont. La temperatura sensible (ts) replicación mutantes Cts16 Cts16 Cts16, Cts24 Cts24 Cts24, Cts42 Cts42 Cts42, Cts25 Cts25 Cts25 con mutaciones en el I7, D5, E9 y marcos de lectura abierta B1, respectivamente, se obtuvieron a partir de R. Condit [53, 54] ; Mut185 ts tiene una mutación en la A20 ORF [10].

Anticuerpos

Cy5-conjugado affinipure F (ab ') 2 fragmento de burro IgG anti-ratón y Texas tinte rojo conjugado affinipure F (ab') 2 de burro anti-conejo IgG se obtuvieron de Jackson ImmunoResearch laboratorios. Alexa Fluor 594 cabra anti-IgG de conejo fue de sondas moleculares. New England Biolabs y Invitrogen suministrado el conejo de anticuerpos a la PAM y el ratón anti-V5 anticuerpo monoclonal, respectivamente.

Transfección, la infección y el aislamiento de ADN

Para los experimentos analizados por PCR en tiempo real, 0,1 μ g de ADN p716 y 3,9 μ g de salmón esperma portador de ADN se mezcla con 10 μ g de lipofectamine 2000 (Invitrogen) y las células no infectadas fueron transfectadas de acuerdo a las instrucciones del fabricante. Después de 24 h, las células fueron infectadas con la cepa VAC WR, vD4 ZG-ts o un mutante en una multiplicidad de 3 PFU por célula. Las células fueron lavadas dos veces con Opti-MEM (Invitrogen) y superpuestos a las EMEM con el 2,5% de SFB. En distintos momentos, se cosecharon las células y el ADN aislado utilizando el ADN de sangre Qiamp Kit (Qiagen), de acuerdo con las instrucciones del fabricante. ADN fue digerido con las enzimas de restricción DpnI DpnI o MboI MboI (New England Biolabs).

Secante del Sur

ADN (2 μ g) fue digerido con EcoRI EcoRI y DpnI DpnI o MboI MboI, resuelto en un gel de agarosa 0,8%, y trasladado a Immobilon-Ny + (Millipore) de transferencia de la membrana. Secante del Sur se llevó a cabo según lo descrito por Maniatis [55]. Plásmido de ADN se detectó con una sonda de ADN que fue de 32 P-etiquetados utilizando un kit de azar-priming (Invitrogen). Pre-hibridaciones y hibridaciones se llevaron a cabo utilizando Quik-hibridación (Stratagene), de acuerdo con la recomendación del fabricante. La mancha fue expuesta a una pantalla de fósforo y de los datos adquiridos en un Tormenta 860 PhosphoImager (Molecular Dynamics, Sunnyvale, CA) y cuantificarse con ImageQuant software (Molecular Dynamics).

PCR en tiempo real

Oligonucleótidos P1 (5'CAACTAAATGTGCAAGCAATGTAATTC3 ') y P2 (5'CATCCTGCCCCTTGCTGT3') fueron diseñadas con el software Primer Express suministrados por Applied Biosystems. Las reacciones se llevaron a cabo utilizando SYBR Green maestro de la mezcla de PCR (Applied Biosystems), 10 μ M de cada cebador, y 1 ng de DNA en un volumen total de 50 μ l en un Applied Biosystems Prism 7900HT secuencia con sistema de detección de software v2.1.1. Para la amplificación 40 ciclos a 95 ° C durante 15 s y 60 ° C durante 60 s se utilizaron.

Construcción de virus recombinantes

VGFP-lacI lacI: el marco de lectura abierta que codifica GFP-lacI lacI fue clonado por PCR usando primers 5'CAGGCTGCGCAACTGTTGGGAAGGGCGA3 'y 5'AAAAGTACTAGCCTGGGGTGCCTAATGAGTGAGC3' con p3'SS dímero-Cl-EGFP [44] como una plantilla. El producto de PCR fue digerido con XhoI XhoI y ScaI ScaI y luego ligated a XhoI XhoI y StuI StuI digerido pSC59 [56] para formar el plásmido pSC59gfplacI pSC59gfplacI pSC59gfplacI. BS-C-1 células fueron infectadas con la cepa VAC WR PFU en el 0,05 por celda de 1 h y luego transfectadas con 2 μ g pSC59gfplacI pSC59gfplacI pSC59gfplacI utilizando 10 μ g de Lipofectamine 2000. Después de 5 h, el medio fue reemplazado con EMEM, más el 2,5% de SFB y la continuación de incubación de 2 días. Las células fueron cosechadas y lisadas, y el lisado diluido se utiliza para infectar HuTK - 143B monocapas de células. Las células se superpone con soporte de bajo punto de fusión de agarosa y 25 μ g de 5-bromodeoxyuridine por ml. Después de tres rondas de la placa de depuración, el ADN viral se hacen pruebas de la presencia del ADN insertado por PCR. La recombinación del virus se propagó y se titula como se describe anteriormente [57]. VV5D4: primers 5'ACTAGATACGTATAAAAAGGTATCTAATTTGATATAATGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGAATTCAGTGACTGT3 'y 5'CTCCTGGACGTAGCCTTCGGG3' y ADN de plásmido pER-GFP [21] se utilizaron para añadir una etiqueta a la V5 VAC D4R gen. Después de la doble digestión de los productos PCR y plásmido con SnaBI SnaBI y SmaI SmaI, los productos se ligated para formar el nuevo plásmido pERV5-GFP. Aproximadamente 10 6 RKD4R células fueron infectadas con el vD4 ZG-en una multiplicidad de 0,05 PFU por celda de 1 h a 37 ° C. La infección de las células se lavaron dos veces con Opti-MEM y transfectadas con 2 μ g de pERV5-GFP utilizando 10 μ g de Lipofectamine 2000. Después de 5 h, la transfección mezcla fue sustituida por EMEM que contiene 2,5% de SFB, y las células fueron recolectadas a las 48 h en 0,5 ml de la EMEM-2,5% de SFB. Lisados fueron preparados por la congelación y descongelación de las células tres veces y sonicating ellos dos veces durante 30 s. Recombinación del virus que se expresó GFP placa purificada cinco veces en RKD4R células. La pureza genética de los virus recombinantes fue confirmada por PCR y secuenciación. La recombinación del virus se propagó y se titula como se describe anteriormente [57].

La construcción y la expresión de MBP-lacI

El gen represor lac PCR fue amplificado utilizando los siguientes primers 5'CGGAATTCTCATCGGGAAACCTGTCGTGCCAGCTGC3 'y 5'CGCGGATCCTAGTGAAACCAGTAACGTTATACG3' y la plantilla de ADN de p3'SS dímero-Cl-EGFP. El fragmento amplificado fue clonado en el BamHI EcoRI BamHI y sitios EcoRI del vector de expresión pMal-c2x (New England Biolabs), con lo que el plásmido pMalc2x-lacI lacI. Luria-Bertani medio (500 ml) suplementado con ampicilina (100 μ g / ml) y la glucosa (0,2% w / v) se inoculó con 5 ml de una cultura de la noche a la mañana el E. ER2507 coli (New England Biolabs) recombinante que contiene el plásmido pMalc2x-lacI. La cultura se ha aumentado a 37 ° C, a una densidad celular de 0,5 nm en el A600 y la expresión de la proteína fue inducida por 2 horas a 37 ° C, añadiendo isopropílico-β-D-thiogalactopyranoside a una concentración final de 0,3 mM. La cultura se centrifuga a 4000 × g por 20 min a 4 ° C. Un extracto de células se prepara usando B-PER reactivo (Pierce), de acuerdo con la recomendación del fabricante y el uso de la proteína purificada pMAL y purificación de proteína de fusión kit (New England Biolabs).

La microscopía confocal y en vivo de imágenes celulares

Las celdas eran de plata de la cubierta de vidrio y se desliza en 12 placas y transfectadas con 1 μ g de pSV2-dhfr-8,32 utilizando 5 μ g de Lipofectamine 2000. Después de 24 h, las células fueron infectadas con el VAC recombinante a los 3 PFU por célula. A las 12 h después de la infección, las células fueron fijadas con 4% paraformaldehido fría en buffer fosfato salino (PBS) a temperatura ambiente durante 20 min. Fijo células fueron permeabilized por 5 min con PBS que contiene 0,2% Tritón X-100 a temperatura ambiente. Permeabilized células fueron incubadas con anticuerpos primarios a una dilución 1:100 FBS 10% durante 30 min, lavadas con PBS tres veces, y luego incubadas con el anticuerpo secundario en una dilución de 1:100 en el 10% de SFB durante 30 minutos a temperatura ambiente. Después de lavar tres veces con PBS, se incubaron cubrir desliza con colorante Hoechst durante 10 min a temperatura ambiente para visualizar el ADN de manchas. Manchadas células fueron lavadas con PBS y ampliamente cubierta desliza montado en el 20% de glicerol. Celular fluorescencia fue examinado bajo una Leica TCS NT invertido microscopio confocal y las imágenes se superpone usando Adobe Photoshop versión 5.0.2.

Para vivir de imágenes celulares, células HeLa fueron chapada en ~ 80% confluencia en TC3 platos (Bioptechs, Inc), y con 3 PFU infectados de virus por célula al día siguiente. Las células se visualiza, ya sea por vídeo o microscopía confocal. Por microscopía de vídeo, una cámara y Hammumatsu C5985 controlador se asigna a una Leica DMIRBE invertido microscopio de fluorescencia. Las imágenes fueron digitalizadas mediante un IC-PCI de la tarjeta de captura de video (Coreco Imaging, Inc) controlado por software Image Pro Plus. Las células se mantuvieron en un acalorado TC3 etapa (Bioptechs, Inc) con la temperatura a 37 ° C.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

FDS participado en el diseño y la coordinación del estudio, la adquisición y el análisis de datos, y la preparación del manuscrito. BM diseñó y coordinó el estudio, con la ayuda en el análisis de datos y contribuyó a la preparación del manuscrito.

Agradecimientos

Damos las gracias a Norman Cooper con la ayuda inestimable de cultivo celular, para ayudar a Owen Schwartz en microscopía confocal y en directo de imágenes celulares, y Mike Baxter por su asistencia en la PCR en tiempo real. A. y A. McBride Belmont siempre plásmidos y Condit R. y F. Falkner donado mutante virus y una línea celular.