Cancer Cell International, 2005; 5: 7-7 (más artículos en esta revista)

Downregulation actividad de la calcineurina en el carcinoma de cuello uterino

BioMed Central
S Padma (padma@cdfd.org.in) [1], A Pavani Sowjanya (pavani@cdfd.org.in) [1], Usha Rani Poli (ushapoli@yahoo.co.in) [2], Meenakshi Jain ( Docmeena@rediffmail.com) [3], BN Rao (bachi_n_rao@yahoo.com) [2], Gayatri Ramakrishna (gayatri@cdfd.org.in) [1]
[1] Centro de Diagnóstico y DNA Fingerprinting, Nacharam, Hyderabad, AP, India
[2] MNJ Instituto de Oncología y el Centro Regional de cáncer, Hyderabad, AP, India
[3] Mediciti Hospital, Medchal, AP, la India

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Calcineurina (CaN) es un importante serina-threonine fosfatasa (PP2B), que desempeña un papel crucial en el calcio-calmodulina transducción de la señal mediada por los acontecimientos. Calcineurina ha sido implicado en la patogénesis de diversas enfermedades hipertrofia cardiaca, la neuropatía diabética y la enfermedad de Alzheimer, sin embargo su papel en la neoplasia sigue siendo poco clara.

Resultados

En vista de esta Evaluación de la actividad de la calcineurina en el suero y biopsia de las muestras obtenidas de mujeres con diagnóstico de carcinoma de células escamosas invasivo de cuello uterino. Una reducción significativa se observó en la actividad de la calcineurina en pacientes con cáncer de cuello de útero en comparación con el grupo control. Sin embargo, la actividad de la calcineurina no han sufrido modificaciones en el cuello uterino raspaduras obtenidos de pacientes con diagnóstico de bajo grado escamosa lesiones intra epiteliales (LSIL). Curiosamente downregulation de la actividad de la calcineurina en carcinomas de células escamosas no fue acompañada de ningún cambio significativo en el ADN de afinidad del factor de transcripción NFAT (Nuclear Factor activado de células T). Todo el carcinoma de células escamosas muestras utilizadas en el presente estudio fueron positivos de alto riesgo para el virus del papiloma humano (VPH) tipos.

Conclusión

El presente estudio demuestra la downregulation de la calcineurina actividad en el carcinoma de células escamosas de cuello uterino con un alto riesgo de infección por VPH. Llegamos a la conclusión de que las perturbaciones en la calcineurina mediada vía pueda participar en el desarrollo de neoplasia cervical.

Introducción

El cáncer cervicouterino es una de las enfermedades neoplásicas más frecuentes que afectan a las mujeres en todo el mundo, especialmente en los países en desarrollo [1, 2]. En la India, neoplasia cervical no sólo es la neoplasia maligna más frecuente, pero también una de las principales causas de muerte entre las mujeres de mediana edad en particular en las zonas rurales [3, 4]. Es bien sabido ahora que la infección con el virus del papiloma humano (VPH) es un importante factor de riesgo etiológico para el desarrollo de cáncer cervical, sin embargo otros host / factores ambientales contribuyen a la progresión de la enfermedad [5 - 7]. La infección con VPH puede modular la acogida factores que intervienen en las cascadas de señalización y de la desregulación de las vías de señalización es un rasgo distintivo del cáncer. Una característica importante de la vía de transducción de señales es reversible serina / threonine fosforilación de las proteínas aberrantes y cualquier actividad en el quinasas o fosfatasas puede perturbar la fosforilación / dephosphorylation ciclo conduce a la proliferación descontrolada. Por lo tanto, la identificación de las principales moléculas de señalización (quinasas y fosfatasas) que se encargan de desarrollo neoplásico puede tener relevancia clínica potencial que permite el diagnóstico, la detección precoz y la intervención.

Hay una plétora de información que existe sobre la participación de diversas quinasas tales MAPK [8], PI3K [9], JNK [10], cdk4 [11, 12], cdc2 [13], Her2 [14], p38 [15] Etc, en células de carcinoma de cuello uterino. Si bien el fosfatasas como cdc25A / C PTEN y han demostrado ser asociados con el cáncer cervical [12, 16, 17], la información existente no está a la altura de la participación de serina / threonine proteínas fosfatasa miembros de la familia a saber., PP1, PP2A, PP2B (calcineurina) y PP2C. Sólo hay un informe, que demuestra downregulation de la proteína fosfatasa 1, de reglamentación subunidad en las células del cáncer del cuello del útero [18]. En vista de la limitada información disponible sobre la participación de la serina / threonine fosfatasa, se hizo un intento en el presente estudio para investigar si existe alguna asociación entre la calcineurina y cervical neoplasia.

Calcineurina es la única serina / threonine fosfatasa cuya actividad es modulada por tanto de calcio y calmodulina y es un mediador crucial de la calcio mediada por vías de transducción de señales. Heterodimeric calcineurina es una proteína que consiste en una subunidad catalítica (calcineurina A), con un activo centro de metal vinculante, y una subunidad reguladora (calcineurina B), que se une al calcio [19]. Una de las principales funciones de la calcineurina es la activación de células T por dephosphorylation del factor de transcripción NFAT (Nuclear Factor activado de células T) [20]. Calcineurina participa en una amplia variedad de respuestas biológicas incluyendo el desarrollo neuronal y muscular, neurite resultado, la morfogénesis de los vertebrados válvulas cardíacas, de la memoria de desarrollo, de comportamiento respuesta etc [21 - 26]. Además, la calcineurina también ha sido implicado en la patogénesis de enfermedades como la hipertrofia cardiaca, la enfermedad de Alzheimer, la esquizofrenia, la nefropatía diabética y el síndrome de Down [27 - 32]. Calcineurina, desempeña un papel en la inducción de la apoptosis a través de la citocromo c / caspasa dependiente de la vía y por dephosphorylating Bad, un proapototic miembro de la familia Bcl-2 [33, 34]. Estudios recientes también han demostrado la participación de la calcineurina en el ciclo celular por regulación de la cdk4 (dependientes de ciclina quinasa 4), un G 0 / G 1 puesto de control de los elementos [35]. El inmunosupresor ciclosporina A (CsA), que inhibe específicamente la actividad calcineurina, ha demostrado ser una herramienta útil en la comprensión de la función de la calcineurina en diversos procesos celulares. CsA se ha demostrado que ejercen un efecto antiproliferativo, no sólo en células T, sino también en una amplia variedad de células incluyendo los linfomas, los queratinocitos, fibroblastos y células musculares lisas que indica que la actividad calcineurina es importante para la progresión del ciclo celular [36]. En contraste con la acción antiproliferativa de CsA en el sistema de cultivo de células, se ha demostrado que el tratamiento con CsA en los receptores de trasplante renal se asocia con aumento de la incidencia de cáncer renal [37, 38]. Sin embargo todavía no está claro si la génesis del cáncer en las personas de CsA administrada se debe a la inhibición de la calcineurina directa mediada por otras vías o de sus efectos indirectos. Esto merece un estudio relativo a la participación de la calcineurina en la progresión del cáncer y, por tanto, el presente estudio fue realizado para determinar la importancia de la calcineurina en la neoplasia cervical.

Materiales y métodos
La recolección de especímenes

Para el presente estudio consentimiento del paciente y se tomó el estudio fue aprobado por el comité institucional de bioética. Biopsia de cuello uterino, se recogieron muestras (N = 45) de las mujeres diagnosticadas con cáncer invasor. La biopsia de las muestras obtenidas de pacientes fueron inmediatamente broche de congelados en nitrógeno líquido. Muestras de tejido del cuello del útero (N = 30) recogidos de las mujeres sometidas a histerectomía por condiciones no neoplásicas formaron el grupo control. Las muestras de sangre (3 ml) fueron colectadas en botellas de llanura [sin anticoagulante] de los normales y los pacientes con cáncer. Se permitió que la sangre coagule y el suero fue separado por centrifugación a 3000 rpm durante 10 minutos a temperatura ambiente. Las muestras de suero fueron almacenadas a -20 ° C hasta su uso ulterior.

Cervical raspaduras también fueron recolectados a través de Ayer's espátula de las mujeres que asisten a la clínica ambulatoria de cuello de útero (N = 30). Cuatro de estas mujeres tenían bajo grado de lesión intraepitelial (LSIL) y el resto sólo con la inflamación crónica de la citología. El cuello uterino se recogió en raspar refrigerados buffer fosfato salino (pH 7,2) y las células se recogieron por centrifugación a 13000 rpm durante 10 min a 4 ° C. El sobrenadante fue descartado y las células fueron inmediatamente congeladas en nitrógeno líquido hasta nuevo uso.

Preparación de la muestra

Tejidos (100 mg) y cervical raspaduras fueron homogeneizadas en 500 μ l o 250 μ l de buffer A, respectivamente, que contiene 25 mM HEPES (pH 7.2), 150 mM NaCl, 1% NP-40, 10 mM MgCl 2, el 10% de glicerol, 10 Μ g / ml PMSF y 10 μ g / ml aprotinina durante 3 min. El homogeneizado se procedió a la eliminación de los escombros por centrifugación a 13000 rpm durante 10 min a 4 ° C. Los sobrenadantes se alicuotar y almacenados a -70 ° C hasta su uso ulterior.

Determinación de la calcineurina

Una alícuota de la muestra homogeneizada (100 μ l) fue aprobada a través de sephadex G-25 la columna (Amersham Pharmacia) para eliminar el fosfato libre y más utilizado para la actividad de la calcineurina. La proteína de estimación se hizo utilizando el Kit de BCA [Pierce empresa] como por los fabricantes de protocolo. Calcineurina actividad fue ensayada en un volumen total de 50 μ l contiene 25 μ l de 2X ensayo buffer (200 mM NaCl, Tris 100 mM [pH 7,5], 12 mM MgCl 2, 1 mM CaCl 2) y 5 μ l de la célula o tejido homogenado . Las muestras fueron incubadas con 2X-buffer de ensayo durante 10 minutos a 30 ° C. El volumen total se ajustó a 50 μ l con la adición de agua. Las reacciones fueron iniciados por la adición de RII phosphopeptide [5 μ M] y se incubaron por un período adicional de 10 minutos a 30 ° C. Las reacciones fueron terminados por adición de 100 μ l de reactivo Malachite verde (3 vol. Malachite de 0,045% y 1 verde vol. 4,2% de molibdato de amonio en HCl 4N). El color se le permitió desarrollar durante 30 minutos y leer la absorbancia a 660 nm. La actividad de la calcineurina se calculó como mmoles de fosfato inorgánico liberado / min / mg de proteína total en el caso de los tejidos y de muestras de suero como mmoles de fosfato inorgánico liberado / min / dl de suero.

Determinación de la calmodulina y calcineurina contenido en el tejido lisados

La calmodulina y calcineurina Se determinó el contenido de la competencia por los métodos de ELISA, tal como se describe anteriormente [39]. La calcineurina de anticuerpos contra la subunidad catalítica A se utilizó en este estudio.

Movilidad electroforética cambio de ensayo para NFATc de ADN obligatorio

Cambio de ensayo de movilidad electroforética (EMSA) se ha realizado mediante el consenso con oligonucleótido sitio de unión para NFATc (5'CGCCCAAAGAAAATTTGTTTCATA3 '). En pocas palabras, biopsia de tejidos fueron homogeneizados y de la nuclear de pellets se recogió por centrifugación (600 × g: 10 min, 4 ° C). La nuclear lisados (100 μ g) se prepararon y se incubaron en 25 μ l de mezcla de reacción que contiene polydI / dC, 10X vinculante de amortiguación (50 μ M ZnCl 2, 0,25 mM DTT, 20 mM Tris [pH 7,5], 60 mM KCl, 1 mM MgCl 2 0,1 mM EDTA, 10% de glicerol) y la etiqueta oligo de 30 minutos a temperatura ambiente. Las reacciones se dieron por terminadas utilizando 25 μ l de la carga de tintes y cargaron en un 7% de gel de ensayo de retardo en gel. La carrera se realizó a 250 V durante 3 horas a 4 ° C. Al final del plazo, el gel fue removido, secado y expuesto en un phosphoimager noche a la mañana a temperatura ambiente.

VPH y la prueba de mecanografía -

El ADN aislado de las muestras de carcinoma de células escamosas se realizarán las pruebas de la presencia de VPH por PCR basada invertir línea blot ensayo tal como se describe anteriormente (40)

Análisis estadístico

Las comparaciones entre el normal y el cáncer de muestras se realiza utilizando la prueba t de Student para datos apareados.

Resultados
1. Actividad de la calcineurina en suero y tejido del cuello del útero (normal vs carcinoma de células escamosas)

Calcineurina actividad fue ensayada en ambos sueros y tejidos lisado por la medición de la RII dephosphorylation de péptido, un sustrato de la calcineurina. La biopsia de las muestras obtenidas de los pacientes con cáncer fueron clasificadas como moderadamente diferenciado de células grandes no keratinising carcinomas de células escamosas de cuello uterino. Se observó una reducción significativa en la actividad de la calcineurina, tanto en los tejidos del cuello uterino (p = 0,0001) y suero (p = 0,0037) de los pacientes con cáncer invasor, en comparación con el grupo control (Fig. 1]. Cabe señalar que hemos calculado la actividad de la calcineurina en el suero como mmoles de fosfato liberado / min / decilitro. Sin embargo, si tenemos en cuenta el contenido de proteína total por decilitro de suero de cada muestra y, en consecuencia, calcular la actividad de la calcineurina por miligramo de proteína de suero, la actividad de la calcineurina en el suero será mucho menor que la de los tejidos. Dado que la norma internacional para la representación de las unidades de la actividad enzimática de suero o plasma está representado en unidades por decilitro / litro, el mismo ha estado representado en la Fig. 1a.

2. Calmodulina y calcineurina A contenido en los tejidos del cuello del útero (normal vs carcinoma de células escamosas)

La calmodulina y calcineurina contenidos también fueron analizados en la toma de biopsias para evaluar si la disminución de la actividad de la calcineurina podría ser correlacionada con sus respectivos contenidos. El contenido de ambos calcineurina Una subunidad calmodulina y se midió usando el método de ELISA competitiva en la muestras de tejidos. No ha habido cambios en el nivel de la calcineurina A entre el control y el cáncer (Fig. 2]. Curiosamente, hubo un aumento significativo en el nivel calmodulina en el carcinoma de cuello uterino (Fig. 3].

3. Calcineurina en la actividad de bajo grado de células escamosas intraepiteliales lesiones

Para correlacionar la disminución de la actividad de la calcineurina con los primeros cambios displásicas, recogidos cervical raspaduras de treinta las mujeres que asisten al departamento de servicios ambulatorios en el hospital. De estos cuatro fueron diagnosticados de bajo grado de lesiones escamosas intraepiteliales (LSIL) de la citología y el resto eran citológicamente normal, pero con la inflamación crónica. No se observó ningún cambio significativo en la actividad de la calcineurina entre las LSIL y los controles en las raspaduras cervical (Fig. 4].

4. NFAT actividad

En vista de nuestra observación sobre downregulation actividad de la calcineurina en el carcinoma de cuello uterino, quisimos investigar si hay alguna alteración en el ADN vinculante de la actividad de NFAT, uno de los principales sustratos de la calcineurina. Se analizaron los extractos nucleares a partir del 5 de carcinoma de células escamosas y el 5 de los controles por incubando el radiomarcado con sondas de oligonucleótidos específicos para NFAT vinculante. Curiosamente no hemos encontrado ningún cambio significativo en el ADN del NFAT afinidad entre el cáncer y las muestras de control (Fig. 5].

5. VPH y la prueba de mecanografía

Una basada en la PCR inversa línea mancha de ensayo (40) fue utilizado para comprobar la presencia de tipos de VPH en los carcinomas de células escamosas. Hemos podido detectar los tipos oncogénicos del VPH (16,18,31,45 etc) en todo el cáncer cervical, pero ninguno en las muestras de control, sin embargo no hemos podido correlacionar la presencia de tipos de VPH con cualquier variación en la actividad de la calcineurina (datos no Muestra).

Discusión

El presente estudio muestra downregulation actividad de la calcineurina en el cáncer cervical invasivo. Alta actividad de la calcineurina puede conducir a la apoptosis [33], lo que indica que la actividad de la calcineurina en downregulation puede ayudar en la supervivencia celular promoviendo así la progresión neoplásica. En un estudio previo [41] una disminución de la actividad de la calcineurina en células MCF-7 tras el ácido retinoico tratamiento se ha relacionado con downregulation en el nivel de expresión de la subunidad catalítica (A) de la calcineurina, sin embargo, en nuestro estudio no hemos encontrado ningún alteraciones En el nivel de la calcineurina A.

La base de la disminución de la actividad de la calcineurina observado en la neoplasia cervical en ausencia de un cambio en Calcineurin Un contenido debe ser identificado y que especular que un cambio en el estado redox de la célula de cáncer debido a estrés oxidativo contribuye a la alteración en la actividad de Calcineurina, sin alterar su contenido. Calcineurina, en virtud de su Fe 2 +-Zn 2 + binuclear centro en su sitio activo es oxidado a Fe 3 +-2 + Zn superóxido y de peróxido de hidrógeno iones [42]. Superóxido dismutasa (SOD), una enzima de la basura de radicales libres, protege la calcineurina de inactivación por superóxido y el peróxido de hidrógeno iones [43, 44]. Los bajos niveles de antioxidantes, como el glutatión, la vitamina E y C, así como la superóxido dismutasa se han notificado a ser menor en el cáncer cervical [45, 46], que a su vez puede modular la actividad de la calcineurina. Curiosamente, el menor SOD en circulación en el cáncer cervical [46] pueden tener un papel en la downregulation de la actividad de la calcineurina suero. Es evidente que hay una fuerte evidencia sobre la participación de especies reactivas de oxígeno (ROS) en el cáncer cervical [47] y lo más probable es que puede alterar la actividad de la calcineurina al menos en los tejidos sin afectar a su expresión. Este argumento está apoyado también por una observación de que la actividad de la creatina quinasa B, una proteína sensible ROS, es downregulated en cáncer cervical [48]. Otro posible mecanismo de inhibición de la calcineurina en la actividad es a través de upregulation natural endógeno inhibidores de la calcineurina como calcipresina 1/DSCR1 y forskolin proteína de unión [31, 49]. La función de estos reguladores negativos de la calcineurina en el cáncer cervical no es conocido. Sin embargo es interesante observar que modula el estrés oxidativo calcipresina expresión y fosforilación estado [50], que a su vez pueden afectar a la actividad de la calcineurina.

La historia natural del cáncer cervical invasivo implica secuencial la progresión de la infección por VPH persistentes a reversible LSIL (CIN1) y, a continuación, de alto grado de lesión intraepitelial escamosa (HGIL/CIN2). En la presencia de otros factores precipitantes LIEgA es un precursor directo del cáncer invasivo [51]. Valorar si la actividad de la calcineurina es también alterada a principios de lesiones hemos examinado la actividad de la calcineurina en cervical raspaduras LSIL recogidos de los casos. Curiosamente, no hubo alteración significativa en la actividad de la calcineurina en las primeras lesiones precursoras (LSIL), en comparación con el grupo control. Ninguna de las muestras recogidas en este estudio eran de LIEgA. Hay que sin embargo señaló que a diferencia de las biopsias de carcinoma de células escamosas en su mayor clonal de las células malignas derivados, el de cuello uterino es raspaduras recogido una población mixta de la normal y la células displásicas. Es posible que la inmensa mayoría de las células normales del cuello del útero en las raspaduras con diagnóstico de LSIL, no se observaron diferencias significativas en la actividad de la calcineurina entre el grupo control y LSIL. Por otra parte, varias de las muestras de LSIL y LIEgA lesiones precursoras tienen que ser analizadas antes de que excluye la posibilidad de la calcineurina participación en las primeras etapas de la progresión del cáncer cervical. No obstante, la significativa disminución de la actividad de la calcineurina invasoras en el carcinoma de células escamosas es sugestiva de su papel en la neoplasia cervical.

La regulación de la expresión génica en respuesta a estímulos de calcio es uno de los más explorados funciones de la calcineurina. Es importante destacar que el objetivo fundamental de la calcineurina es la NFAT familia de factores de transcripción. Calcineurina dephosphorylates NFAT que permite la translocación de esta proteína en el núcleo [19]. Los estudios realizados sobre preadipocyte línea celular (3T3-L1) han demostrado que la expresión constitutiva de NFATc1 puede inducir transformación celular proporcionar una evidencia directa para el potencial oncogénico de la NFATc1 factor de transcripción [52]. Además, NFAT también se ha vinculado a la metástasis del tumor [53]. En vista de lo anterior evidencia, que es de su interés investigar la activación de NFAT en el cáncer cervical. No hubo grandes diferencias en el ADN de afinidad NFAT nucleares de extractos obtenidos de cáncer y de las muestras de control. Los resultados de la actividad sin alterar el ADN vinculante de NFAT parecen en contradicción a la vista de la reducida actividad de la calcineurina en la neoplasia cervical. Sin embargo, es posible que la regulación de NFAT por calcineurina es tipo de células específicas y no se ve afectado por la calcineurina en las células cervicales. Otra posibilidad podría ser, que la calcineurina se sabe que existen en las distintas isoformas (α, β, ↓), y es probable que las isoformas existentes en el cuello del útero tiene una forma distinta especificidad por el sustrato. Además de NFAT, calcineurina también puede modular el estado de fosforilación de otras proteínas reguladoras, como Bad, IkB y NFkB, que a su vez puede promover la neoplasia por perturbar el equilibrio existente entre la proliferación y la muerte celular [30, 54]. Ya mediada la vía de NFkB se sabe que se upregulated en la progresión del cáncer cervical [55]. Disminución de la actividad de la calcineurina podría conducir a la supervivencia celular por la desregulación de estos grandes jugadores con lo cual se mantienen el fenotipo maligno de la neoplasia cervical.

Conclusión

En conclusión, nuestro estudio piloto es indicativo de un posible papel de la calcineurina mediada vía en la patogénesis de la neoplasia cervical. Aunque NFAT es un importante objetivo de la calcineurina, nuestro estudio descarta la participación de este factor transcripcional que indica la presencia de una vía de la calcineurina NFAT independiente al menos en el cáncer cervical. La presente investigación ha abierto nuevas vías para evaluar aún más el papel de la calcineurina en la progresión del cáncer cervical.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

SP llevado a cabo ensayos de la calcineurina y la recopilación de datos. La prueba del VPH y el cáncer de cuello uterino a escribir en las muestras fue realizada por APS. Ambos SP y APS realizado NFAT ensayo. Las muestras fueron proporcionadas por URP, MJ y el Banco Central de Rwanda. El estudio fue concebido y coordinado por el GR. El manuscrito fue finalizado por los RG y aprobada por todos los investigadores.

Agradecimientos

Damos las gracias a todas las mujeres que participaron en este estudio. SP recibió el apoyo de una beca del Departamento de Biotecnología. Patti Gravitt damos las gracias por ayudarnos con PCR línea blot. La PCR línea blot reactivos son una especie de regalo de Janet Kornegay, de diagnóstico de Roche, EE.UU.. Damos las gracias a Sangita Mukhopadhyay con sugerencias útiles sobre la AESM.