Genetic Vaccines and Therapy, 2005; 3: 3-3 (más artículos en esta revista)

Evaluación de la proteína VP22 para la mejora de una vacuna de ADN contra el ántrax

BioMed Central
Stuart D Perkins (sdperkins@dstl.gov.uk) [1], Helen C Flick-Smith (hcfsmith@dstl.gov.uk) [1], Helen S Garmory (hsgarmory@dstl.gov.uk) [1], Angela E Essex-Lopresti (aeelopresti@dstl.gov.uk) [1], Freda K Stevenson (fs@soton.ac.uk) [2], Robert J Phillpotts (bjphillpotts@dstl.gov.uk) [1]
[1] Departamento de Ciencias Biomédicas, de Defensa de la Ciencia y la Tecnología de Laboratorio, Porton Down, Salisbury, Wiltshire, SP4 OJQ, UK
[2] Tenovus Laboratorio de la Universidad de Southampton Hospital NHS Trust, Southampton, SO16 6YD, UK

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Anteriormente, expresaron antígenos de vacunas de ADN se han fusionado a la proteína VP22 del virus del Herpes simple tipo I con el fin de mejorar la eficacia. Sin embargo, el mecanismo inmune de mejorar VP22 no es muy conocida y sugerencias iniciales que pueden mediar VP22 intercelular propagación se han cuestionado. A pesar de ello, la fusión de VP22 a antígenos expresados de vacunas de ADN ha mejorado la respuesta inmune, en particular a los no secretan antígenos.

Métodos

En este estudio, hemos fundido el gen de la proteína VP22 al gen de antígeno protector (PA) del Bacillus anthracis, el agente causal del ántrax. Inmunidad protectora contra la infección con B. Anthracis es casi en su totalidad sobre la base de una respuesta a la Autoridad Palestina y hemos generado dos construcciones, en donde se funde VP22 ni a la N-o el C-terminal de 63 kDa de la proteasa-cleaved fragmento de la Autoridad Palestina (AP 63).

Resultados

Después de la inmunización de genes pistola de A / J ratones con estas construcciones, se observó ninguna mejora en la lucha contra el PA respuesta de anticuerpos generados. Después de un reto intraperitoneal con el 70 50% de la dosis letal B. Anthracis cepa STI esporas, ninguna diferencia en la protección era evidente en los grupos inmunizados con la vacuna de ADN que expresan PA 63 vacunas de ADN y la expresión de proteínas de fusión de la PA 63 con VP22.

Conclusión

VP22 fusión no mejora la protección de A / J ratones contra el reto de esporas en vivo tras la vacunación de las vacunas de ADN que expresan PA 63.

1,0 Antecedentes

El VP22 proteína es un componente importante de la región tegumento amorfo de los virus de Herpes simple tipo I (HSV-1). Compuesta de 301 aminoácidos, lo que se conoce como una proteína de transducción de dominio capaces de mediar intercelular propagación. Al igual que otras proteínas translocatory como antennapedia y de la proteína Tat del VIH, es muy básico, es capaz de obligar a la heparina o ácido sialic y las tres proteínas tienen un casi idéntico predijo pI [1]. VP22 ha informado de que sean capaces de salir de la celda en la que es sintetizado a través de un uncharacterised, golgi-independiente vía secretora y, posteriormente, entrará en torno a las células por un mecanismo no endocítica. Estas propiedades pueden ser retenidos después de la fusión de otras proteínas [2].

La capacidad de de succión proteínas o péptidos en las células pueden ser particularmente útiles para la terapia génica. Timidina quinasa y p53 se han beneficiado de la fusión con VP22 [3, 4]. VP22 se ha fusionado a las proteínas y entregados por un vector viral. Por ejemplo, p53 emitido por un adenovirus vector [5, 6], GFP dictada por un lentivirus vector [7] y el Virus del Papiloma Humano E7 antígeno dictada por un replicón Sindbis [8, 9] han demostrado ser más eficaces VP22 después de la fusión.

Sin embargo, la capacidad de mediar VP22 intercelular propagación ha sido cuestionada, sobre la base de estudios in vitro que utilizan metanol fijación. Porque el metanol se disuelve membranas celulares, puede producir un artefacto interpretarse como propagación célula a célula [10]. En otros estudios, el transporte no puede ser detectado en células vivas [11] y de una proteína de fusión de la toxina de la difteria y VP22 A (una sola molécula de la que es letal a una celda) no puede cruzar la membrana celular y causar un efecto citotóxico mensurables [ 12]. Un análisis crítico de la literatura ha llevado a la conclusión de que los efectos de la VP22 puede explicarse por bien establecido que los principios biológicos VP22 causas de liberación de las células, posiblemente por la muerte de la célula. A raíz de esto, la proteína de Mayo se unen a las células vecinas, pero no de manera eficiente penetrar las membranas celulares [1].

Independientemente de si puede mediar VP22 intercelular propagación sin embargo, VP22 in vivo pueden mejorar las respuestas a una serie de antígenos no sólo en el contexto de la terapia génica, sino también cuando se fusionó a los antígenos dentro de una vacuna de ADN. Esto podría ser particularmente útil ya que si bien las vacunas de ADN pueden ofrecer protección contra una amplia variedad de agentes patógenos en los pequeños modelos animales, su eficacia en modelos animales y más grandes primates no es suficiente. En este estudio, se ha evaluado el potencial de VP22 para mejorar las vacunas de ADN contra el ántrax.

La formación de esporas de la bacteria Bacillus anthracis causas de la enfermedad de ántrax. El actual Reino Unido con licencia de la vacuna es un alumbre de filtrado de un precipitado B. Anthracis Sterne cepa de la cultura, administrados por vía intramuscular, que a veces causa algunos transitorios reactogenicidad en vacinees [13]. Los EE.UU. con licencia de la vacuna es el Ántrax Vaccine Adsorbed (BioThrax-AVA) de vacunas producidas a partir de la cultura de la fracción sobrenadante V770-NP1-R cepa [14].

El componente clave en estas dos vacunas es el antígeno protector (PA), que junto con el factor letal (LF) y el factor edema (EF) forma un tripartito toxina y es uno de los factores de virulencia de la bacteria [15]. Célula huésped intoxicación se cree que se producen después de la plena unión de la longitud 83 kDa PA a la acogida del receptor de membrana celular. Los 20 kDa fragmento N-terminal del PA es cleaved por furin proteasa exponer a la LF-EF sitio de unión [16]. El 63 kDa PA heptameric fragmentos forman un poro, el LF o EF y obligará a todo el complejo de la toxina es internalizada [17, 18].

Vacunas de ADN contra la B. Anthracis expresar ya sea el fragmento de 63 kDa PA [19, 20] o de la proteína de 83 kDa PA han tenido éxito [21]. Protección contra la letal toxina reto en ratones Balb / c ratones o un desafío de esporas en conejos NZW puede lograrse ya sea por vía intramuscular o pistola de genes de vacunación [19 - 22]. Los intentos de mejorar la eficacia protectora de las vacunas de ADN contra el ántrax son co-administración con una vacuna de ADN que expresan LF, y un primer ADN / proteína impulsar régimen [20] o el uso de lípidos catiónicos [22].

El objetivo de este estudio fue evaluar el potencial de VP22 para mejorar la inmunogenicidad de una vacuna de ADN que expresa el fragmento de 63 kDa PA (PA 63) adjunto a una señal de secreción. La proteína VP22, que ya ha sido demostrado para mejorar el rendimiento de las vacunas de ADN [23 - 26], fue fundido ni a la N-o el C-terminal de la PA 63. Nos muestran que tras la administración de genes pistola de estas vacunas, la fusión con VP22 no mejora anti-PA respuestas de anticuerpos a la Autoridad Palestina 63 vacunas de ADN, ni aumenta la protección contra el ántrax letales esporas desafío.

2,0 Métodos
2,1 Construcción de vacunas de ADN

La vacuna de ADN pGPA contiene la secuencia de señales para el activador del plasminógeno fundido a la N-terminal del gen de los 63 kDa fragmento de la AP [19] y fue una especie de regalo de Dennis Klinman (Administración de Alimentos y Medicamentos, EE.UU.). Para incluir VP22 la secuencia de aminoácidos derivados de 159 - 301, que posee la plena actividad de transporte de la proteína nativa (tanto la intrínseca capacidad de transporte y la capacidad de desempeñar las proteínas de gran tamaño [27]], la siguiente estrategia fue empleada. Para construir la carretera N-terminal de la fusión, el gen de la VP22 secuencia de amplificación de PCR se pCR ® T7/VP22-1 (Invitrogen), utilizando primers VP22 F9 (5 'ACTCTAGCTAGCACGGCGCCAACCCGATCCAAGACA ACTCTAGCTAGCACGGCGCCAACCCGATCCAAGACA ACTCTAGCTAGCACGGCGCCAACCCGATCCAAGACA 3') y VP22 R8 (5 'ATTGTCACGGTCTGGAACCGTAGGAGCAGCTGGACCTGGACCCTCGACGGGCCGTCTGGGGCGAGA 3' ). Además, el gen de la PA 63 se pGPA de amplificación de PCR usando primers PA F8 (5 'CCTACGGTTCCAGACCGTGACAAT 3') y PA R9 (5 'CGCGGATCCTTATCCTATCTCATAGCC CGCGGATCCTTATCCTATCTCATAGCC CGCGGATCCTTATCCTATCTCATAGCC 3'). Las dos secuencias fueron fusionados juntos por PCR [28] usando primers VP22 F9 y PA R9.

Para crear el C-terminal de la fusión, el gen de la PA 63 secuencia fue amplificado por PCR usando primers pGPA PA F11 (5 'CTAGCTAGCCCTACGGTTCCAGACCGTGACAAT CTAGCTAGCCCTACGGTTCCAGACCGTGACAAT CTAGCTAGCCCTACGGTTCCAGACCGTGACAAT 3') y PA R10 (5 'TGTCTTGGATCGGGTTGGCGCCGTAGCAGCTGGACCTGGACCTCCTATCTCATAGCC 3'). El gen para VP22 fue amplificado por PCR pCR ® T7/VP22-1 (Invitrogen), utilizando primers VP22 F10 (5 'CGGCGCCAACCCGATCCAAGACA 3') y VP22 R11 (5 'CGCGGATCCTTACTCGACGGGCCGTCTGGGGCGAGA CGCGGATCCTTACTCGACGGGCCGTCTGGGGCGAGA CGCGGATCCTTACTCGACGGGCCGTCTGGGGCGAGA 3'). Las dos secuencias fueron fusionados juntos utilizando VP22 F10 y VP22 R11 fusión por PCR [28]. La PCR primers utilizados para crear fusiones de los dos genes fueron diseñados para incorporar una secuencia de enlazador Gly-Pro-Gly-Pro-Ala-Ala VP22 entre el PA y 63 proteínas, para permitir el plegado de la proteína de fusión. El uso de los sitios de restricción NheI NheI y BamHI BamHI, el PA 63 de genes se exised de pGPA y el gen se ligated fusiones en el vector de forma pSTU-PA-22 (N-terminal de la fusión) y pSTU-PA-22 (C-terminal de fusión ). Estas construcciones fueron verificadas por la secuencia y se representa esquemáticamente en la figura 1.

El control de vacunas de ADN sólo expresando VP22 (pSTU22), se ha descrito previamente [26]. El plásmido de ADN se prepara usando Qiagen Endofree columnas de purificación de ADN (Qiagen Ltd).

2,2 Western blot de proteínas expresadas

África Green Monkey Riñón células COS-7 (European Collection of Animal Cell Cultures, Porton Down) fueron chapada en 1-5 × 10 5 células y -1 en 6 y placas (Corning). Las células fueron transfectadas con 1 μ g de plásmido de ADN utilizando el reactivo de transfección Polyfect (Qiagen) de acuerdo con las directrices del fabricante. Transfectadas lisados de células fueron separadas por 4-20% electroforesis en gel de poliacrilamida (Tris-Glicina gel, Invitrogen), utilizando XCell SureLock ™ Mini-Cell aparato (Invitrogen), según el protocolo del fabricante. Proteínas de las gel fue transferido a nitrocelulosa por electroblotting (Invitrogen). Un kit ECL Western Blot (Amersham Biosciences) se utiliza con anticuerpos a la Autoridad Palestina (antisueros policlonales de conejo) o VP22 (sueros policlonales de conejo) para detectar la expresión de vacunas de ADN.

2,3 vacunación de ratones Balb / c mice

Grupos de mujeres de 10 A / J mice (Harlan OLAC) fueron inmunizados con 1 μ g de ADN recubierto en oro partículas y entregado usando una pistola de genes Helios ™ (BioRad), tal como se describe anteriormente [29]. Los ratones fueron inmunizados tres veces en intervalos de dos semanas. La sangre se tomó de la cola antes de la vena reto para los análisis de anticuerpos en suero por ensayo inmunoenzimático (ELISA).

2,4 Medición de anticuerpos anti-PA por ELISA

Microtitulación placas estaban cubiertas de 5 μ g ml -1 PA recombinante (Aldevron) en fosfato-salina tamponada con 50 μ l -1 y así se incubaron durante la noche a 4 ° C. Tres columnas en cada plato fueron recubiertos con anti-IgG (Fab) (Sigma) a fin de producir una curva estándar para la cuantificación de la concentración de IgG. Después de lavar tres veces con PBS que contenía 0,2% de Tween-20, una unión no específica fue bloqueada con 5% (w / v) de leche desnatada en polvo en PBS y las placas se incubaron por 2 horas a 37 ° C. Las placas se lavaron tres veces y se añadió el suero en una dilución a partir de la 1:50 en el amortiguador de bloqueo, y el doble-diluido en la placa. Isotipo IgG o normas (Sigma), diluido en amortiguador de bloqueo, se añadieron a los pozos que habían sido recubiertos con anti-IgG (Fab) (Sigma), y el doble diluido como antes. Las placas fueron incubadas durante 1,5 horas a 37 ° C antes de lavar y la adición de cabra anti-IgG de ratón (o anti-ratón isotipo IgG) conjugado con peroxidasa de rábano (Sigma), diluido en amortiguador de bloqueo. Las placas fueron incubadas durante 1 hora a 37 ° C, luego lavados 3 veces antes de la adición de sustrato ABTS (Sigma). Absorbancia a 410 nm se midió después de 20 minutos de incubación a temperatura ambiente y se analizaron con el software Ascent.

2,5 desafío con B. Anthracis

Tres semanas después de la final immunising dosis, los ratones fueron desafiados por vía intraperitoneal con B. Anthracis ITS (Tox + Cap -) esporas. Esporas suficiente para el desafío fueron retirados de las existencias culturas, lavada con agua destilada estéril, y resuspendido en PBS a una concentración de 7 × 10 5 esporas ml -1. Los ratones fueron retados con 100 μ l de volúmenes que contiene 7 × 10 4 esporas por ratón (equivalente al 70 50% de la dosis letal [s LD 50] [30]] y fueron controlados durante 18 días post desafío de determinar su estatus de protección. Humane puntos finales fueron observadas estrictamente a fin de que los animales que muestra una colección de signos clínicos que indicaban una infección letal, se sacrificaron.

2,6 Métodos estadísticos

Utilizó un modelo lineal con la comparación múltiple de Tukey posterior análisis de la prueba y el análisis estadístico de la supervivencia utilizando el Mantel-Haenszel Logrank test se realizaron con GraphPad Prism versión 3,02 para Windows, GraphPad Software, San Diego, California, EE.UU. http://www.graphpad. Com.

3,0 Resultados
3,1 in vitro de expresión de vacunas de ADN

Vacunas de ADN codificación PA 63, VP22 PA-63, PA 63-VP22 o VP22 (Figura 1] fueron transfectadas mono verde africano en las células del riñón (COS-7). Las células fueron cosechadas y procesadas para Western blot 48 horas de la transfección. Células transfectadas con la AP 63-codificación del ADN expresó vacuna una proteína de aproximadamente 68 kDa, que reaccionó con anticuerpos específicos de PA. Fusión de VP22 ni a la N-terminal o C-terminal de PA 63 dio lugar a una proteína de aproximadamente 90 kDa, que reaccionó con dos PA-VP22 de anticuerpos específicos y anticuerpos específicos (Figura 2]. Control de las células, transfectados con el ADN plásmido expresando VP22 sólo expresó una proteína de aproximadamente 22 kDa, que reaccionó con VP22-anticuerpos específicos. Algunos degradación de las proteínas PA 63 fue evidente, independientemente de que a VP22 fusionados o no. Sin embargo, la degradación de proteínas de fusión fueron reconocidos por tanto la lucha contra la Autoridad Palestina y los anticuerpos anti-VP22 lo que sugiere que este deterioro no se debe a la inestabilidad en el punto de fusión de las dos proteínas.

3,2 Anti-PA respuestas de anticuerpos tras la vacunación de genes pistola

Grupos de mujeres de 10 A / J ratones fueron inmunizados tres veces por arma de genes administración de 1 μ g de ADN plásmido intervalos de dos semanas. Las muestras de suero se recogieron 17 días después de la tercera inmunización (4 días antes del desafío). Sera de los ratones se analizaron para PA-IgG específica total (Figura 3]. Los ratones inmunizados con la AP 63-expresando vacuna de ADN producido una media titre de 27216 ng / ml total PA-IgG específica, en comparación con 18823 ng / ml y 19448 ng / ml para la VP22 AP-63 y AP-63-VP22 expresando vacunas de ADN Respectivamente. Estos títulos de anticuerpos de la PA-IgG específica total no difirió significativamente entre los tres grupos (p> 0,05, ANOVA de una vía con la comparación múltiple de Tukey posthoc análisis).

La protección contra el ántrax 3,3 esporas desafío

Los ratones fueron retados tres semanas después de la última dosis de 70 50% con la dosis letal de la B. Anthracis cepa STI por la vía intraperitoneal. La vacuna de ADN que expresan PA 63 confiere un 70% de supervivencia a los ratones inmunizados. En comparación, el 80% y el 50% de los ratones sobrevivieron después de la inmunización con vacunas de ADN expresando VP22-PA 63 y PA 63-VP22, respectivamente (Figura 4]. Por lo tanto la inclusión de la proteína VP22, ya sea en la N-o C-terminal de 63 PA no alteraron significativamente la protección de los ratones. Las tres vacunas que ofrecen un importante nivel de protección frente al ingenuo ratones. El análisis estadístico de la supervivencia se realizó a través de Mantel-Haenszel test Logrank (GraphPad Prisma).

4,0 Discusión

El virus Herpes simple tipo I proteína VP22 ha sugerido para mediar por salida intercelular propagación de las células en un golgi de modo independiente, y la entrada a las células adyacentes por un mecanismo no endocítica [2]. Sin embargo, los estudios in vitro de la proteína siendo concluyentes, con informes de que la aparente efectos de la VP22 pueden atribuirse a un artefacto producido por la metodología [1, 10, 31, 32]. A pesar de la controversia en torno a los estudios in vitro, in vivo, la mayoría de los trabajos muestra que VP22 tiene un efecto beneficioso, en particular en el campo de la terapia génica. Fusión de VP22 ni a la pro-droga de activar la enzima timidina quinasa [3] o el factor de transcripción p53 [5] se traduce en una mejora de su eficacia. Del mismo modo, la inclusión de esta proteína dentro de una vacuna de ADN puede incrementar la respuesta inmune. Antígenos demostrado beneficiarse de la fusión a la VP22 incluir Amarillo fluorescente de proteínas (YFP) [24], reforzada Green Fluorescent Protein (EGFP) [26] y el virus del papiloma humano (VPH) de proteína E7 [23, 25, 33, 34].

En este estudio, la proteína VP22 se ha fundido ni a la N-o C-termini del antígeno protector (PA), de B. Anthracis. Este antígeno expresado de una vacuna de ADN contra el desafío es de protección, ya sea con toxina letal (PA más LF) en ratones Balb / c ratones [19, 20] o esporas desafío en Nueva Zelanda blancos conejos [21]. Hemos utilizado un régimen de inmunización y dosis de prueba de ITS esporas diseñada para ofrecer importantes, pero no la plena protección de ántrax reto de A / J mice. Este diseño nos permitiría demostrar cualquier aumento de la protección debido a la fusión de VP22 a PA dentro de la vacuna de ADN. Nuestros resultados mostraron que la fusión de VP22 PA con 63, ya sea en término no aumentar significativamente anti-PA respuestas de anticuerpos frente a la Autoridad Palestina 63 vacunas de ADN. Tras desafío, las tres vacunas de ADN, ya sea expresando PA 63, VP22 PA-63 o PA 63-VP22 ofreció una protección significativa contra 70 LD s 50 de B. Anthracis unimmunised en comparación con ratones control. Sin embargo, la inclusión de VP22 no aumentar o disminuir la protección que ofrece en comparación con el AP 63-expresando vacuna de ADN solo. Esto sugiere que la fusión de VP22 ni a la N-o C-terminal de la Autoridad Palestina en un 63 vacunas de ADN, no altera ni la respuesta de anticuerpos obtenido in vivo o la protección otorgada a A / J mice siguiente reto de esporas. La longevidad de la respuesta inmune o de la capacidad de estas vacunas de ADN para iniciar la protección a largo plazo no fue evaluado en este estudio.

El fracaso de la fusión de aumentar VP22 respuestas de anticuerpos a la Autoridad Palestina 63 contrastan con los de otras YFP, EGFP o E7 del VPH expresaron antígenos de vacunas de ADN, donde la mejora es evidente [23 - 26]. Además, la incapacidad de aumentar la protección contra la B. Anthracis desafío contrasta con estudios con vacunas de ADN que expresa la proteína E7 del VPH de protección que la inmunidad antitumoral se aumentó con VP22 fusión [33, 34]. Sin embargo, las vacunas de ADN que expresaban el reportero proteínas EGFP YFP y la falta de secreción de señales y el nivel de mejora que ofrece a la proteína E7 del VPH después de la fusión con VP22 fue equivalente a la que ofrece la inclusión de una secreción de la señal [23]. El PA 63-expresando ADN vacuna utilizada aquí contiene una señal de secreción.

La inclusión de una señal de la secreción de uso común es una estrategia para la vacunación de ADN, como la liberación de la proteína de la célula puede aumentar la respuesta inmune [35 - 37]. La inclusión de VP22 dentro de una vacuna de ADN no puede permitir que las proteínas secretadas para salir de la celda con lo que aumenta su exposición a las células presentadoras de antígenos como las células dendríticas. Esto es consistente con la hipótesis de que VP22 no mediar intercelular propagación como describió por primera vez, sino que es liberada de las células, posiblemente, por la muerte de las células [1]. Además de la liberación de la proteína expresada de la célula, VP22 pueden potenciar las vacunas de ADN de otras maneras. Por ejemplo, la fusión de immunostimulatory secuencias de los antígenos expresados de vacunas de ADN ha demostrado para proporcionar ayuda de células T afines [38]. En este estudio, una vacuna de ADN contra la fusión de células B utiliza los tumores no tóxicos fragmento C de la toxina del tétanos. Por lo tanto, es posible que la fusión de VP22 a antígenos codificados por el ADN pueden mejorar la inmunogenicidad de vacunas mediante la provisión de ayuda de células T afines.

5,0 Conclusión

Este estudio examina la inclusión de la proteína VP22 en una vacuna de ADN que expresan PA 63 de B. Anthracis. La proteína VP22 se ha demostrado previamente para mejorar el rendimiento de las vacunas de ADN no expresan proteínas secretadas. En este caso, el PA 63-expresando vacuna contiene el ADN humano activador del plasminógeno señal de secuencia [19]. VP22 inclusión de la vacuna de ADN dentro de esta construcción no aumentar anti-PA respuestas de anticuerpos u ofrecer un aumento en el nivel de protección de los A / J mice esporas ántrax siguiente desafío. Esto sugiere que aunque VP22 pueden mejorar las respuestas a las vacunas de ADN no codifica proteínas secretadas, que no mejora las respuestas a un PA 63-que expresa la codificación de la vacuna de ADN secreción señal.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

SDP, HCF-S, HSG, AEE-L llevado a cabo los estudios. FKS, RJP participado en el diseño del estudio. Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

Los autores desean agradecer la Tenovus Laboratorio (Southampton University Hospitals Trust) y el Fondo de Investigación de Leucemia. Gracias también a Emma Waters, Steve Elvin, Tony Stagg, Warren Cocina, Stefan Mills, Sarah Hayes, Sara Browning, y Clara Angela Scutt Burton para una excelente asistencia técnica. Gracias también a Helen Burnell de asesoramiento y Lyn O'Brien para la prueba de lectura.