Genome Biology, 2005; 6(4): R34-R34 (más artículos en esta revista)

Un enfoque genómico para investigar la muerte de la célula de desarrollo en los tejidos leñosos árboles de Populus

BioMed Central
Charleen Moreau (charleen.moreau @ plantphys.umu.se) [1], Nikolay Aksenov (nikolay.aksenov @ plantphys.umu.se) [1], Maribel García Lorenzo (maribel.garcia @ chem.umu.se) [2 ], Bo Segerman (bo.segerman @ plantphys.umu.se) [1], Christiane Funk (christiane.funk @ chem.umu.se) [2], Peter Nilsson (nipe@biotech.kth.se) [3] , Stefan Jansson (Stefan.jansson @ plantphys.umu.se) [1], Hannele Tuominen (hannele.tuominen @ plantphys.umu.se) [1]
[1] Departamento de Fisiología Vegetal, el Centro de Ciencia de Plantas Umeå, Umeå University, SE-901 87 Umeå, Suecia
[2] Departamento de Bioquímica, Universidad de Umeå, SE-901 87 Umeå, Suecia
[3] Departamento de Biotecnología, KTH - Real Instituto de Tecnología, Centro Universitario AlbaNova, SE-10691, Estocolmo, Suecia

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen

Populus EST Un conjunto de datos se utiliza para la transcripción in silico de perfiles de la muerte programada de las fibras en el xilema de los tejidos leñosos Populus tallo. El análisis sugiere la participación de dos nuevos extracelular serin proteasas, nodulin-como proteínas y un AtOST1 (Arabidopsis thaliana OPEN STOMATA 1) homólogo en la señalización de la muerte celular de la fibra.

Antecedentes

Los tejidos leñosos de los árboles de angiospermas, las fibras y los vasos de xilema, se forman a partir de la meristemo lateral del tallo, el cambium vascular. En contraste con elementos de vasos, que diferenciar muy rápidamente cerca del cambium vascular, fibra diferenciación es un proceso relativamente lento de la expansión inicial de las células tanto en la dimensión longitudinal y radial, seguida de una amplia síntesis de la pared celular secundaria. La fase final de maduración de los dos elementos de vasos y fibras es la muerte de las células y autolisis de la célula de contenidos.

Xilema de la muerte de las células implica una serie de cambios morfológicos y nuclear en un marco estrictamente espacial y temporalmente, de forma coordinada y programada [1, 2]. La muerte celular programada (PCD) de xilema ha sido analizado en detalle en un sistema in vitro de Zinnia elegans, en la que las células del mesófilo Zinnia transdifferentiate xilema en buques como comúnmente se llama tracheary elementos en un semi-sincronizada manera [3]. En Zinnia células, en la diferenciación irreversible tracheary elementos se caracteriza por la acumulación de enzimas hidrolíticas en la vacuola y la deposición de la pared celular secundaria, seguido por tonoplast perturbación, la liberación de proteasas y nucleasas vacuolar en el citoplasma, y finalmente la pérdida de autolíticas Contenido de células [2, 4]. Varios diferentes tipos de proteasas se han detectado en Zinnia [5, 6], y un tipo nucleasa S1-, capaz de hidrolizado tanto el ADN y el ARN, parece control de la degradación del ADN nuclear en el Zinnia tracheary elementos [7]. A pesar de que la cadena de acontecimientos durante tracheary elemento PCD está bien caracterizado en el sistema de Zinnia, se sabe muy poco sobre la regulación de este proceso en las plantas intactas. Además, el sistema de Zinnia no ha permitido el análisis de los diferentes tipos de células del xilema, como las fibras.

Muerte celular programada también se produce en las plantas en respuesta a factores externos, tales como los patógenos avirulent, dando lugar a la llamada respuesta hipersensible (HR) y en respuesta a la reducción de luz artificial - manifiesta en la senescencia de hojas. HR muerte celular es usualmente rápido y comparte ciertas características con la muerte apoptótica de las células animales, como la nuclear y la reducción de la fragmentación oligonucleosomal del ADN en múltiplos de 180 pb fragmentos [8]. Senescencia inducida por la muerte de las células es un proceso mucho más lento, con la participación de la degradación nuclear, la fragmentación del ADN y exhaustivo de la degradación proteolítica celular contenidos y controlados removilización de los nutrientes [9]. La muerte de los elementos de xilema es diferente de los recursos humanos relacionados con la senectud y PCD en organoides que la estructura permanece intacta hasta vacuolar oligonucleosomal el colapso y fragmentación de ADN no sean anteriores a la muerte celular [1]. Si estos procesos se relacionan en el nivel molecular se desconoce, pero las diferencias en la regulación temporal y espacial, y en la morfología celular, sugieren que existen importantes diferencias, no sólo en los principios de la regulación, sino también en la ejecución de los diversos procesos de la planta PCD .

El género Populus se ha convertido en el principal modelo para el sistema de los árboles, debido a su amenability genómica y molecular para el análisis [10]. Populus también es adecuado para el análisis de xilema desarrollo [11, 12]. Un Populus etiqueta de secuencia expresada (EST) base de datos (POPULUSDB) se ha creado a partir del 19 de las diferentes bibliotecas de cDNA [13]. La base de datos consta de 102019 EST, unigene montaje en un conjunto de grupos 11885 y 12759 no agrupados singletons correspondientes a un total de 24644 secuencias únicas o transcripciones [14]. La gran diversidad de los tipos de tejidos que dan lugar a las diferentes bibliotecas de cDNA digital permite el análisis de la expresión génica por la EST comparación de las frecuencias en las distintas bibliotecas. Una de las bibliotecas se ha fabricado con Populus woody tejidos compuestos por fibras de xilema en la muerte de la célula. En este trabajo se estudió la expresión de genes en el proceso de fibra de muerte por análisis in silico de esta "biblioteca de fibra de muerte" y por un análisis de microarrays con una novela Populus 25K cDNA microarray. Además de su importancia económica como uno de los procesos que regulan la calidad de la madera, fibra de la muerte celular es un interesante proceso biológico que todavía es poco conocido. Nuestro análisis identificó varios genes reguladores novela candidato para xilema PCD.

Resultados y discusión
Las características singulares de la muerte de las células de fibra de madera en Populus

Un análisis de la fibra de muerte en la biblioteca de cDNA POPULUSDB se llevó a cabo para caracterizar los eventos moleculares específicos en Populus xilema fibras aproxima la muerte de la célula. La muerte de fibra biblioteca fue construida xilema de los tejidos en los que las fibras han pasado la fase de desarrollo y expansión de la célula la pared celular secundaria grueso deposición, y se acercaban a la muerte celular (ver [13], y el correspondiente a la zona B en la Figura 1]. La muerte de las células de las fibras se caracteriza por la progresiva desaparición del citoplasma y finalmente por completo autolisis de las células cuando no citoplasma se pueden discernir dentro de las células (Figura 1]. Diferenciación de xilema buques difiere de la de las fibras en el sentido de que es mucho más rápido, que ocurre por lo general dentro de una distancia de 100-150 μ m del cambium. Desarrollo de los buques es difícil de estudiar in vivo, no sólo porque es tan rápido, sino también porque tiene lugar en medio de fibras de xilema que aún están terminando de células de expansión e iniciar la deposición de la pared celular secundaria. Para evitar la mezcla de diferentes procesos de desarrollo xilema, hemos decidido en este análisis para excluir madera que contiene la diferenciación de los tejidos y los vasos de xilema que se centran exclusivamente en los eventos finales de la maduración de las fibras xilema.

Para obtener un panorama amplio de la muerte de las células de xilema en fibras, se comparó la distribución de tecnologías ecológicamente racionales en relación con la ontología de genes diferentes asignaciones en tres bibliotecas de cDNA POPULUSDB: la muerte de fibra biblioteca, la biblioteca de madera de tensión derivados de la tensión de la madera formando xilema, y la Senescencia de hojas biblioteca [13]. La senescencia foliar biblioteca fue elegido ya que representa otro PCD en plantas de proceso, la tensión y la biblioteca de la madera, ya que representa los tejidos de fibra de muerte cuando se inhibe, pero otra cosa es comparable a la muerte de fibra biblioteca. La tensión de madera se forma en una forma asimétrica en gravistimulated tallos de los árboles de angiospermas. Como parte de este proceso las fibras muestran retraso en la muerte de las células debido a la producción de una rica capa de celulosa-, el llamado G-capa, en el interior de la pared celular secundaria. Sorprendentemente, la biblioteca de fibra de muerte muestran una mayor proporción de tecnologías ecológicamente racionales (36%) que no pueden ser asignados a cualquier gen ontología plazo, en comparación con la tensión biblioteca de madera (23%) y la senescencia de hojas de biblioteca (27%) (Figura 2] . Además, el 6%, 7% y 5% de la fibra de tecnologías ecológicamente racionales en la muerte, la tensión y la madera de hoja de senectud bibliotecas, respectivamente, representados desconocidos procesos biológicos. Estas cifras indican que la única y mal caracterizado procesos fisiológicos pueden ocurrir en xilema fibras en la muerte de la célula. Las dos bibliotecas de la muerte celular, la fibra de la hoja de la muerte y la senectud, fueron similares en el sentido de que había un menor número de clones relacionados con la biosíntesis de las células y la comunicación, y un mayor número de clones relacionados con el catabolismo de la tensión biblioteca de madera (Figura 2] . Sin embargo, la senescencia de hojas biblioteca había clones de frecuencias más altas en las categorías de transporte de electrones y el desarrollo que las otras dos bibliotecas (Figura 2]. En total, el análisis demostró que la distribución de los procesos biológicos de fibra durante la muerte celular son bastante similares a los que durante tanto la formación de madera de tensión y de la hoja de senectud. Las características comunes compartidas por la muerte de fibra y hojas de senectud sugieren similitudes entre las bibliotecas de fibra de senectud y la muerte de las células relacionadas con la PCD. Sin embargo, la muerte de las células de fibra también se espera la participación de las vías metabólicas y de regulación que aún no se han caracterizado, sobre la base de la alta proporción de tecnologías ecológicamente racionales con desconocidos o desconocidas ontología de genes en función de la biblioteca de fibra de muerte.

Los más abundantes transcripciones de fibra durante la muerte celular

Una gran abundancia de una transcripción sugiere que la correspondiente proteína participa en un proceso que es importante para la célula o tejido. Se realizaron búsquedas en las transcripciones de muy abundantes en el proceso de muerte celular de fibra mediante la identificación de la fibra en la biblioteca de la muerte POPULUSDB unigene agrupaciones que presentó el mayor número de tecnologías ecológicamente racionales. Los 28 más abundantes transcripciones, que se muestra en la figura 3, también se enriqueció en la biblioteca de fibra de muerte. Suponiendo una distribución aleatoria, la espera EST frecuencia en la biblioteca de fibra de muerte es de 4,8% (4867 EST fibra en la biblioteca de la muerte de un total de 102019 tecnologías ecológicamente racionales en el POPULUSDB). Todas las transcripciones de la muestra en la Figura 3 muestran una mayor frecuencia que eso. De hecho, todos los grupos excepto POPLAR.147, POPLAR.58, POPLAR.39, POPLAR.166 y POPLAR.613 había una EST frecuencia entre 10-91% de fibra de muerte en la biblioteca.

La transcripción más abundante en la biblioteca de fibra de muerte fue hydroxymethyltransferase glicina (GHMT; POPLAR.161). GHMT fue también muy abundantes en varias otras bibliotecas derivados de xilema que contienen los tejidos, tales como la tensión de madera y las raíces (Figura 3]. GHMT también ha sido identificado como uno de los más abundantes en proteínas Populus xilema [15], las raíces de Arabidopsis [16] y el pino loblolly xilema [17]. GHMT es una enzima clave en el metabolismo de un carbono, catalizar la conversión reversible entre glicina y serina para producir 5,10-metilentetrahidrofolato, que se puede usar para recuperar de la metionina 5-metil-tetrahydrofolate y homocisteína [15]. Uno-el metabolismo del carbono se sabe que se activa en photorespiration, pero su expresión preferencial en la maduración tardía fibras sugiere que el Populus GHMT también participa en algún otro proceso (s). Además, otras tres enzimas que participan en el metabolismo de un carbono son muy abundantes en la biblioteca de fibra de muerte. 5-Methyltetrahydropteroyltriglutamate homocisteína-S-metiltransferasa (POPLAR.649) cataliza la biosíntesis de metionina, mientras que S-adenosylmethionine sintetasa (POPLAR.155) y adenosylhomocysteinase (POPLAR.147) participan en el catabolismo metionina (Figura 3]. Es posible que el metabolismo de un carbono se requiere durante xilema de maduración para la producción de glicina, que es abundante en las proteínas de la pared celular. S-adenosylmethionine, que se sintetiza de la metionina, también se puede utilizar para metilación reacciones secundarias que se producen durante el muro Formación. Sin embargo, es poco probable que estas enzimas son sólo necesarios para la fibra de la muerte de la célula, ya que son también muy abundantes en las bibliotecas derivados de la zona del cambium y la tensión de madera (Figura 3].

Proteínas de la pared celular son muy abundantes en la biblioteca de fibra de muerte (Figura 3]. Arabinogalactan proteínas (AGP) pertenecen a una superfamilia de los proteoglicanos que abarca varias subclases, como la clásica AGPs y fasciclin-como AGPs. Ambos clásica AGPs (POPLAR.862 y POPLAR.999) y un fasciclin-como AGP (POPLAR.3203) fueron muy abundantes en la biblioteca de fibra de muerte (Figura 3]. AGPs son un importante constituyente proteínico de las paredes celulares, pero su función sigue siendo poco clara. En un informe reciente sobre un híbrido que contiene proteínas AGP dominios apoya la hipótesis de que AGPs tienen una función crítica en la mediación interacciones célula-célula durante la diferenciación vascular [18]. El fasciclin-AGPs como, por otra parte, parecen estar implicadas en el control de la adhesión celular [19, 20]. AGPs también han sido implicados en el DPC [21, 22]. AGP genes en grupos POPLAR.999 y POPLAR.3203 también fueron altamente expresado en otras bibliotecas, en especial la biblioteca de la tensión de la madera que forman los tejidos de xilema, lo que sugiere que tienen un carácter más general en función de la formación de la pared celular (Figura 3]. Sin embargo, la POPLAR.862 AGP se enriqueció en la biblioteca de fibra de muerte. POPLAR.862 también ha demostrado ser suprimidas en un análisis de microarray de la tensión de fibra de madera, donde se inhibe la muerte celular (S. Andersson-Gunnerås, E. Mellerowicz y B. Sundberg, comunicación personal), que indica un fuerte papel para este AGP En la estimulación de la fibra de la muerte de la célula. Otras dos proteínas de la pared celular, una glicina ricos en proteínas (POPLAR.1776) y una proteína similar a extensin (POPLAR.9554), también son muy abundantes y excesivamente en la biblioteca de fibra de muerte (Figura 3], lo que sugiere que estas proteínas también Tienen funciones durante los fines de maduración de las fibras xilema.

Un cisteína proteasa (POPLAR.1250) y un polyubiquitin (POPLAR.58) fueron muy abundantes en la biblioteca de fibra de muerte (Figura 3], así como en otras bibliotecas derivados de los tejidos en los que una gran proporción de las células están muriendo, como senescing Hojas, tejidos de la raíz y pecíolos. Cisteína proteasas se cree que participar en el post mortem acontecimientos del xilema elementos [1]. La alta abundancia de polyubiquitin sugiere que la vía ubiquitin-proteosome participa en eventos proteolítica de las células de xilema también. Otra transcripción relacionados con la proteólisis y muerte celular se POPLAR.9335, que era muy abundante y altamente enriquecido también en la biblioteca de fibra de muerte (Figura 3]. Que codifica una proteína con una función desconocida, pero contiene un dominio se encuentran en las proteínas de transferencia de lípidos, proteínas y almacenamiento de las semillas de los inhibidores de la proteasa. El mismo tipo de proteína se muestra antes de regular la muerte celular programada y la defensa de plantas [23]. El patrón de expresión de POPLAR.9335 también fue analizado por RT-PCR, y los resultados confirmaron la especificidad de esta transcripción en el xilema fibras en la muerte celular (Figura 4].

La muerte de fibra de biblioteca específica de las transcripciones son supuestamente nuevos reguladores de la muerte celular

El análisis de las transcripciones más abundante en la fibra de la muerte de las células biblioteca dado una lista de genes candidatos con altos niveles de expresión. Con el fin de determinar la muerte de las células de fibra transcripciones específicas con menores niveles de expresión que hemos observado en los grupos POPULUSDB y simple (no agrupadas transcripciones) que son exclusivas de la biblioteca y de fibra de muerte no existe en ninguna de las otras 18 bibliotecas EST. En total, 71 grupos y 929 singletons que se identificaron fueron exclusivas de la muerte de fibra biblioteca (archivo de datos adicional 1). Singletons representa ni transcripciones raras o mal secuenciado transcripciones de las regiones, por lo que no son necesariamente indicativos de fibra de expresión específica de muerte. 71 de la muerte de fibra biblioteca categorías concretas, las 12 agrupaciones que tengan la más alta abundancia de tecnologías ecológicamente racionales se muestran en la Tabla 1. Primero, un microarray experimento se realizó para confirmar el patrón de expresión de estas transcripciones. Dos muestras se obtuvieron de la woody tejidos de la raíz, una (A), que contiene las zonas donde se xilema fibras en el proceso de expansión celular y la formación de la pared celular secundaria, y una (B), que contiene fibras de los tejidos, donde fueron sometidos a la muerte de las células ( Véase la figura 1]. La muestra de la fibra de la muerte de la célula zona correspondía estrechamente a los tejidos recogidos para la construcción de la biblioteca de fibra de muerte, y, por lo tanto, debe mostrar alta expresión de la singular transcripciones a esta biblioteca. El microarray análisis mostró que, con la excepción de POPLAR.11648, los siete fibra muerte de biblioteca específica de las agrupaciones que estuvieron representados por más de tres tecnologías ecológicamente racionales son también más altamente expresado en la fibra de la muerte de las células de la muestra en comparación con principios de desarrollo de las fibras (Tabla 1]. Fibra muerte de biblioteca específica de las agrupaciones con menos de cuatro EST abundancias mostró resultados diferentes en el análisis de microarrays (archivo de datos adicional 1).

Ninguna de las transcripciones que se han demostrado que son exclusivas de la biblioteca de fibra de muerte ha sido implicado en la regulación de la muerte celular. El transportista oligopeptide (POPLAR.11639) participa en el metabolismo de aminoácidos relacionadas con la removilización de nutrientes de los tejidos mueren, pero la razón de la expresión específica patrón de las otras transcripciones no está claro. Varios de ellos parecen ser proteínas de membrana o destinados al endomembrane sistema, tal como se predijo, sobre la base de sus más cercanos Arabidopsis homólogos (Tabla 1]. Un glicosil hidrolasa de la familia 1 (POPLAR.11628) es el más abundante transcripción de la única muerte de fibra biblioteca, pero los sustratos de esta glucosidasa y su función exacta en fibra de la muerte de las células aún no se han dilucidado. Curiosamente, el más cercano homólogos de esta proteína son cianogénicos en la naturaleza, y es tentador especular que la producción de cianuro de esta enzima podría participar en la regulación de la muerte celular en el xilema fibras. PCR transcripción reversa (RT-PCR), análisis de las transcripciones de los cinco únicos confirmó que POPLAR.11628 (nueve EST), POPLAR.11639 (cinco TER) y POPLAR.11646 (cuatro EST) fueron realmente muy específicamente en el xilema fibras expresado en la muerte de las células ( Figura 4]. POPLAR.11658 (seis TER) y POPLAR.11624 (dos EST) mostraron expresión más alta en el xilema fibras morir, pero se expresa también en otros tipos de árboles de Populus tejidos (Figura 4].

Combinación de los análisis in silico con un análisis de microarrays refina la selección de los candidatos genes reguladores

El análisis puso de manifiesto tanto los microarrays singletons y grupos que estuvieron representados sólo por dos o tres tecnologías ecológicamente racionales en la biblioteca de fibra de muerte, pero eran muy upregulated en el xilema fibras en la muerte de las células (archivo de datos adicional 1). Para combinar el poder de la POPULUSDB y el análisis de microarrays, se identificaron las transcripciones que había un alto nivel de expresión en las fibras de morir, sobre la base del análisis de microarrays y que se enriquece o único en la muerte de fibra dentro de la biblioteca POPULUSDB. Figura 5 muestra los 50 la mayoría de las transcripciones que se upregulated en el xilema fibras de morir en comparación con los primeros xilema en desarrollo sobre la base del análisis de microarrays. La mayoría de upregulated transcripciones fueron en general muy enriquecido o exclusivas de la biblioteca de la muerte de fibra (Figura 5]. De los 20 más upregulated transcripciones, nueve son exclusivas de la biblioteca de fibra de muerte y sólo cinco estaban completamente ausentes de él (archivo de datos adicionales 2). La buena correlación entre la EST abundancias en la biblioteca de fibra de muerte y la expresión de genes en el análisis de microarray de verificar la utilidad de la transcripción en POPULUSDB xilema de perfiles de fibra de muerte.

Entre los más upregulated transcripciones que se únicas o muy enriquecido en la biblioteca de fibra de muerte, hay transcripciones que participan en el metabolismo de aminoácidos y de los transportes (X024D04, POPLAR.872), proteólisis (POPLAR.11632, POPLAR.4995, POPLAR.10724 , X077D02), y también las transcripciones, como quinasas (X053F08, POPLAR.9347), nodulin-como las proteínas (X002G05, POPLAR.4667) y una proteína similar a CACTIN (POPLAR.11667), que parecen tener funciones de señalización en lugar de Mera celular desintegración de la muriendo fibras (Figura 5]. Nodulin alta expresión de las proteínas-como en morir xilema sugiere que nodulins fibras, que regulan la formación de nódulos en respuesta a la infección por Rhizobium, también tienen una importante función en la maduración de las fibras xilema. Curiosamente, algunos se han mostrado nodulins para regular la acumulación de especies de oxígeno reactivas (ROS) [24, 25], y es posible que-al igual que las proteínas nodulin regular ROS acumulación que se produce durante los fines de maduración o de la muerte de las células de xilema fibras. ROS acumulación también está implícito en la expresión de alto nivel de peroxidasas (POPLAR.11659 y 11.669) y una proteína quinasa (singleton X053F08), que parecen codificar la Populus ortholog de Arabidopsis thaliana OPEN STOMATA 1 (OST1; Figura 5]. OST1 regula ácido abscisic (ABA) mediada por la acumulación de ROS relacionadas con cierre estomático en Arabidopsis, y se ha demostrado que se expresa en los tejidos vasculares de las hojas y raíces de Arabidopsis [26]. Otras proteínas importantes en las primeras señales de fibra de la muerte de la célula básica podría incluir la hélice-loop-hélice V031H02 factor de transcripción y de la clase C2H2 zinc-proteína POPLAR.10810 dedo de la mano. Curiosamente, la mayoría de POPLAR.11144 es similar a los genes de Arabidopsis VACUOLELESS1, que se requiere para una adecuada formación y vacuola autofagia [27]. En la Z. Elegans cultivo celular, la permeabilidad y la integridad de la membrana vacuolar regula inicio de xilema de la muerte celular [1], y nuestros resultados sugieren que VACUOLELESS1 podían participar en este reglamento durante la muerte celular de las fibras.

La combinación de los análisis de la expresión in silico en 19 diferentes tipos de tejidos con un análisis centrado microarrays se espera que facilite la identificación de genes candidatos mejor que cualquiera de los métodos por sí solo. Si bien el análisis de microarray permitió la selección de genes con altos niveles de expresión en el xilema fibras en la muerte de las células en comparación con principios de desarrollo de las fibras, el análisis in silico de POPULUSDB facilitado exclusión de los genes que son muy abundantes en otros tipos de árboles de Populus tejidos. Los genes candidatos seleccionados aquí son potenciales nuevos reguladores de la muerte celular en el xilema fibras.

Comparación de las proteasas en tres diferentes procesos de muerte celular

La expresión de serina, cisteína y aspártico proteasas se analizó en detalle en la biblioteca de fibra de muerte, porque las proteasas han establecido funciones en el control de la muerte celular en las células animales y las plantas [28, 29]. También comparó su expresión en la biblioteca de fibra de muerte y otras tres bibliotecas de cDNA: la senescencia de hojas de biblioteca (biblioteca I) y el virus / infectados por hongos de hoja de biblioteca (biblioteca de Y), que se prevé será enriquecido en las transcripciones relacionadas con la muerte de la célula, Y la tensión de madera biblioteca (biblioteca G), que debería ser en teoría carece de fibra de muerte relacionadas con las transcripciones.

Cisteína proteasas (CP) se han especificado en el xilema elementos sometidos a la muerte celular [6, 30]. En consecuencia, los inhibidores de proteasas cisteína han demostrado afectar la maduración de xilema elementos [31]. Cisteína proteasas son muy abundantes en la POPULUSDB, y por lo general no se limita a ninguna de las bibliotecas de la muerte de las células X, o Y (Cuadro 2]. Sin embargo, la cisteína proteasa POPLAR.3310 es algo enriquecido en la biblioteca de fibra de muerte y que no están representados en la senescencia de hojas biblioteca. Esta transcripción es similar a la mayoría de Arabidopsis XYLEM CYSTEINE PEPTIDASE 2 (XCP2), que se ha demostrado que se expresa específicamente en los vasos de xilema de las hojas y las raíces [32]. Curiosamente, POPLAR.3310 también estuvo presente en el virus / infectados por hongos de hoja de biblioteca, lo que sugiere que este PC también se activa durante el agente patógeno de la muerte celular inducida. Además, un VACUOLAR PROCESAMIENTO ENZYME (VPE; POPLAR.3027), se enriqueció en la biblioteca de la muerte de fibra (Tabla 2]. VPE de Arabidopsis dos isoenzimas, α-y γ-VPE VPE, han demostrado ser activado durante la senescencia, pero sólo α-VPE se expresó en los tejidos vasculares [33]. En el tabaco, VPE se ha demostrado que la regulación de la integridad de la membrana vacuolar y patógenos-hipersensible muerte celular inducida [34]. Nuestros datos sugieren que, además de la muerte de las células hipersensibles, VPE controles de desarrollo en la muerte de las células de xilema fibras, posiblemente a través de la regulación de la integridad vacuolar.

En contraste con la cisteína proteasas, la serina proteasas muestran mayor especificidad dada a los procesos de muerte celular (Tabla 2]. Esto se ajusta bien a la función informó de las proteasas de serina en la señalización de la apoptosis temprana muerte de las células infectadas por el virus en las células animales [29]. En células vegetales, serin proteasas han estado implicados en el agente patógeno de la muerte celular inducida [35, 36], y la serina proteasa actividades también se han demostrado durante el xilema de la muerte celular [5, 6]. Groover Jones y [4] muestran que la actividad serina proteasa estimulados, y era necesario que, la muerte de Z. Elegans tracheary elementos cultivados in vitro. De acuerdo con estos resultados, un 40 kDa serina proteasa era la que se acumulan en el medio de cultivo in vitro de tracheary elementos [4]. Nuestros datos revelan la identidad de dos serina proteasas posiblemente relacionadas con la regulación de la muerte de las células de xilema. La serina proteasas POPLAR.10138 y POPLAR.4995 fueron enriquecidos en fibra de la muerte biblioteca, y también muy upregulated microarrays en el análisis de las fibras de xilema en la muerte de las células (Tabla 2]. PSORT Un análisis [37] de secuencias de proteínas derivadas de las tecnologías ecológicamente racionales y ensambladas manualmente secuencias genómicas apoyado extracelular localidades para ambos POPLAR.10138 y POPLAR.4995 (datos no presentados).

Los objetivos de estas proteasas serina no se conocen. Groover y Jones [4] sugiere que la extracelular de 40 kDa serina proteasa es responsable de la activación de canales de Ca 2 +, que es un requisito previo de xilema de la muerte de la célula. Otros posibles objetivos son membrana ricos en leucina-repito-que contienen proteínas, que se han mostrado para interactuar con serin proteasas hipersensible durante la muerte celular [38]. Una de ellas podría ser un objetivo de la membrana plasmática localizada ricos en leucina-repito-que contiene quinasa del receptor que es única a la biblioteca de la muerte de fibra (singleton X021F12), y significativamente durante upregulated fibra de muerte (PU27994; adicional archivo de datos 2). Sin embargo, independientemente de sus objetivos, parece evidente que los datos de nuestro modificación de la matriz extracelular se produce durante la fibra de la muerte de la célula por dos extracelular serina proteasas, probablemente como parte de los principios de transducción de señales.

Un aspártico proteasa ha sido localizada específicamente en el tracheary elementos sometidos a la muerte celular [39]. En este análisis, no se encontraron pruebas para cualquier fibra-aspártico proteasas específicas de la muerte. Los cuatro aspártico proteasas identificadas en POPULUSDB se presente, ya sea en varias bibliotecas de la muerte de la célula o también en la biblioteca de madera de tensión, donde la muerte de la célula relacionados con las transcripciones no debe acumular (Tabla 2].

Hormonales de control de la maduración de la fibra

Arabidopsis se ha utilizado para analizar transcriptomes xilema durante el desarrollo [40, 41]. En Arabidopsis, la formación del cambium vascular, dando lugar a la llamada vegetación secundaria, tiene lugar en el hipocotilos después de dos a tres meses de crecimiento continuo que requiere la eliminación de la inflorescencia se deriva [42]. Los principios de desarrollo y maduración de los vasos de xilema y fibras durante la secundaria el crecimiento de la hipocotilo es similar a Populus excepción de las fibras, que en Arabidopsis no mueren en el muy en forma coordinada como Populus, incluso después de un largo período de crecimiento de tres meses ( Nuestro trabajo no publicado). Por lo tanto, es posible analizar las similitudes entre Populus Arabidopsis y en el proceso de maduración de fibra, pero no la muerte de la célula.

Para identificar patrones comunes en la transcriptomes de Populus y Arabidopsis fibra durante la maduración, hemos identificado Arabidopsis Populus homólogos a los genes que se upregulated por lo menos dos veces (P <0,001 y B> 0) en la fibra de la muerte de la célula de muestra (maduración tardía Fibras; muestra B), en comparación con los principios de desarrollo de fibra (muestra A). Este conjunto de datos, señalados como «Populus B / A ', se comparó a dos conjuntos de datos anteriormente publicados Arabidopsis [41]. La primera Arabidopsis bases de datos, señalados como "tratamiento", consiste en que los genes se upregulated por lo menos dos veces durante el crecimiento secundario (9 semanas de crecimiento) en comparación con el crecimiento de la primaria hipocotilos (3 semanas de crecimiento), y se espera que, por lo tanto, Enriquecer transcripciones relacionadas con el crecimiento con inclusión de fibra secundaria maduración. El segundo conjunto de datos Arabidopsis, señalados como "xilema", consiste en que los genes se upregulated más de dos veces en el xilema secundario en comparación con los tejidos de corteza de hipocotilos tejidos, y se espera que las transcripciones enriquecer todos los aspectos relacionados con el desarrollo de xilema secundario durante el crecimiento, incluida la muerte Xilema de los buques y de fibra de maduración. Las características comunes de estos conjuntos de datos se indican en el archivo de datos adicional 3. - La muerte de células relacionadas con transcripciones rara vez han compartido por los diferentes conjuntos de datos debido al método de muestreo para las comparaciones "tratamiento" y "xilema". Sin embargo, un gran número de factores de transcripción y las plantas relacionadas con la hormona de transcripciones a menudo son compartidos por la Arabidopsis y los conjuntos de datos Populus. Vamos a discutir aquí las transcripciones de este último grupo como muy poco conocimiento previo existente sobre el papel de las hormonas vegetales en la maduración de los acontecimientos de fines de xilema fibras.

Indol-3-ácido acético (AIA) es una planta de tipo auxina hormona que regula varios procesos diferentes de desarrollo en las plantas y también la actividad del cambium vascular y la formación de xilema [43]. En Populus tallos, la Academia muestra una fuerte concentración de gradiente radial en todo el tallo con la mayor concentración cerca del cambium vascular y una muy baja concentración en el xilema de maduración tardía [11]. Varios reguladores transcripcionales de la Academia relacionados con la expresión de los genes, como el factor de respuesta auxinas (ARF) proteínas de la familia, así como la auxina / ácido indoleacetic (AIA), la familia de proteínas, se observó en todos los conjuntos de datos (archivo de datos adicional 3), lo que sugiere la participación De estas proteínas no sólo en el desarrollo temprano del xilema secundario, según lo sugerido por la alta concentración de la Academia en estos tejidos, pero también durante la última etapa de maduración de las fibras de xilema. El papel de la Academia a fines de maduración de las fibras no es clara, pero es posible que la Academia de señalización funcional es necesaria para la supervivencia de las células. At2g21620 codifica una proteína de estrés universal (USP), miembro de la familia, que se rige por la auxina [44]. Ventajas han sido implicados en la regulación de las relacionadas con el estrés metabólico turnos, y la activación de la auxina-USP regulados durante el crecimiento secundario en Arabidopsis y durante fines de fibra de maduración en Populus (archivo de datos adicional 3), sugiere un papel de la Academia en maduración tardía xilema Las fibras que la experiencia algún tipo de estrés. Este podría ser el estrés osmótico debido a la condensación del contenido citoplásmico o el agotamiento de los nutrientes, debido a la cada vez mayor distancia de transporte de los nutrientes de las células floema. El papel de la Academia durante el estrés celular es apoyado también por el hecho de que la Academia induce la expresión de enzimas involucradas en la biosíntesis de etileno [45], que es una hormona vegetal que se produce en respuesta a diferentes condiciones de estrés.

Etileno no parece ser necesario para el desarrollo normal de xilema sobre la base del hecho de que el etileno-insensible genotipos en Arabidopsis y otras especies en crecer normalmente. Sin embargo, se activa la biosíntesis de etileno en gravitationally estimulado Populus deriva, es decir, cuando la raíz es desplazada de su posición vertical, lo que resulta en la producción de madera de tensión [46]. Por analogía con otros procesos de muerte celular en plantas [47], se espera que el etileno participa también en la regulación de la muerte de las células de xilema. Esto se sustenta en la activación de varios relacionados con las transcripciones de etileno en los dos Arabidopsis y la maduración tardía xilema fibras en Populus (archivo de datos adicional 3). Etileno-INSENSITIVE 3 (EIN3), EIN3-BOX VINCULANTE F-1 (EBF1) y RESPUESTA etileno SENSOR 1 (ERS1) mediar conocido partes de etileno de transducción de señales [48]. EBF1 y ERS1 también son inducidas por el etileno. Porque tanto EBF1 y ERS1 función de señalización de etileno para reprimir, parece que la señal de etileno necesarias para la maduración de xilema debe ser suprimida o sólo transitoriamente activado.

Comparación de los datos sugiere la participación de otras dos hormonas vegetales. PATOGENESIS RELACIONADOS CON PROTEÍNAS PHENYLALANINE y amoníaco LYASE-2 se relacionan con ácido salicílico (SA) y la biosíntesis de señalización, respectivamente, y CORONATINE INSENSITIVE 1 a jasmonic ácido (JA) de señalización. Ambos JA SA y el control de procesos relacionados con el estrés, como la muerte de las células de defensa y otras respuestas a los agentes patógenos [47]. La activación transcripcional de estos genes en la Arabidopsis xilema tejidos y en la maduración tardía Populus fibras sugiere que ambos JA y SA participan en la regulación de la muerte celular también en fibras de xilema (archivo de datos adicional 3).

Conclusiones

Aunque Arabidopsis es un modelo adecuado para el estudio del sistema vascular temprana de desarrollo y crecimiento primario, que no puede ser fácilmente utilizada para el estudio del crecimiento secundario del tallo. Xilema fibras se forman en Arabidopsis sólo después de dos a tres meses de crecimiento, que es el equivalente del tiempo necesario para cultivar árboles de Populus a un tamaño que permita la recogida de grandes cantidades de madera tejidos de la espiga. Además, debido al mayor diámetro de los árboles de crecimiento del tallo, los tejidos pueden ser fácilmente recogidos de las diversas fases de desarrollo, sin mezclar los diferentes tipos de tejidos [43]. Por lo tanto, Populus tiene varias ventajas sobre el análisis de la madera de Arabidopsis. Desarrollo de herramientas bioinformáticas y genómicas ha fortalecido aún más Populus como el principal modelo para el sistema de formación de la madera.

Este análisis aprovecharse plenamente las ventajas del sistema de Populus. La combinación de análisis in silico de la POPULUSDB con un análisis de microarray de la novela utilizando microarrays 25K Populus puesto de manifiesto una serie de genes que son únicos y muy abundantes en la tarde de los tejidos leñosos en desarrollo, y posiblemente relacionadas con la regulación de la muerte celular en el xilema fibras. Encontramos fibra de muerte específicas de factores de transcripción, así como nodulins y subtilisina como serina-proteasas, que se espera que desempeñen un papel en la señalización de los principios de fibra de la muerte de la célula. Las secuencias correspondientes a las Populus homólogo de Arabidopsis OPEN STOMATA 1 y peroxidasas sugieren la participación de ROS y ABA en fibra de señalización de la muerte celular también. Específicas de los patrones de expresión de los componentes, como el homólogo de Arabidopsis Populus XYLEM CYSTEINE PEPTIDASE 2 y el oligopeptide transportistas, el apoyo de la importancia de estas proteínas en la degradación de las proteínas y la removilización de nutrientes en las fibras de morir. Curiosamente, dos proteínas que se sabe que regulan vacuola vacuolar de reunión y de la integridad en otros procesos celulares, el Populus homólogo de Arabidopsis VACUOLELESS1 y un VACUOLAR PROCESAMIENTO ENZYME, se expresa específicamente en fibra de la muerte de la célula. Permeabilidad de la membrana vacuolar y la integridad vacuolar se sabe que regulan la muerte de las células de xilema, y ahora podemos, por primera vez, las proteínas reguladoras sugerir candidatos para este proceso. En su conjunto, nuestro análisis ha identificado un grupo de genes candidatos que pueden ser importantes en la regulación de la muerte celular de la fibra. Sobreexpresión y represión transcripcional experimentos deben realizarse para dilucidar la función de estos genes en el proceso de fibra de la muerte de las células y su impacto en los rasgos de importancia económica de los tejidos leñosos.

Materiales y métodos
Biología computacional y análisis de bases de datos

Construcción de la fibra y de la muerte biblioteca POPULUSDB [14] se describen en [13]. Se analizaron los datos utilizando mysql, PHP, C + + y Filemaker software. El gen ontología (GO), la comparación se hizo lista de todos los términos GO [14] en la jerarquía de cada clon y de la selección de clones de los niveles apropiados GO jerarquía. Alrededor de 10% de los clones fueron asignados a más de una clase. El clon EST POPULUSDB dentro de la distribución se realizó con mysql y Filemaker, y visualiza con el paquete de software de R [49] según el código de programa se describe en [13]. Anotaciones fueron derivados de análisis BLASTX contra la Arabidopsis proteoma o la Swiss-Prot base de datos en los casos en que no Arabidopsis con suficiente homología de proteínas se identificaron de acuerdo con una anotación en tramitación se describe en [50].

Preparación de la 25K Populus cDNA microarray

Los microarrays utilizado aquí constituyen la segunda generación de los microarrays de ADNc Populus mundial y contienen en total 24735 diferentes fragmentos de cDNA. Esta gama se basa en la primera generación 13K Populus array [51] con clones de cDNA de siete bibliotecas, en representación de: la zona del cambium (AB), hojas jóvenes (C), brotes florales (F), la tensión de madera (G), deja senescing (I), inactivo cambium (UA), y activa cambium (UB). El 25K serie contiene 12 nuevos clones de cDNA bibliotecas, en representación del brote apical (K), destacó deja fría (L), raíces (R), corteza (N), y disparar meristemo (T), masculino catkins (V), inactivo Yemas (Q), catkins mujeres (M), pecíolos (P), de fibra de muerte (X), imbibed semillas (S) y virus / hongos hojas infectadas (Y). Para una descripción detallada de la construcción y la secuencia de las bibliotecas de cDNA, ver [13]. Todos los clones en el conjunto unigene se resequenced tanto de la 5'-final, al igual que las secuencias EST original, y la 3'-end. Cada unigene clon se define por un número en la PU microarrays. Información de la secuencia de los clones se pueden encontrar en el POPULUSDB [14].

Plásmido se hicieron los preparativos en un formato de 96-placa de suspensiones de células bacterianas con una Montage 96 plasmídico Prep Kit (Millipore) con un Biorobot 8000 la biología molecular de trabajo (Qiagen). Amplificaciones de PCR se realizaron en 100 μ l de reacción volúmenes, y se purifica en Montage PCR 384 Filtro de placas (Millipore) con un trabajo Biorobot 8000 (Qiagen). Los productos de PCR purificada fueron disueltos en 40 μ l 30% de DMSO y división entre una placa de almacenamiento y una plancha de impresión.

Los microarrays se imprimieron con un QArray (Genetix) SMP2.5 instrumento con 24 clavijas (Telechem) sobre Ultra LAGUNAS diapositivas (Corning). El cDNA 24735 fragmentos, junto con ocho ejemplares de cada uno de los 23 diferentes controles Lucidea Universal Scorecard (Amersham Biosciences), fueron avistados con una función de centro a centro distancia de 180 μ m. La calidad de las diapositivas manchada fue evaluada por tinción con Syto61 (Molecular Probes) y por la hibridación con nonamers azar. Las diapositivas se UV vínculos cruzados, a 250 mJ / cm 2 seguido de horneado a 75 ° C durante 2 h.

Microarray análisis

Las muestras para el aislamiento de ARN se obtuvieron de la base del tallo de un 6 meses de edad híbrido aspen árbol temblón (Populus tremula x tremuloides) cultivadas en un invernadero. La corteza es pelado apagado, y el desarrollo de las fases xilema se identificaron mediante microscopía de luz y por la textura y el color de los diferentes tipos de tejidos (Figura 1]. A la muestra, que consta de los restos de la zona del cambium, xilema y secundaria, la ampliación de la pared celular del depósito de xilema, fue recogida por raspado de la parte del xilema que era de color amarillento y relativamente suave con un cuchillo. La muestra B, que consiste en el grueso de células de paredes y maduración tardía xilema fibras acercarse a la muerte de la célula, fue la luz en color amarillo y relativamente difícil de raspar con el cuchillo. La muestra B se raspó a la frontera de la madera muerta, que es discernible por su color completamente blanco, la sequedad y dureza. Total RNA fue preparado a partir de las dos muestras de acuerdo a [52], y el ARNm se preparó a partir del 1 μ g RNA total usando paramagnética oligo (dT) perlas (Dynabeads, Dynal Biotech) en un 10 μ l volumen de elución.

Para la síntesis de ADNc, el ARNm esquilada muestra fue repetido por succión en un 10 μ l con una jeringa biselados, la no extracción de testigos aguja de punto (Hamilton Bonaduz AG). Primera línea de cDNA se preparó con 1 μ g oligo-dT 15 primer y 200 U SuperScript II RNasa H - la transcriptasa inversa (Invitrogen). Segundo capítulo de cDNA se preparó en un volumen final de 150 μ l a 16 ° C durante 2 h con 10 U Escherichia coli ligase de la DNA (Invitrogen), 40 E. U Coli DNA polimerasa I (MBI Fermentas), 2 U RNasa H (USB, GE Healthcare Bio-Sciences), en un buffer que contenía 0,2 mM de cada dNTP, 19 mM Tris-HCl (pH 6.9), 91 mM KCl, 4,5 mM MgCl 2 Y 10 mM (NH 4) 2 SO 4. Otro de incubación se realizó a 16 ° C por 20 min con 2 U T4 DNA polimerasa (Invitrogen). La reacción se detuvo con 10 μ l 0,5 M EDTA, y el cDNA se recuperó por fenol y cloroformo: isoamylalcohol extracción seguida de la precipitación de etanol. Los precipitados se disuelve en 2 mM Tris-HCl (pH 7,5) y purificado utilizando Autoseq G-50 columnas (Amersham Biosciences). Un burdo-adaptador final fue creado por dos recocido solo varados oligonucleótidos, (0,5 mmol MarAdLong: 5'-CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT-3 'y 0,5 mmol MarAdShort 5'-PO 4 - ACCTGCCC-NH 4 -3') en una solución tampón que contiene ligase 66 mM Tris-HCl (pH 7.6), 5 mM MgCl 2, 5 mM TDT y 7,5 μ g de BSA, en un volumen total de 15 μ l con un 0,7 ° C / min gradiente de temperatura de 50 ° C hasta 10 ° C. El adaptador se ligated a los 5 'plantilla con 10 U T4 ligase de la DNA (Invitrogen) ligase en una solución tampón que contiene 33,8 mM Tris-HCl (pH 7,6), 2,56 mM MgCl 2, 2,56 mM de TDT y 24 μ g de BSA, en un volumen total De 48,8 μ l, a temperatura ambiente. El cDNA fue purificado con un QIAquick PCR purification kit (Qiagen).

El cDNA fue amplificado por PCR en un 100 - μ l volumen que contiene 0,2 mM de cada dNTP, 0,75 μ M MaraAP1 (5'-CCATCCTAATACGACTCACTATAGGGC-3 '), de 0,75 μ M oligo-dT 15, 67 mM Tris-HCl (pH 8,8), 4 MM MgCl 2, 16 mM (NH 4) 2 SO 4, 3 μ g de BSA y 0,6 μ l AmpliTaq DNA polimerasa (Applied Biosystems). El procedimiento de PCR fue 95 ° C por 1 min, 72 º C por 5 min, además de la AmpliTaq, y 17 a 29 ciclos de 95 ° C durante 1 min, 50 º C por 1 min y 72 ° C durante 2 min. El número adecuado ciclo se definió como dos ciclos antes de la saturación de la PCR como producto detectado por electroforesis en gel. El producto de PCR fue purificado utilizando un kit QIAquick PCR purificación y su concentración se midió por espectrofotometría (NanoDrop ND-1000, NanoDrop Tecnologías).

Etiquetado de la amplificación de cDNA muestras fue realizado por la incorporación directa de 3 μ l Cy3-dUTP o Cy5-dUTP (Amersham Biosciences) en una reacción de PCR asimétrica con 100 ng cDNA, 1 μ M MaraAP1 ejemplo, 0,6 μ l AmpliTaq, 67 mM Tris-HCl ( PH 8,8), 4 mM de MgCl 2, 16 mM (NH 4) 2 SO 4, 80 μ M de cada dATP, dCTP, dGTP y 20 μ M dTTP en un volumen total de reacción de 50 μ l. Las condiciones de PCR fueron 95 ° C durante 1 min seguidos por nueve ciclos de 95 ° C durante 30 segundos, 50 º C por 30 seg y 72 ° C durante 10 min. El producto de PCR fue purificado con un QIAquick PCR purification kit y eluyen dos veces en 30 μ l 4 mM KPO 4 buffer (pH 8.5). El volumen final se redujo a 41 μ l.

Microarray hibridaciones, así como la digitalización de diapositivas y análisis de imágenes se realiza de acuerdo con [53]. Las dos muestras AyB se hibridó uno contra otro en cinco ocasiones (incluido el tinte-swaps). El microarray datos brutos, incluidos los tiff y gpr archivos de la digitalización y análisis de imágenes, es depositado a la UPSC-BASE microarrays base de datos [54]. Para las estadísticas, B-valores basados en la estadística bayesiana [55] paramétricos y pruebas t se obtuvieron con el programa R, versión 1.8.1 [49]. El microarray de datos se muestra en los archivos de datos adicionales 1 y 2 incluye la expresión diferencial log 2 (M) relación entre las dos muestras B y A, P-valor de la t de Student y de la B-valor.

RT-PCR análisis

Se recogieron muestras de las diez diferentes tipos de tejidos de un 6 meses de edad híbrido aspen temblón (Populus tremula × tremuloides), de árboles que crecen en el invernadero. Tallo tejidos; corteza, floema, la ampliación de xilema, la pared celular secundaria de depósito de xilema, la fibra y la muerte de las células-tejidos, fueron recogidos por raspado con un cuchillo de la base del tallo (véase la figura 1]. La fase de desarrollo de los diferentes tejidos de xilema se verificó en las secciones transversales de la raíz. El xilema de fibra muerte de la célula de muestra correspondió a los tejidos recogidos de la muestra B en el análisis de microarrays (véase más arriba) y los tejidos preparados para la construcción de la biblioteca de cDNA de fibra de muerte analizados en este estudio (para una descripción de la biblioteca ver [13 ]). Otros tejidos obtenidos de los análisis RT-PCR fueron las apical disparar, puntas de raíces, hojas jóvenes, de edad y de sexo masculino catkins hojas.

ARN fue preparado de acuerdo con [52]. Las muestras obtenidas fueron tratados con DNasa RQ1 (Promega), y ha sido producido utilizando cDNA SuperScript RNasa H-II (Invitrogen) y aleatorios decamers (Ambion), seguido de la RNasa H tratamiento. Dos microlitros de cDNA fue PCR-amplificación de genes usando primers específicos y una combinación apropiada de los genes 18S universal primers específicos y el 18S competimers (Ambion). El gen primers específicos se ACAGATGAAGCGTTCAGCAA y CAGTGCAGCACACCTAGGAA para el grupo POPLAR.11628, CAGGAAAGCTCTCCGTTTCTT y TCAAAGCTCTTCCCTTCTGC para POPLAR.11658, AATCCCATGAATATTACCCCTAGA y TCTCTTGCATGGGTAGACATTTT para POPLAR.11639, ACCTCCATAGCCACCCAAG y CTGCAAGCTGATGCAGAAGT para POPLAR.11646, TGAACAGCAGGAGGTGTGAG y AACAGGTGTCCCCATCTGAG para POPLAR.11624, y TGGCAACTCCAATGAAGAAC y CACCAACAGTTTATTTATTATTCAGATG para POPLAR.9335.

Análisis de las proteasas en el POPULUSDB

Una lista de Populus proteasas fue compilada, sobre la base de secuencias de la proteasa conocido A. Thaliana recogidos de las siguientes bases de datos: la Arabidopsis de recursos de información [56], TrEMBL [57], Merops [58], InterPro [59], [60] TIGR y Munich Centro de Información para secuencias de proteínas [61]. 602 Arabidopsis secuencias de proteasas se encontraron. El contig secuencias de la POPULUSDB se preguntó entonces con BLASTX contra la Arabidopsis proteasas. Sólo las secuencias de Populus BLASTX que obtuvo una puntuación superior a 100 y fueron anotados como proteasas o como codificación de las proteínas con una función biológica relacionadas con la proteólisis peptidolysis o en la base de datos TIGR fueron aceptadas. Los correspondientes grupos, de tres o más tecnologías ecológicamente racionales en cualquiera de las bibliotecas de interés (tensión madera, senescing hojas, de fibra de muerte y virus / hongos hojas infectadas) en POPULUSDB fueron escogidos para el análisis.

Adicional de los archivos de datos

Los siguientes datos adicionales está disponible con la versión en línea de este artículo. Datos adicionales archivo 1 es un cuadro con la lista completa de la muerte de fibra de biblioteca específica de las transcripciones y los correspondientes datos de la expresión génica de los análisis de microarrays. Datos adicionales 2 es un archivo que contiene la tabla completa de datos de expresión génica en xilema fibras en la muerte de la célula usando el 25K Populus cDNA array y la POPULUSDB. Datos adicionales 3 es un archivo que contiene una tabla de comparación de los datos de los microarrays de tejidos de xilema Populus y Arabidopsis. Datos adicionales archivo 4 es un cuadro que muestra la adhesión GenBank (s) para las secuencias EST (s) en cada grupo y POPULUSDB unigene singleton.

Material suplementario
Archivo Adicional 1
La lista completa de la muerte de fibra de biblioteca específica de las transcripciones y los correspondientes datos de la expresión génica de los análisis de microarrays. La lista muestra los grupos y singletons exclusivo de la fibra de muerte POPULUSDB dentro de la biblioteca, el número de secuencias EST en cada grupo, anotación, más cercano
Arabidopsis
Gen y el valor BLASTX (
E
), Y la correspondiente expresión de genes de análisis de los microarrays. El registro
2
Expresión ratio (
M
) Se calcula entre la expresión de genes en la muestra B (de fibra de la muerte de la célula) y la muestra A (principios de fibra de desarrollo). Una diferencia estadísticamente significativa en la expresión de genes se prevé para tener transcripciones
P
<0.001 (
T
- Test) y
B>
0 (estadística bayesiana [
55
]).
Archivo Adicional 2
El total de datos de expresión génica en el xilema fibras en la muerte de la célula usando las 25k
Populus
CDNA array y la POPULUSDB. Las transcripciones y la correspondiente distribución de la biblioteca en POPULUSDB se enumeran en orden descendente de expresión de la relación entre el análisis de microarrays. El registro
2
Expresión ratio (
M
) Se calcula entre la expresión de genes en la muestra B (de fibra de la muerte de la célula) y la muestra A (principios de fibra de desarrollo). Una diferencia estadísticamente significativa en la expresión de genes se prevé para tener transcripciones
P
<0.001 (
T
- Test) y
B>
0 (estadística bayesiana [
55
]). Las anotaciones y el
E
Valores se derivan de análisis en contra de la BLASTX
Arabidopsis
Proteoma o la Swiss-Prot base de datos de acuerdo con una anotación en tramitación se describe en [
50
]. La PU definir los números unigene clon números en la matriz.
Archivo Adicional 3
Comparación de los datos de los microarrays de tejidos de xilema
Populus
Y
Arabidopsis
El
Populus
Se seleccionaron los genes que fueron estadísticamente significativas, más de dos veces upregulated fibra en la muestra de la muerte de las células (fibras de maduración tardía; B), en comparación con los principios de desarrollo de fibra (A). La asigna automáticamente
Arabidopsis
Homólogos [
14
] Fueron incluido en la lista de estos
Populus
Genes (columna '
Populus
B / A '), y en comparación con
Arabidopsis
Genes que previamente se upregulated demostrado ser por lo menos dos veces durante el crecimiento secundario en comparación con el crecimiento principal de la inflorescencia se deriva (columna «tratamiento») o en los tejidos de xilema en comparación con la corteza de los hipocotilos (columna 'Xilema') [
41
]. La lista muestra los genes que fueron compartidas por la
Populus
Conjunto de datos y al menos uno de los
Arabidopsis
Conjuntos de datos. '1 'Denota la presencia, y'0' la ausencia de un gen en un conjunto de datos. Las anotaciones fueron derivados de la
Arabidopsis
De recursos de información (TAIR) 28/01/2005. La PU números, que corresponde a la unigene de los clones seleccionados
Populus
Genes, se muestran para cada homóloga
Arabidopsis
Gen.
Archivo Adicional 4
Una tabla que muestra el GenBank (s) de la adhesión de la secuencias EST (s) en cada grupo y POPULUSDB unigene singleton. Una tabla que muestra el GenBank (s) de la adhesión de la secuencias EST (s) en cada grupo y POPULUSDB unigene singleton.
Agradecimientos

Damos las gracias a Andreas Sjödin para el análisis estadístico de los resultados y de microarrays para la visualización de los datos y Edouard Pesquet para el análisis de datos. El trabajo recibió el apoyo de la Fundación Wallenberg, el Consejo Sueco de Investigación para el Medio Ambiente, Ciencias de la Agricultura y Ordenación del Territorio, Escuela de Estudios Superiores de la sueca en Genómica y Bioinformática Kempe y la fundación.