Genome Biology, 2005; 6(4): R38-R38 (más artículos en esta revista)

Derivación de las redes de interacción genético de los datos cuantitativos fenotipo

BioMed Central
Becky L Drees (bdrees@u.washington.edu) [1], Vesteinn Thorsson (vthorsson@systemsbiology.org) [1], Gregory W Carter (gcarter@systemsbiology.org) [1], Alexander W Rives (arives @ gmail . Com) [1], Marisa Z Raymond (Marisa.Raymond @ UCHSC.edu) [1], Iliana Avila-Campillo (iavila@systemsbiology.org) [1], Paul Shannon (pshannon@systemsbiology.org) [1] , Timothy Galitski (tgalitski@systemsbiology.org) [1]
[1] Instituto para Sistemas de Biología, 1441 N. calle 34, Seattle, WA 98103, EE.UU.

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen

Genéticos redes de interacción se deriva de los datos cuantitativos fenotipo mediante el análisis de agar de la invasión fenotipos de cepas mutantes de levadura, que mostraron genéticos específicos modos de interacción con los procesos biológicos específicos.

Antecedentes

Fenotipos están determinados por complejas interacciones entre las variantes de genes y factores ambientales. En biomedicina, que interactúan estos elementos de varios tipos: heredado y somáticos humanos variantes y polimorfismos de genes, los efectos epigenéticos en la actividad de los genes, agentes ambientales, y de drogas, que incluyen combinaciones de fármacos. El éxito de predictivo, preventivo, y la medicina personalizada será necesario no sólo la capacidad de determinar los genotipos de los pacientes y para clasificar a los pacientes sobre la base de impresiones dactilares moleculares de los tejidos. Se requerirá una comprensión de cómo interactúan las perturbaciones genéticas para afectar el resultado clínico. Los avances recientes ofrecen la capacidad de perturbar los genes y el fenotipo de recoger datos sobre una escala genómica [1 - 7]. Para extraer la información biológica en estas bases de datos, paralelamente avances deben realizarse en los conceptos y métodos de cálculo para obtener y analizar la interacción genético-redes. Se presenta el desarrollo y la aplicación de esos conceptos y métodos.

Resultados y discusión
Fenotipo de los datos genéticos y la interacción

Una interacción genética es la interacción de dos perturbaciones genéticos en la determinación de un fenotipo. Interacción genética se observa en la relación entre los fenotipos de cuatro genotipos: el genotipo de referencia, el "tipo salvaje", un perturbado genotipo, A, con una sola perturbación genética, un genotipo perturbado, B, con una perturbación de otro gen; Y un genotipo doblemente perturbado, AB. Genética de las perturbaciones pueden ser de cualquier tipo (como nulas, la pérdida de la función, ganancia de la función, y dominante-negativo). Asimismo, dos perturbaciones pueden interactuar de diferentes maneras para diferentes fenotipos o bajo diversas condiciones ambientales.

Genetistas reconocen biológicamente informativo modos de interacción genética, por ejemplo, epistasis y síntesis. Estos dos modos puede ilustrar las propiedades generales de las interacciones genéticas. Un epistatic interacción ocurre cuando dos mutantes individuales tienen diferentes desviado (diferente de la de tipo salvaje) fenotipos, y la doble muestra el fenotipo mutante de uno de los mutantes. Análisis de las interacciones epistatic puede revelar la dirección del flujo de información en las vías moleculares [8]. Si queremos representar un fenotipo de un determinado genotipo, X, X, Φ, entonces podemos escribir un fenotipo de la desigualdad que representa un ejemplo concreto de la interacción epistatic genéticos, por ejemplo, Φ AWT <Φ Φ B = AB. Asimismo, un sintético interacción ocurre cuando dos mutantes tienen un único tipo salvaje y el fenotipo mutante muestra una doble desviado fenotipo, por ejemplo, WT = Φ Φ Φ A = B <Φ AB. Sintético de las interacciones de los mecanismos genéticos revelan "buffering" [1, 9].

Algunos modos de interacción genética son simétricas; otros modos son asimétricos. Esta simetría o asimetría es evidente en el fenotipo de las desigualdades, y es biológicamente informativo. Epistasis ilustra la interacción genético-asimetría. Si la mutación es epistatic A al B, entonces B está a un hipostática. La asimetría de la epistasis, y la forma de los alelos mutantes (ganancia o pérdida de función), indica la dirección de flujo de la información biológica [8]. Por el contrario, son simétricas sintéticas interacciones. Si es una mutación sintética con B, B con A es sintético. La simetría de la síntesis genética refleja la mutua exigencia de fenotipo buffering [1, 9].

La representación de las interacciones genético como fenotipo desigualdades cabida a todas las posibilidades sin supuestos acerca de cómo interactúan las perturbaciones genéticas. Además, las exigencias cuantitativas (o al menos ordenados) fenotipos. En principio, todos los fenotipos son mensurables; fenotipos complejos (por ejemplo, las diferentes identidades de tipo de células) son la combinación de múltiples subyacentes fenotipos. Hay un total de 75 posibles desigualdades para el fenotipo WT, A, B, y AB. Utilizando un enfoque híbrido que combina las propiedades matemáticas de fenotipo desigualdades y familiar interacción genético-conceptos y nomenclatura, el 75 fenotipo desigualdades se agruparon en nueve exclusivos modos de interacción genética, algunos de los cuales son genéticamente asimétrica (archivo de datos adicional 1). Este planteamiento puede extenderse a las interacciones de más de dos perturbaciones también. Los nueve modos de interacción familiar que se incluyen: noninteractive, epistatic, sintéticas, condicional, la suprimen, y aditivo, y los modos en que se producen, pero sin duda, a nuestro conocimiento, no se han definido previamente: asynthetic, de un solo nonmonotonic, y doble nonmonotonic. Todos se definen los modos de interacción en los materiales y métodos; breves descripciones seguir para la desconocidos (previamente definido) modos. En asynthetic interacción, A, B, AB y todos tienen el mismo fenotipo desviado. En un solo nonmonotonic interacción, el gen mutante muestra efectos opuestos en el WT de fondo y la otra mutante de fondo (por ejemplo, Φ WT <Φ Φ Ay ABB). En doble nonmonotonic interacción, ambos genes mutantes muestran efectos opuestos.

Las redes de interacción genético -

Aplicación de los principios genéticos de la interacción hace que la red de derivación plenamente computables a partir de los datos medidos en cualquier celda de la propiedad con cualquier interacción perturbaciones. Hemos desarrollado un código abierto de múltiples plataformas de software de aplicación llamado PhenotypeGenetics, disponible en [10], un plug-in para el Cytoscape fines generales red plataforma de visualización y análisis [11]. PhenotypeGenetics apoya una especificación XML para la carga de cualquier conjunto de datos, permite que el usuario define los modos de interacción genético-, y apoya todos los de los análisis descritos en el presente documento. Es utilizada para obtener y analizar una interacción genético-red de levadura invasión fenotipo de datos.

En respuesta a la baja sobre el crecimiento de amonio-agar, Saccharomyces cerevisiae MATa MATa / α diploide células de levadura diferenciar de los familiares ovoides única forma de crecimiento de células filamentosas a una forma capaz de invadir el agar sustrato [12]. Invasoras de forma filamentosa crecimiento está regulado por una mitogen-activated proteína quinasa (MAPK) quinasa cascada, el barrio de Ras / cAMP vía, y varios otros caminos [13, 14]. Investigamos la interacción entre los genes genéticos en estas vías y procesos. Cuatro conjuntos de homocigotos mutantes diploides solo y doble mutante se construyeron cepas de levadura (Materiales y métodos). Dos propósitos guiarán la selección de los genes mutantes y las combinaciones a estudiar: para representar a los principales caminos y la regulación de los procesos de invasión, y para garantizar una diversidad de fenotipos invasión (no invasivos, invasivos hipo, de tipo salvaje, y la hiper-invasiva) para permitir la Detección de las diversas interacciones genéticas. Un conjunto de 19 alelos mutantes de los genes clave en el control de las vías de crecimiento invasivo, de los cuales 13 por plásmidos cargo multicopy dominante o alelos de tipo salvaje y 6 supresiones de genes, se cruzó en contra de un grupo de 119 supresiones de genes. Todos los alelos mutantes utilizados en el presente estudio se enumeran en el archivo de datos adicional 2.

Hemos desarrollado un fenotipo cuantitativo invasión de ensayo. Levadura agar-sustrato invasión puede evaluarse por el aumento de las colonias de bajos amonio agar, la eliminación de las células sobre la superficie de agar por lavado, y observar el crecimiento de las células restantes en el interior del agar. Replicar cuantitativos invasión-fenotipo de datos con rangos de error se extrajeron de las imágenes de pre-lavado y después de lavarse las colonias. Cada prueba interacción se registró como una forma de desigualdad, y asigna un modo de interacción genético-. Este proceso se detalla en los materiales y métodos y se ilustran en las Figuras 1a y 1b, utilizando el ejemplo de la epistasis de la deleción del gen FLO11, un importante factor determinante de la invasión, a una supresión de la SFL1 gen, la codificación de un represor de FLO11 . Tenga en cuenta que el error de intervalos limitada (negro bares) para los genotipos en la figura 1b son representativos de todo el conjunto de datos. Estos errores son: flo11, 0,02; flo11 sfl1, 0,01; WT, 0,05; sfl1, 0,06. Adicional archivo de datos 3 muestra una parcela de error de los valores para todos los genotipos ordenados por error de magnitud. El promedio de error es de 0,04.

Visualización gráfica de las interacciones genético reveló una densa red compleja. Para mayor claridad, una pequeña parte de esta red (la interacción entre factores de transcripción) se muestra en la Figura 1c, que ilustran la diversidad genética de las interacciones observadas. Perturbado genes son nodos de la red. Cada prueba alelo combinación genera una ventaja que representa una interacción genética. Edge colores y flechas (en su caso) indican el modo de interacción y asimetría como se indica en la Figura 1d. El conjunto de la red de 127 nodos y 1808 aristas se muestra en el archivo de datos adicional 4. Todos los datos, incluida la prueba interacciones, genotipos, y el fenotipo de datos cuantitativos con valores de error, se enumeran en el archivo de datos adicional 5. Los nueve modos de interacción genético-se observaron interacciones entre la 1808. Que no sea el modo de noninteractive (con 443 apariciones), los más frecuentes fueron los modos aditivo (347), epistatic (271), (245) condicional, y represivas interacción (202). Asynthetic de frecuencias bajas (111), de un solo nonmonotonic (74), sintético (62), y doble-nonmonotonic (52) se observó interacción. Tenga en cuenta que aunque la asynthetic, de un solo nonmonotonic, y doble nonmonotonic modos no son reconocidos por la nomenclatura genética común, que se produzcan sustanciales en las frecuencias.

Perturbaciones genéticas que interactúan con un proceso biológico

Debido a las interacciones genético reflejar interacciones funcionales, una perturbación genéticos pueden interactuar en un modo específico con más de un gen en un proceso biológico. Esta conjetura es apoyada por el hallazgo de 'monocromático' la interacción entre procesos biológicos de los módulos [15]. La tabla 1 recoge las 23 interacciones en un determinado modo de entre un alelo mutante y un proceso biológico. La estadística de validación de estas interacciones se detalla en el Material y métodos. La Figura 2 muestra tres ejemplos. En la Figura 2 bis, un gen de supresión PBS2 es aditivo con mutaciones de la pequeña GTPasa de transducción de la señal mediada por los genes (P = 0,001). Estos genes incluyen en la transducción de señales Rho / polaridad celular vía (BNI1, CLA4, BUD6) y el barrio de Ras / cAMP vía de señalización (RAS2, BMH1, TPK1). Estas vías de señalización contribuir al crecimiento fenotipo invasivo en concierto con la respuesta al estrés regulados por el Pbs2 MAPK kinasa [16]. En la Figura 2b, supresión de genes invasoras de crecimiento DFG16, RIM8, y DIA2 son epistatic a sobreexpresión de la invasión de la activación de Phd1 factor de transcripción (P = 0,002). La combinación de este con la epistasis formas de la interacción de alelos (PHD1 sobreexpresión es una función de la ganancia, mientras que los demás son nulas alelos) conduce a la sugerencia de que DFG16, RIM8, y DIA2 pueden estar reguladas por Phd1. En la Figura 2c, la deleción del gen ISW1 suprime los efectos de las perturbaciones de la pequeña GTPasa de transducción de la señal mediada por los genes CDC42, RAS2 y IRA2 (P = 0,005). ISW1 codifica una ATP-dependientes de la remodelación de la cromatina-factor [17]. Halme et al. [18] han demostrado que la invasión de células de levadura es controlado epigenetically. Alta frecuencia de mutaciones espontáneas IRA1 y IRA2 aliviar el silenciamiento epigenético de genes invasión. La supresión de una mutación por IRA2 mutación ISW1 sugiere la posibilidad de que ISW1 dependientes de la remodelación de la cromatina media IRA2 efectos de la mutación. Tabla 1 y Figura 2 locales ilustran los patrones de interacción entre los genes mutados y los procesos biológicos.

Mutuamente informativo patrones genéticos de la interacción

Las consecuencias fenotípicas combinatoria genética de las perturbaciones son complejas, en un sentido estricto; conocer los fenotipos de dos perturbaciones único, no existen reglas sencillas para saber la combinatoria fenotipo. Como contrapartida de esta complejidad, los grandes conjuntos de datos genéticos de la interacción puede contener en gran escala los patrones de uso. Se examinó la posibilidad de que haya pares de perturbaciones mutuamente informativo con los patrones de interacción genético común de la interacción con sus socios. En otras palabras, a sabiendas de las interacciones de una perturbación puede permitir uno a saber, en cierta medida cuantificables, las interacciones de otra perturbación, y viceversa. Información mutua, y su significado, se ha calculado para todos los pares de perturbaciones compartir a prueba la interacción con otros genes. Para todos los 171 pares de los 19 alelos mutantes de los genes en las principales vías, la información mutua se basa en su interacción con el grupo de 119 supresiones de genes. Del mismo modo, entre todas las 7021 parejas de las 119 supresiones de genes, la información mutua se basa en su interacción con los 19 alelos mutantes de los genes en las principales vías. Entre todos los posibles pares, 23 mostraron significativa (P <0,001) la información mutua (Materiales y métodos adicionales de archivo de datos y 6).

Los resultados sugieren que la mayoría de la información genética de ambas pautas de interacción entre los genes se producen perturbaciones con efectos similares en los procesos biológicos. Por ejemplo, tres de los seis pares de genes mutantes con los más importantes son la información mutua overexpressers de STE12 - STE20, STE12 - CDC42, y STE20 - CDC42 (archivo de datos adicional 6). Estos tres genes codifican componentes centrales de la vía de señalización MAPK promover invasoras de forma filamentosa de crecimiento [14], y muestran patrones similares de interacción genética, como se demuestra con STE12 y STE20 en la Figura 3. El patrón dominante es uno de uniforme interacción (AyB interactúan en el mismo modo con C), lo que sugiere efectos similares del gen perturbaciones en la red molecular subyacente. Además, son frecuentes los casos de reiteradas interacción de modo mixto (A, en algunos interactúa con el modo C, y B interactúa en un modo diferente, con C), lo que sugiere que los efectos de la genética molecular perturbaciones pueden diferir aún muestran diferencias consistentes. Ambos interacción uniforme y coherente de modo mixto contribuir a la interacción mutua de información.

Interacciones genéticas son, en definitiva, una propiedad de una red de flujos de información biológica. La información mutua entre los compañeros de ruta de los genes como miembro STE12 y STE20 apoya esta. La figura 4 muestra una red de información mutua y de los genes perturbado. Cada borde indica significativo de información mutua (archivo de datos adicional 6). Algunos de estos genes en los bordes conectar diferentes procesos celulares. Por ejemplo, una ventaja conecta la GLN3 gen, la codificación de un regulador transcripcional del metabolismo de nitrógeno, y el gen CDC42, la codificación de una GTPasa que participan en la polaridad celular. Tales los casos de información mutua sugieren que en la red molecular subyacente, existen importantes flujos de información entre los distintos itinerarios y procesos.

Además de pairwise información mutua, existe la posibilidad de que múltiples genes pueden presentar importantes de información mutua. La red en la Figura 4 contiene múltiples camarillas-n, n completamente subredes de nodos conectados. Hay una camarilla de 3, incluidos los dos componentes principales (PBS2 y HOG1) de la MAP-kinasa HOG vía, y tres de la superposición de 4 camarillas (con muchos subcliques), que contiene filamentation vía MAPK componentes. El STE12 - STE20 - CDC42 3-camarilla es en este grupo de camarillas. Las camarillas y los grupos sugieren ternarios y órdenes superiores de la información mutua, lo que refleja similitudes en el mundial de los efectos de las perturbaciones en los flujos de información molecular.

Conclusión

El análisis de la determinación de las interacciones genético de levadura invasión fenotipo sugiere algunas perspectivas de la genética a nivel de sistema. El proceso de interacción entre genes y en la Tabla 1 y Figura 2 sugieren que (como se ha señalado para la epistasis y síntesis) existen mecanismos característicos de red que se encuentran subyacentes conocidos y desconocidos modos de interacción genética. La investigación de estos mecanismos debe ofrecer una imagen específica sobre los procesos generales y de las propiedades biológicas de las redes. Hay varias zonas para el desarrollo ulterior del análisis cuantitativo de la interacción genética: en primer lugar, los avances en la medición cuantitativa fenotipo ontologías y, en segundo lugar, el fortalecimiento o la revisión de la interacción genético-Modalidad de definiciones sobre la base de relevancia a los mecanismos de red, en tercer lugar, la extensión de todos los genéticos - Modos de interacción más allá del fenotipo de pedido de incorporar parámetros derivados de fenotipo magnitudes, y en cuarto lugar, la genética comparativa de los análisis de la interacción de múltiples alelos (con diferentes efectos sobre la función) de cada uno de los genes para saber cómo diferentes niveles de impacto de la actividad de los genes de la red.

El mundial de los patrones de interacción genético-se ilustra en las figuras 3 y 4 son lecturas del estado de la red molecular subyacente. Datos sobre el genotipo y fenotipo son esenciales para la comprensión del metabolismo y flujo de información caminos. Los datos genéticos, integrado con los datos de actividad de los genes y la interacción molecular de los datos, revelan dirección de la corriente de información, activaciones, de la represión, los controles y combinatoria. El genoma integración de la escala molecular-cableado mapas, datos de expresión de genes-, y las redes de interacción genético-permitirá el desarrollo de modelos biológicos de la red que explícitamente predecir el fenotípica consecuencias de las perturbaciones genéticas [19].

Materiales y métodos
Cuele construcciones

Un total de 127 genes implicados en la regulación de la invasión fueron seleccionados para el estudio de las búsquedas de la base de datos de YPD [20] y de perfiles de expresión génica de los experimentos [21, 22]. 138 alelos mutantes de esos 127 genes, incluidos 125 supresiones y 13 de plásmidos tener alelos, se reunieron (archivo de datos adicionales 2). Single-diploide cepas mutantes homocigotos se construyeron en la invasión de Σ1278 b competentes en ciernes-cepa de levadura de antecedentes. Construcciones por cuadruplicado, de 19 de alelo mutante subconjunto, incluyendo los 13-plásmido cargo y seis alelos del gen supresiones, se cruzó en contra de la supresión de otros 119. Homocigotos diploide doble mutantes se han generado de la siguiente manera.

Single-deleciones en el gen de la invasión competentes Σ1278 b levadura de antecedentes se construyeron. 'Barcode' supresión de la inserción de genes alelos [5] PCR se amplificó con varios centenares de pares de bases de acompañamiento de las secuencias de sus antecedentes no invasiva cepa. El uso de la droga-G418 resistencia cassette de estos alelos, cepa G85 (MATa MATa / α ura3 Δ0 / ura3 Δ0 his3 Δ0:: hisG/his3 Δ0:: hisG) se transformó con productos de la PCR. Gene desorganización y la presencia de la inserción KanMX4 fueron verificadas por PCR. Los heterocigotos son diploides esporulados y la consiguiente tetrads fueron disecados y selección para seleccionar G418 resistentes MATa MATa y MAT α haploids. Estos fueron cruzadas para obtener homocigotos diploide-gen de supresión cepas.

Algunos de los dobles mutantes fueron generados por la transformación de la supresión homocigotos con cualquiera de las dos cepas de baja copia plásmidos teniendo alelos dominantes o multicopy (2 μ m de base) plásmidos teniendo alelos de tipo salvaje. Todos los plásmidos utilizados nativo de genes promotores. Plásmido transformaciones se realizaron con una versión adaptada de un protocolo de transformación multiwell [5, 23]. Cuatro independiente transformantes fueron almacenados y ensayados para cada transformación. Cepas también se transformó con el vector vacío plásmidos.

El alto rendimiento de la construcción diploide homocigotos doble supresión cepas necesario el uso de tres marcadores de resistencia a las drogas para poder seleccionar el que desee para diploides y cepas intermedias. Para cada supresión, la KanMX4 marcadores de resistencia a las drogas se convirtió a otros dos marcadores de resistencia a las drogas, HygMX4 (hygromycin resistencia) y NatMX4 (nourseothricin resistencia). MAT gen α-supresión cepas fueron transformados con el cassette NatMX4 amplificado de pAG25 [24]; Nat G418 R S transformantes fueron abastecidos. MATa MATa gen de supresión cepas fueron transformados con el cassette HygMX4 amplificado de pAG32 [24]; Hyg R S G418 transformantes fueron abastecidos.

El alto rendimiento de la construcción diploide homocigotos doble supresión cepas requiere la capacidad de seleccionar haploids apareamiento de cada tipo por separado. Para lograr esto, hemos utilizado la resistencia a la canavanina recesiva causada por la alteración de la CAN1 gen, la codificación de los transportistas, que en combinación con fusiones de la ORF HIS3 a los promotores de los genes se expresa en un determinado tipo de apareamiento. Una supresión de la CAN1 gen se construyó sin introducir cualquier marcador o secuencias de genes. Un doble varados 60mer oligonucleótido que contiene 30 bases de la región río arriba fusionados directamente a 30 bases de la región aguas abajo de la CAN1 marco de lectura abierta (5'-GTAAAAACAAAAAAAAAAAAAGGCATAGCAATATGACGTTTTATTACCTTTGATCACATT-3 ') se amplificó con 60mer primers CAN1 adicionales que contienen secuencias de acompañamiento (avance cartilla 5'-CGAAAGTTTATTTCAGAGTTCTTCA GACTTCTTAACTCCTGTAAAAACAAAAAAAAAAAA-3 ', 5'-invertir primer GTGTATGACTTATGAGGGTGAGAATGCGAAATGGCGTGGAAATGTGATCAAAGGTAATAA-3'). El producto resultante de PCR se utilizó para transformar dos cepas de canavanina resistencia. Completo supresión de la CAN1 gen fue confirmada por PCR. Esto generó tensiones G264 (MATa MATa his3 Δ:: hisG can1 Δ) y G266 (MAT α his3 Δ:: hisG can1 Δ). Para construir fusiones de la ORF HIS3 de apareamiento específicos para cada tipo de genes, la S. Kluyveri HIS3 gen se amplificó desde pFA6-His3MX6 [25] con los primers ORF-que contiene secuencias de acompañamiento para la MFA1 locus (adelante primer 5'-GTTTCTCGGATA AAACCAAAATAAGTACAAAGCCATCGAATAGAAATGGCAGAACCAGCCCAAAA-3 ', 5'-invertir primer AAGGAAGATAAAGGAGGGAGAACAACGTTTTTGTA CGCAGAAATCACATCAAAACACCTTTGTT-3') y con los cebos que contienen Secuencias de acompañamiento para el MF α 1 locus (adelante primer 5'-GATTACAAACTATCAAT TTCATACACAATATAAACGATTAAAAGAATGGCAGAACCAGCCCAAAA-3 ', 5'-invertir primer ACAAAGTCGACTTTGTTACATCTACACTGTTGTTA TCAGTCGGGCTCACATCAAAACACCTTTGGT-3'). Los productos resultantes de PCR se utilizaron para transformar G264 y G266, respectivamente, para crear cepas G544 (MATa MATa his3 Δ:: hisG can1 Δ mfa1:: HIS3) y G546 (MAT α his3 Δ:: hisG can1 Δ mf α1:: HIS3).

Cruces y sporulations se llevaron a cabo para presentar el canavanina-marcadores de la resistencia y el apareamiento de tipo específico-Su + marcadores. MAT α Nat R supresión cepas fueron cruzadas con G544. Nat Ura + R diploides fueron seleccionados, y todos fueron Can y Su S -. Estos son diploides esporulados; de azar esporas preparativos Nat R ¿R + Su Hora - MATa MATa haploids fueron identificados. MATa MATa Hyg R supresión cepas fueron cruzadas con G546. Estos son diploides esporulados; de azar esporas preparativos Hyg I Can I + Su Hora - MAT α haploids fueron identificados.

Para realizar el diploide homocigotos doble supresión cepas, una serie de alto rendimiento y sporulations cruza, en el que todos los tipos de células intermedias y supresión genotipos podría ser seleccionado, se llevó a cabo [1]. En todas las etapas, varias cepas fueron verificados individualmente. Nat R MATa MATa solo supresión cepas fueron cruzadas a una variedad de MAT α G418-R único supresión cepas. Hyg R MAT-α único supresión cepas fueron cruzadas a una variedad de MATa MATa G418-R único supresión cepas. A partir de estos cruces Nat R R diploides G418 y G418 Hyg R R diploides fueron seleccionados, respectivamente. Diploides de cada cruz se esporulados. Haploides doble supresión cepas fueron seleccionados: ¿Su + R (MATa MATa haploides) G418 R Nat R de doble SEGREGANTES supresión, y ¿Su + R (MAT α haploides) G418 R Hyg R de doble supresión SEGREGANTES, respectivamente. Las matrices resultantes de MATa MATa y MAT α haploides supresión de la doble acoplado y fueron sometidas a selección para G418 R, Nat R, y la R para generar Hyg diploide homocigotos doble supresión cepas.

Determinación de la levadura de invasión

Las cepas fueron inoculadas congelado las reservas de líquido en los medios de comunicación en placas de 96 pozos y se incubaron 18 horas a 30 ° C. Cada placa incluyó al menos ocho pozos que contienen los controles de tipo salvaje. Las células fueron transferidas con un 96-flotante-Pin Replicator colonia y copiadora (V & P Científicas) en SLAD agar [12] en un omnitray. Cada placa de 96 pocillos fue depositado por cuadruplicado, lo que resulta en un total de 384 colonias por SLAD-agar en placa. Tenga en cuenta que cada genotipo se construyó en cuatro y ensayaron en placas diferentes. Por lo tanto, cada genotipo fue ensayada con un total de 16 repeticiones. Las placas fueron incubadas por 4 días a 30 ° C. Después de la incubación, las células material fue retirado de la superficie de agar mientras que la placa de lavado con agua corriente. Una imagen en escala de grises 300 dpi de cada placa se generó antes y después del lavado, colocando la placa boca abajo sobre un scanner y escaneo con luz transmitida. Las imágenes fueron invertidos utilizando Adobe Photoshop 6 y guardar como archivos TIFF cuantitativos de análisis de imagen.

Procesamiento de datos de ensayo de invasión

Colonia de crecimiento y la invasión se cuantificaron utilizando Dapple [26], el software diseñado originalmente para el análisis de imágenes de microarrays de ADN. Cada posterior a la de lavado de imagen se analizaron simultáneamente con las correspondientes pre-lavado de imagen para que fiable definición de los límites de la colonia y la comparación directa de material celular. La resta de antecedentes locales intensidad dado un-normalizaron los valores de crecimiento (G) y la invasión (U) y de invasión ratio (R = U / G). Un factor de normalización para cada plato, N p, se obtuvo de múltiples controles de tipo salvaje en cada plato. Para cada repetir q en la placa p, se obtienen el tipo salvaje invasión ratio R wt q, p = q wt U, p / G wt q, p y define la placa de la normalización como factor N N p p = q mediana (R wt Q, p) / p media (mediana q (R wt q, p)). Para un determinado genotipo g, la ratio normalizado de invasión se da por q R g, p = (U q g, p / q G, g, p) / N = p R i g donde en la última igualdad hemos renumerado en un único ordinal El índice de repeticiones N i = 1,2, .., N (N ≤ 16). Se excluyeron cualquier genotipo g para que N <5 debido, por ejemplo, al déficit de crecimiento. A partir de datos normalizado, derivados fenotipo valores y errores de medición. Se obtuvo la media de coeficiente R = mediana i g (g R i), y la mediana de la desviación absoluta MAD MAD = g (g R i) = i mediana (| g R i - R g |). Como límite inferior de error en las estimaciones se utilizó MAD Q = 0,1, el décimo percentil de todos los g MAD. Así, el fenotipo de los valores se presentan como R g, con error máximo E = g (g MAD, MAD Q = 0,1). Las frecuencias de los modos de interacción genético-se insensible a los aumentos del error límite inferior al percentil 50. Dirigido controles de los distintos componentes del procesamiento automatizado que se realizaron durante. Estos incluyen: la inspección visual de cada imagen, comprobar la morfología de la colonia, la comprobación in situ de cada bien caracterizado cepas de principio a fin en el análisis de tuberías, la detección de errores sistemáticos en las intensidades de ensayo. Nos confirmó que la placa-sabia normalización no dio lugar a la amplificación de errores debido a la división de pequeños números.

Derivación de las desigualdades fenotipo

Los siguientes pasos se llevaron a cabo utilizando el software PhenotypeGenetics. Fenotipos y genotipos de errores WT, A, B, AB y [(R wt, wt E), (R A, E A), (B, R, B, E) y (R AB, AB E)] se asignará un Fenotipo desigualdad relación. Esto se hizo por primera definición de los límites de error de intervalo I = g [R g - g E, R g + E g] para cada genotipo. Todos los pares de genotipos se les asignó una igualdad, Φ Φ g1 g1 = g2 g2 si intervalo I g1 g1 superponen con I g2 g2. Transitividad de las igualdades (si a = b y b = c, entonces a = c) se aplicó a los grupos de rendimiento disjunta fenotipo igualdades. Desigualdades, mayor que (>) o menor que (<) fueron asignados para la igualdad de las relaciones entre grupos. Las desigualdades resultantes fueron asignados a los modos de interacción genético-las asimetrías y como se describe a continuación. Los resultados de todas las pruebas genéticas de la interacción se dictaron como un gráfico como se ilustra en la Figura 1d. Toda la red resultante se muestra en el archivo de datos adicional 4. Uno puede obtener PhenotypeGenetics software, o utilizarlo para analizar la invasión en red [10].

Modos de interacción genético -

El fenotipo de 75 posibles desigualdades fueron asignados a los modos de interacción genética sobre la base de criterios computables. Para cada modo, la lista de criterio para la inclusión de un fenotipo de la desigualdad. En estos criterios, 'fondo' se refiere a un genotipo con su complemento de la naturaleza y el tipo de genes mutantes, en el que otras perturbaciones genéticas se añaden, y "efecto" se refiere a un cambio en el fenotipo, ya sea un aumento o una disminución, a Un solo genéticos perturbación de un fondo. En los ejemplos siguientes, otros casos podrían ser generados por operaciones tales como el intercambio de AyB, o revertir el efecto de los dos alelos (por ejemplo, revertir el efecto de la A gen mutante con Φ WT <Φ da un Φ AWT). Datos adicionales archivo 1 se enumeran cada una de las 75 fenotipo de las desigualdades y se les asignó el modo de interacción genético-y asimetrías. Figura 1d visualización gráfica muestra que los nueve modos de interacción genético-.

Genéticos interacción con los procesos biológicos

Para identificar correlaciones estadísticamente significativas entre un determinado alelo de los modos de interacción y los procesos biológicos, los vecinos de cada alelo en la red se les preguntó por la clase y la interacción de genes Ontología (GO) Consorcio anotaciones base de datos [27]. Cada clase se define la interacción de la interacción y el modo de dirección, si las hubiera. Por ejemplo, 'A suprime B "y" A es reprimida por B' se colocan en diferentes clases de interacción. Hay 13 clases de interacción y 9 modos de interacción (descrito anteriormente). Probabilidad se calcularon los valores de encontrar excesivamente representados clase de anotación emparejamientos dentro de cada conjunto de los vecinos más cercanos, y P-valores fueron asignados en relación con un acumulado de distribución hipergeométrica. El resultado fue una lista generada por computadora biológica de las declaraciones relativas genes, la interacción clases, y la meta anotaciones, con inscripciones tales como "Una pérdida de la función de la mutación de HSL1 es reprimida por mutaciones organización de la pared celular y la biogénesis de los genes (-log 10 P = 2,52). " Estos se enumeran en forma de cuadro en el cuadro 1.

Para calibrar la importancia de los resultados, un paralelo cálculo se realizó para cada prueba en la red en la que las probabilidades fraccional de cada uno de los posibles resultados se agregaron a una distribución general de los P-valores para toda la red. Por ejemplo, si una determinada mutación interactúa con otros N, N C, de las interacciones del ser y de la clase C N A, de los vecinos llevar una anotación, hay un conjunto finito de resultados para el N CA, el número de mutaciones vecino con una anotación C conectada a través de la interacción. Los valores posibles de N CA siguen una distribución hipergeométrica discretos, y resumiendo estas distribuciones más de todas las pruebas en la red se obtiene un formalmente al azar de la distribución de P-valores que se ha visto limitada por la topología de la red. Las distribuciones, real y teórica, de log 10 P-valores se comparan entonces por realizar una prueba de ji al cuadrado comparables entre histogramas. Estas pruebas revelaron un fuerte exceso de log 10-P> 1,8.

Mutual información genética de los patrones de interacción

Se calcularon la información mutua [28] de pares genéticos de las perturbaciones. Cada perturbación, X, tiene una distribución de probabilidad discreta observó interacción de las clases (que se define por el modo y dirección) a prueba la interacción con sus socios, P (x), donde xX, el conjunto de clases de interacción perturbación X, y:

Información mutua, I, de un par de perturbaciones, AyB, es la entropía de la distribución de probabilidad conjunta de su relación con su probabilidad de distribución de productos. Así:

Importancia de la información mutua se puso a prueba independiente para cada alelo par de computación de la probabilidad de obtener la puntuación observada en los datos permutada al azar. Para eliminar el sesgo debido a nuestra selección de alelos mutantes, aleatorio de datos se vieron limitados por el mantenimiento de tipo silvestre y dos fenotipos mutantes único fijo y que sustituye la interacción clases sólo con las clases que están en consonancia con la observada solo fenotipos mutantes. La elección entre las clases era posible sustitución ponderado por la frecuencia observada en el conjunto de la red. Pruebas empíricas muestran resultados aleatorios de información mutua que se distribuye normalmente, y múltiples randomizations se llevaron a cabo para determinar una media y desviación estándar para caracterizar la distribución para cada prueba alelo par. P-valores fueron calculados como la probabilidad de encontrar una información mutua Resultado En o por encima de la puntuación observada. Alelo pares con probabilidades por debajo del punto de corte de P <0,001 se enumeran en el archivo de datos adicional 6, y se muestra como un gráfico en la Figura 4.

Adicional de los archivos de datos

Los siguientes datos están disponibles con la versión en línea de este documento. Datos adicionales archivo 1 es un cuadro que muestra la interacción genético-75 las desigualdades en nueve modos de interacción genética. Datos adicionales archivo 2 se enumeran las perturbaciones de genes utilizados en este estudio. Adicional archivo de datos 3 es una cifra tramando fenotipo valores de error en todo el conjunto de datos. Datos adicionales archivo 4 se muestra la interacción de toda la red genéticos derivados de la invasión de levadura-fenotipo de datos. Datos adicionales archivo 5 listas fenotipo de datos para todas las interacciones a prueba. Datos adicionales 6 listas de archivos de información mutua en los patrones de interacción genético-.

Material suplementario
Archivo Adicional 1
Una tabla que muestra la interacción genético-75 las desigualdades en nueve modos de interacción genética. Como se describe en Materiales y métodos, todos los 75 posibles desigualdades fenotipo fueron clasificados en nueve modos de interacción genética. Los resultados se resumen aquí.
Archivo Adicional 2
Gene perturbaciones utilizada en este estudio. Este archivo lista todos los genes, alelos mutantes, y el alelo formas (por ejemplo, null, ganancia de función, etc)
Archivo Adicional 3
Fenotipo error de los valores en todo el conjunto de datos. Esta trama muestra el fenotipo de los valores de error (Materiales y métodos) conspiraron contra percentil de todos los genotipos ordenados por error de magnitud.
Archivo Adicional 4
Toda la red de interacción genéticos derivados de la invasión de levadura-fenotipo de datos. Figura
1c
Muestra una pequeña parte de la interacción genético-red. Este archivo contiene una imagen incluyendo todas las interacciones a prueba.
Archivo Adicional 5
Fenotipo datos de prueba para todas las interacciones. Este archivo lista todos los probados interacciones genéticas, así como el fenotipo de error y los valores de todos los genotipos,
WT
,
A
,
B
, Y
AB
Archivo Adicional 6
Información mutua en los patrones de interacción genético-. Este archivo lista la información mutua, y la importancia, entre los pares de genes conectados por bordes en la figura
4
Agradecimientos

Damos las gracias a J. Aitchison, C. Aldridge, G. Iglesia, L. Hood, S. Istrail, A. Markiel, S. Prinz, F. Roth, D. Segre, y J. Taylor por sus contribuciones. Este trabajo fue financiado en parte por Merck & Co VT recibió el apoyo de NIH Grant P20 GM64361. TG es un receptor de un Fondo Burroughs Wellcome Premio en la carrera de Ciencias Biomédicas.