Journal of Inflammation (London, England), 2005; 2: 3-3 (más artículos en esta revista)

La dexametasona inhibe la producción de IL-9 por las células T humanas

BioMed Central
Lauren E Holz (l.holz @ centenary.usyd.edu.au) [1], Kristoffer P Jakobsen (porsj@hotmail.com) [1], Jacques Van Snick (vansnick@mail.icp.ucl.ac.be) [3], Francoise Cormont (francoise.cormont @ gskbio.com) [3], William A Sewell (w.sewell @ garvan.org.au) [1]
[1] Garvan Institute of Medical Research, 384 Victoria St, Darlinghurst, NSW 2010, Australia
[2] Centre for Immunology, St. Vincent's Hospital, University of NSW, NSW 2052, Australia
[3-1200 Bruselas, Bélgica
[4] St Vincent's Clinical School, University of NSW, NSW 2052, Australia

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Interleukina 9 (IL-9) es producido por la activación de células T CD4 +. Sus efectos incluyen la estimulación de la producción de moco, el aumento de la proliferación de las células mástil, el aumento de eosinófilos función, y la producción de IgE. Estos efectos son compatibles con un papel en las enfermedades alérgicas. Los glucocorticoides tienen potentes efectos antiinflamatorios, incluida la supresión de la síntesis de citoquinas, y son ampliamente utilizados en el tratamiento de las enfermedades alérgicas.

Métodos

Se examinó el efecto de los glucocorticoides dexametasona (DEX), el IL-9 mRNA expresión y secreción de proteínas en tiempo real con RT-PCR y ELISA. Células mononucleares de sangre periférica (PBMC) se preparan a partir de voluntarios humanos y activado con OKT3. Los linfocitos T CD4 + fueron purificados de PBMC y activado con OKT3, más PMA.

Resultados

IL-9 mRNA abundancia y la secreción de la proteína son a la vez reducido después del tratamiento de PBMC activado con DEX. MRNA niveles se redujeron a 0,7% y los valores de control de la secreción de la proteína se redujo a 2,8% de los controles. En los linfocitos T CD4 +, DEX reducida la secreción de la proteína a una medida similar. El valor de la CI 50 DEX en mRNA expresión fue de 4 nM.

Conclusión

Estos resultados indican que la producción de IL-9 es muy marcadamente inhibida por DEX. Los resultados plantean la posibilidad de que los efectos beneficiosos de los glucocorticoides en el tratamiento de las enfermedades alérgicas son, en parte, mediada por la inhibición de la producción de IL-9.

Antecedentes

Los linfocitos T CD4 + de la T helper 2 (Th2) tipo han sido implicados como principales contribuyentes a la patología del asma alérgica [1]. Las células Th2 producen citocinas IL-4, IL-5, IL-9 e IL-13. IL-9, que se identificó por primera vez como un factor de crecimiento de células T [2], tiene múltiples efectos en consonancia con un papel en la inflamación alérgica. IL-9 actúa sobre el epitelio pulmonar para inducir la producción de moco [3] y quimiocinas [4]. Aumenta la función de eosinófilos a través de la inducción de IL-5 receptor [5]. IL-9 induce la síntesis de la inmunoglobulina todos los isotipos, en especial IgE [6]. Mastocitos cifras son elevadas en el pulmón por IL-9 [7].

Hay evidencia en estudios clínicos para una asociación entre IL-9 y asma alérgica. En biopsias bronquiales, las células que expresan IL-9, que son predominantemente células T, se incrementaron en los pacientes con asma alérgica, y esta se asoció con hiperreactividad bronquial [8, 9]. Una asociación entre IL-9 y de las células que expresan eosinofilia también se ha descrito [10]. En pacientes con asma alérgica, IL-9 en el líquido broncoalveolar se aumentó después segmentaria alergeno desafío [11]. Entre una serie de citoquinas producidas por PBMC estimulados in vitro, la IL-9 se encontró a tener la mejor correlación con la reactividad alérgica, medida por pruebas de punción cutánea [12].

Varios estudios en animales han investigado el papel de la IL-9 en el asma alérgica. En ratones transgénicos con pulmonar elevada expresión de la IL-9, hubo una mayor afluencia de células inflamatorias de los pulmones, el aumento de la producción de moco y el aumento de los mastocitos números [13]. En dos estudios separados modelo murino de asma inducida por alergenos, la administración de neutralizantes anti-IL-9 anticuerpos reducido eosinofilia, BHR, las vías respiratorias y daños IgE [14, 15]. En un modelo de infección parasitaria con una respuesta Th2, IL-9 knockout mice mostradas reducido y la hiperplasia de las células goblet matocitosis [16]. Sin embargo, en un modelo de asma alérgica, hiperreactividad de vías aéreas, eosinofilia y la hiperplasia de las células goblet no se altera en IL-9 ratones knock-out [17]. A pesar de los resultados en los ratones knock-out, en general las pruebas de los modelos animales es coherente con evidencia clínica de que la IL-9 puede tener un papel en el asma alérgica.

Los glucocorticoides (GC) son un componente importante del tratamiento del asma y otros trastornos alérgicos. GC citoplásmica se unen a los receptores de glucocorticoides (GR), y GC / GR complejos a trasladar el núcleo de la célula donde se estimulan o inhiben la transcripción de un gran número de genes. Los efectos antiinflamatorios de los GC se han asociado con la inhibición de la transcripción de numerosas citocinas [18]. GC reducir notablemente la transcripción de genes de las citocinas Th2 IL-4 [19], IL-5 [20] y la IL-13 [21], así como la inhibición de la producción de muchas otras citoquinas incluyendo IL-2 [22], GM-CSF [23] y el interferón gamma (IFN-γ) [24]. Por el contrario, GC inducen la expresión de ciertas citoquinas, incluyendo IL-10 [25], IL-1 antagonista del receptor (IL-1Ra) [26] y el factor de crecimiento transformante-beta [27], y la GC no afectan a la expresión de M - CSF [23].

Dado lo extenso de pruebas de IL-9 puede ser un candidato de citoquinas en la patogénesis de las enfermedades alérgicas, fomento de la investigación de la regulación de la producción de IL-9 se justifica. Dado que los glucocorticoides son eficaces en el tratamiento de las enfermedades alérgicas, es importante comprender sus efectos en los genes que son potencialmente relevantes para la patogénesis de estas enfermedades. Por lo tanto, hemos investigado el efecto de los glucocorticoides sintéticos dexametasona (DEX) en la producción de IL-9.

Métodos
Cultivo de células

Sangre periférica fue donado por voluntarios sanos del Instituto Garvan de Investigación Médica y el Centro de Inmunología. Los procedimientos fueron aprobados por el Comité de Ética de Investigación Humanos, St Vincent's Hospital, Sydney y se encuentran en el cumplimiento de la Declaración de Helsinki. Células mononucleares de sangre periférica (PBMC) se aislaron por ficoll basado en la densidad de centrifugación. Las células se resuspendió en medio completo que consta de medio RPMI 1640 (JRH Biosciences, Lenexa, KS, EE.UU.) suplementado con 10% v / v inactivado por calor suero fetal bovino (SFB) (CSL Ltd, Parkville, Australia), 2 mM L - Glutamina, 20 mM HEPES buffer, 100 U / mL de penicilina y 100 μ g / ml estreptomicina (todos de Invitrogen, Carlsbad, CA, EE.UU.). Viabilities de células y se determinó a través de azul de tripan exclusión en un haemocytometer. La viabilidad fue siempre superior al 95%.

PBMC se ajustaron a 1 × 10 6 células / ml y se incubaron a 37 ° C en 5% CO 2 para el período de actividad. PBMC fueron tratados con 100 ng / ml OKT3 (diluida en PBS) o con el correspondiente volumen de PBS. OKT3, una especie de regalo de Janssen-Cilag, Sydney, Australia, las causas de activación de células T por medio de la unión a las células T específicas de la superficie molécula CD3. Las células fueron tratadas con DEX (Sigma, Castle Hill, Australia) o con el correspondiente volumen de PBS. DEX fue diluida en PBS, y añadió inmediatamente después de OKT3.

En algunos experimentos, los linfocitos T CD4 + fueron purificados por incubando en PBMC completa mediano durante 90 minutos a 37 ° Cy 5% de CO 2 en la depleción de células adherentes. Las células no adherentes luego se centrifuga y resuspendido en MACS Buffer (0,5% de SFB y 2 mM EDTA en PBS) y MACS humanos CD4 + micro perlas (Miltenyi Biotec, Auburn, California, EE.UU.), con arreglo a las instrucciones del fabricante. Después de la incubación, las células fueron lavadas y las células T CD4 + fueron aislados por un MACS LS columna colocada en una MACS Separador de acuerdo a las instrucciones del fabricante (Miltenyi).

Pequeñas alícuotas de las células CD4 + fueron analizadas por citometría de flujo. Las células se tiñeron con anti-CD3 FITC y anti-CD4 PE anticuerpos y analizados en un FACSCalibur utilizando software CellQuest (todos BD Biosciences, San Jose, CA). Por lo menos 98% de las células CD3 y CD4 expresó. Las células CD4 + se cultivaron al anterior excepto que se les estimuló con un conjunto de 8 ng / ml PMA (Sigma) y la placa determinada OKT3. OKT3 fue vinculado al 12-y además de las placas por 10 μ g / ml de OKT3 en PBS a 4 ° C durante la noche. La solución de anticuerpos fue retirado inmediatamente anteriores a la adición de las células.

RT-PCR

Después de la cultura durante 24 horas, las células fueron centrifugadas a 440 g durante 5 min. ARN total fue extraído por Trizol (Invitrogen), de acuerdo con las instrucciones del fabricante. ARN fue disuelto en el agua tratada con DEPC y almacenados a -70 ° C hasta que se precise. Concentración de ARN se determinó mediante espectrofotometría. 2 μ g de ARN total fue calentada a 65 ° C durante 5 min, enfriado por 2-3 min en hielo, y revertir transcritas por el virus aviar myeloblastosis la transcriptasa inversa (RT-AMV), con 1 μ M oligo (dT) 15 primer (Roche , Castle Hill, Australia), AMV-20U enzima RT (Roche), 1 mM dNTP (Roche), AMV-RT buffer (50 mM Tris-HCl, 8 mM MgCl 2, 30 mM KCl, 1 mM dithiothreitol) (Roche) DEPC-agua y en un 20 μ l de volumen a 42 ° C por 1 hora. Tubos se calienta a 65 ° C durante 5 min y almacenado a -20 ° C hasta que se precise.

Para la IL-9 PCR, en un 20 μ L mezcla de reacción, 1 μ l cDNA fue amplificado por PCR cuantitativa Platinum Supermix UDG (1,5 U Platinum Taq polimerasa, 20 mM Tris-HCl, 50 mM KCl, 3 mM MgCl 2, 200 μ M dGTP, 200 μ M dATP, 200 μ M dCTP, 200 μ M dUTP, 1U Uracil DNA glycosylase (UDG)) (Invitrogen), el agua Milli-Q, M, de 0,4 μ adelante y atrás los primers y sondas Taqman (Geneworks, Rundle Mall, Adelaide, Australia) Con secuencias 5'CCTGGACATCAACTTCCTCATC3 ', 5'CATGGCTGTTCACAGGAAAA3' y 5'FAM-CTCTGACAACTGCACCAGA-TAMRA3 ', respectivamente. PCR se realizó con un Rotorgene 3000 PCR en tiempo real de máquinas (Corbett Research, Mortlake, Sydney, Australia). No plantilla controles (NTC), con agua en lugar de cDNA se incluyeron en todos los experimentos. La reacción de las condiciones de la IL-9 PCR en tiempo real fueron 95 ° C durante 3 min seguido de 40 ciclos de 95 ° C durante 15 segundos luego de 60 ° C durante 60 segundos. Adelante y atrás primers fueron diseñados para diferentes exones se unen a fin de que cualquier ADN genómico de amplificación se podrían distinguir de cDNA.

La eficiencia de amplificación de PCR se determinó en cada experimento de serie cuatro veces diluciones de la muestra que no tiene activado el DEX. Estas muestras diluido y sin diluir todas las muestras fueron analizadas de nuevo en doble ejemplar por PCR en tiempo real en las mismas condiciones. La amplificación de la eficiencia fue determinada por el trazado de la media del ciclo umbral (Ct) diluido el valor de las muestras contra el registro de la dilución. IL-9 de amplificación de la eficiencia varió de 1,63 a 1,99. La eficiencia real de la amplificación fueron utilizados para determinar los coeficientes de las muestras tratadas con y sin DEX.

A β-actina de PCR también se realiza en cada muestra. 1 μ L cDNA se amplificó en 25 μ l en buffer de PCR (10 mM Tris-HCl, 1,5 mM de MgCl 2, 50 mM KCl) (Roche), 0,25 mM dNTP (Roche), 1 X SybGr (Molecular Probes, Eugene, OR, EE.UU. ), 0,75 U Taq polimerasa (Roche), 2 mM de MgCl 2 y 0,32 μ M de adelante y atrás β-actina cartilla (Geneworks) con secuencias 5'CCAACTGGGACGACATG3 'y 5'CAGGGATAGCACAGCCT3', respectivamente [20]. Las muestras fueron amplificadas por 94 ° C por 2 min seguido de 30 ciclos de 94 ° C durante 15 segundos, 56 ° C durante 20 segundos y 72 ° C durante 20 segundos. Para confirmar la identidad de los productos PCR, todos los productos son de tamaño fraccionada por electroforesis en gel de agarosa, y los productos con aparente movilidad en consonancia con el tamaño esperado (277 pb para IL-9 y 203 pb para β-actina) se detectaron.

Ensayos de ELISA

ELISA ensayos se utilizaron para determinar la IL-4, IL-9 e IFN-γ concentración en la cultura sobrenadantes. La IL-9 reactivos (captura de anticuerpos, estándar, y la detección de anticuerpos) se han descrito anteriormente [28], mientras que la IL-4 e IFN-γ se adquirieron kits de BD Biosciences. 384 así MAXISorp placas de fondo plano (Nunc, Roskilde, Dinamarca) fueron utilizados. En el IL-9 de ELISA de captura de anticuerpos, mh9a4, se diluyó en una capa de amortiguación (20 mM glicina, cloruro de sodio 30 mM, pH 9,2) a una concentración de 5 μ g / ml. Después de la noche a la mañana de incubación a 4 ° C y lavado con 0,05% de Tween-20 en PBS, la placa fue bloqueado con el diluyente de ensayo, el 1% (w / v) BSA en PBS, incubadas a 37 ° C durante al menos 2 horas y lavado De nuevo. Antes de una final de un día de incubación a 4 ° C, las muestras y las normas de ensayo se prepararon de diluyente, y la carga en los pozos por triplicado. Las normas se prepararon en dos veces diluciones de 500 pg / mL a 3,9 pg / mL. Tras el lavado, la detección de anticuerpos mh9a3 biotina-se añadió en un 1:2000 dilución por 2 horas a 37 ° C. Las placas fueron lavadas y streptavidina-peroxidasa de rábano se añadió el conjugado (DakoCytomation, Glostrup, Dinamarca) 1:500 en diluyente de ensayo, y las placas fueron incubadas a temperatura ambiente durante 30 min. La IL-4 e IFN-γ ELISA ensayos se realizaron de acuerdo a las instrucciones del fabricante. El límite inferior de detección se 3.9-15.6 pg / mL para IL-9, 7,8 pg / ml para IL-4 y 3,9 pg / mL de IFN-γ. Si los resultados con y sin DEX se presentaron en porcentajes, si la muestra era indetectable en el ELISA, el límite inferior de detección del ensayo fue utilizado en el cálculo.

Todos los ensayos fueron lavados, cargados de solución TMB Substrate (BD Biosciences) en una mezcla de 1:1 TMB sustrato AyB, y incubados a temperatura ambiente en la oscuridad de 30-45 minutos antes de la reacción se detuvo con 2 MH 2 SO 4. Absorbancia fue medida por un lector de imágenes utilizando Spectra X-Plus leer software (Tecan, Maennedorf, Suiza).

Estadísticas

Las muestras se compararon con la prueba de los rangos con signos de Wilcoxon (5,0 Statview Software, Abacus Concepts, Berkeley, California, EE.UU.). Un valor de p <0,05 fue considerado significativo.

Resultados
La dexametasona reduce IL-9 mRNA abundancia

En experimentos preliminares en tiempo real de RT-PCR reveló que OKT3 fue un muy eficaz estímulo de la IL-9 en PBMC de expresión, como en el informe anterior [2]. IL-9 mRNA fue inducida de 4 a 48 h después de la activación (Figura 1A], y 24 h fue elegido como un momento adecuado para la detección de mRNA en experimentos posteriores. El efecto de Dex sobre IL-9 mRNA abundancia en PBMC se examinó en 13 individuos sanos de tiempo real RT-PCR. PBMC se cultivaron con OKT3, con o sin 10 -6 M DEX. En todas las muestras tratadas con OKT3 sin DEX, IL-9 mRNA expresión es fácilmente detectado. Además de DEX a culturas estimulado por OKT3 fue seguida por una marcada reducción de la IL-9 mRNA abundancia. Todas las muestras tratadas con DEX ha Ct valores mucho más altos que los que Dex (Tabla 1]. El análisis estadístico reveló un efecto significativo de la DEX (p <0,01). Todos los productos de RT-PCR fueron sometidas a electroforesis en gel y los resultados fueron coherentes con los datos en tiempo real. En las muestras activadas con OKT3, una sola banda se detectó fuertes con aparente movilidad en consonancia con el tamaño predicho fragmento de 277 pb (Fig. 1B]. Después del tratamiento con OKT3 y DEX, una banda muy débil de la misma se detectó la movilidad, y no se detectaron bandas en la unactivated muestras. Con excepción de algunos muy bajo tamaño molecular material, no había pruebas de cualquier otra banda, aparte de la banda de 277 pb. El cDNA También se evaluaron las muestras para la limpieza de genes β-actina de tiempo real RT-PCR, DEX y no tiene efecto significativo. En activan las células, Ct valores de β-actina fueron 15,5 ± 2,7 (SD) para las muestras dadas DEX, en comparación con 16,5 ± 4,6 para no dar muestras de DEX. Las conclusiones con β-actina DEX indican que no causa una reducción generalizada de la expresión génica.

El cambio relativo en la IL-9 expresión ARNm producido por DEX se determinó mediante el cálculo de la diferencia de valores entre el Ct activado y activado + DEX muestras (Tabla 1]. Esta diferencia se corrige con la amplificación de la eficiencia de las muestras de cada uno de los PBMC de donantes. La amplificación de eficiencia se determinó por dilución de serie de cada una de las muestras activado y no tratados con DEX. El porcentaje de IL-9 en la transcripción DEX tratados en comparación con los controles de las muestras varió de 0,03% a 3,57% con una media de 0,67% y una mediana de 0,20%.

Concentración-respuesta de los estudios

La eficacia de DEX se evaluó mediante la comparación de la IL-9 de transcripción en las muestras no tratadas con DEX a las muestras tratadas con 10 -6 a 10 -11 M M DEX. La media de los valores de Ct duplicados de las muestras se determinó, y en cada uno de la media Ct valor de la muestra no tratada con DEX se dio una cifra de 100%. PCR se realizó en diluciones seriadas de las muestras no tratadas con DEX para corregir la amplificación de la eficiencia como se describe en los métodos. DEX inhibe IL-9 transcripción en PBMC activado con OKT3 en una forma dependiente de la concentración en cuatro diferentes individuos. El porcentaje medio para cada valor DEX concentración se traza en la figura 2. 10 -7 M DEX fue casi como inhibitoria de 10 -6 M DEX, y 10 -8 M DEX reducción de la IL-9 transcripción abundancia al 20% de los niveles de control. En concentraciones más bajas de DEX, transcripción hacia el aumento de los niveles de control. En 2 de 4 experimentos, las muestras tratadas con 10 -10 M DEX había un mayor nivel de la transcripción de muestras de control, contribuyendo a la media ligeramente mayor expresión de IL-9 en el nivel 10 -10 M DEX DEX en comparación con el no (Fig. 2 ). La concentración de DEX que inhibe el 50% de la IL-9 en la transcripción activado PBMC, la IC 50, que se calculó a 10 -8,4 M ó 4 nM.

DEX IL-9 inhibe la secreción de la proteína

Después de la activación con OKT3, la secreción de IL-9 es fácilmente detectado por ELISA sándwich. Sobrenadantes fueron cosechadas en distintos momentos después de la activación, e IL-9 se midió por triplicado. La cantidad de IL-9 a las 72 h de la cultura se define como 100%. IL-9 no se detectó a 0 h. A las 24 h, la IL-9 nivel fue de 16 ± 1% (media ± DE) y a las 48 h, fue de 85 ± 3%. Así, los niveles de IL-9 ha llegado a su máximo nivel en casi 48 h, y sobrenadantes se cosecharon en este momento en experimentos posteriores. PBMC de 11 donantes fueron tratados con o sin OKT3 y con o sin 10 -6 M DEX en todo el período de cultivo. En todas las muestras estimuladas con OKT3, existen altos niveles de la secreción de IL-9, en ausencia de DEX, y las concentraciones de IL-9 se encontraban en el rango de 207-2526 pg / mL. La secreción de IL-9 es muy reducido después del tratamiento con DEX (p <0,005). En las muestras tratadas DEX-, la secreción de sólo 2,8% ± 2,5% (SD), de los valores de control (Fig. 3]. En 8 de las 11 muestras tratados con OKT3 y DEX, la concentración de IL-9 estaba por debajo del límite inferior de detección del ensayo. En la mayoría de las culturas no tratados con OKT3, IL-9 no podía ser detectado. Se detectó en niveles muy bajos en 3 muestras en ausencia de DEX y en 1 muestra de la presencia de DEX.

En seis de las 11 muestras, la cultura sobrenadantes También se realizarán las pruebas de IFN-γ e IL-4. En activan las células tratadas con Dex, el IFN-γ e IL-4 concentraciones fueron siempre por encima del límite inferior de detección de los ensayos. DEX redujo significativamente las concentraciones de ambas citoquinas (p <0,05 en ambos casos). El efecto de DEX en la secreción de IFN-γ fue similar a la de la IL-9. Activan las células tratadas con DEX secretada 2,4 ± 2,1% como mucho IFN-γ como el control de las células activadas. Por el contrario, ha DEX sustancialmente menor efecto inhibitorio en la secreción de IL-4. Las células tratadas con DEX secretada 31,4 ± 14,1 (SD)% tanto IL-4 en comparación con el control de las células activadas.

Los linfocitos T CD4 + fueron purificados a partir del 7 de las personas, para determinar si Dex estaba actuando directamente sobre estas células. En las células no activadas con OKT3, IL-9 se detectó en niveles muy bajos en 4 muestras sin DEX y en 2 muestras en presencia de DEX. Activado células no tratadas con DEX secretan IL-9 en el rango 222-1939 pg / mL. Como en PBMC, DEX marcadamente inhibida la secreción de IL-9 en las células activadas (Fig. 4] (p <0,02). Las muestras tratadas con 10 -6 M DEX secretada sólo el 2,9% ± 2,5% (SD), la mayor cantidad de IL-9 como muestras de control. En activan las células tratadas con DEX, IL-9 estaba por debajo del límite de detección del ensayo en 3, de 7 de culturas en estos experimentos.

Discusión

El estudio demuestra que el DEX es un eficiente agente farmacéuticos para la inhibición de la producción de IL-9. En activado PBMC, DEX reducida la secreción de IL-9 a una media de 2,8% de los niveles de control, mientras que en el caso de ARNm, el valor correspondiente fue de 0,7%. La diferencia entre estos 2 valores porcentuales puedan haber surgido porque en la PCR en tiempo real de análisis, siempre es posible determinar un valor para la IL-9 en el mRNA DEX-muestras tratadas, mientras que en el ensayo de ELISA, las correspondientes muestras se suelen Indetectable. En este último muestras, el límite inferior de detección del ensayo fue utilizado para calcular los porcentajes, que pueden tener más de la estima-IL-9 concentración en el tratado con DEX muestras.

Para determinar si el efecto inhibidor fue específicas de las células T helper, experimentos También se llevaron a cabo con las células CD4 + purificados. Estas poblaciones que figuran al menos el 98% CD3 + células CD4 +, por lo que es muy probable que los efectos observados directamente la participación de las células T helper. Los datos indican que los linfocitos T CD4 + producen cantidades importantes de la IL-9, aunque la posibilidad de que otras células en PBMC también producen IL-9 no han sido excluidas. DEX reducido considerablemente la secreción de IL-9 en los linfocitos T CD4 +, y la mayoría de los datos son consistentes con un efecto directo de DEX en los linfocitos T CD4 +.

DEX se encontró que inhibe la síntesis de IL-9 en PBMC ARNm en una forma dependiente de la concentración. Marcado inhibición de la transcripción de IL-9 se observó con DEX concentraciones tan bajas como 10 -8 M, y DEX tenía un valor de la CI 50 nM 4. DEX concentración similares curvas de respuesta se han observado con la IL-2 [22] y la IL-5 [20] expresión en las células T, así como IL-4 e IL-5 en las células [29]. Expresión de ICAM-1 [30], así como la síntesis y liberación de prostaglandina en el tejido alveolar [31] También se han encontrado para tener respuestas similares a una gama de concentraciones de DEX. IC 50 valores de DEX se han obtenido para la expresión de ICAM-1 de <1 nM [30], la actividad de la COX 1-10 nM [31], IL-11 nM expresión de 1 [32] y la expresión de IL-5 en T Células de 1 nM [20]. En los mastocitos, la DEX IC 50 tuvo un valor de 1,6 nM de IL-5 expresión que indica que la sensibilidad de las células T y mastocitos a DEX es similar para citocinas Th2 [29]. Estos resultados, en su conjunto, sugieren que la inhibición de DEX similares pueden ser los involucrados en la regulación de la expresión de una variedad de diferentes genes en las células T y mastocitos.

Los glucocorticoides pueden mediar efectos en la transcripción de dos maneras. Después de translocación de la GC / GR al núcleo, el GR puede obligar directamente a los elementos de respuesta de glucocorticoides (GRE), secuencias en las regiones promotoras de genes diana. La expresión de muchos genes que se estimula de esta manera. Sin embargo, hay pruebas limitadas para GRE participan en la inhibición de la expresión génica. Alternativamente, GC GR actuar indirectamente por factores de transcripción vinculante a fin de evitar que la interacción con el ADN. Estudios previos han encontrado que los dos mecanismos están mediados por las distintas concentraciones de DEX. El efecto inhibidor de la colagenasa en el DEX expresión resultó ser mediado por la interacción entre el GC / GR y el factor de transcripción AP-1 [33]. A falta de GC, AP-1 se une a la promotora de la colagenasa para estimular la transcripción de genes, mientras que en la presencia de GC, vinculante entre GC / RG y AP-1 impide a este último de asociarse con el ADN, a fin de que se inhibe la transcripción . La mitad de la colagenasa represión máxima expresión se alcanzó con 1,5 nM DEX, mientras que de media máxima inducción de la expresión de genes a través de GRE vinculantes necesarios 10 nM o mayor [33]. Encontramos DEX a tener un CI 50 nM valor de 4, en consonancia con un efecto indirecto a través de interferencia con factor de transcripción (s).

Entre los posibles factores de transcripción NF-AT es un probable candidato. En el caso de la IL-5 promotor, observamos que el DEX inhibido vinculante a la NF-AT sitio, pero no a la GATA-3 sitio [34]. La IL-9 promotor vinculante contiene secuencias de NF-AT [35], y la transcripción de otras citoquinas incluyendo IL-2 [36] y la IL-4 [37] supone NF-AT. IL-4, IL-5 e IL-9 todos los Th2 residir en el grupo de genes humanos en el cromosoma 5 [38] plantean la posibilidad de que puedan tener mecanismos de regulación similares. Otros factores que pueden estar involucrados incluyen AP-1, NF-κ B, y CREB, que tienen sitios de unión de ADN de la IL-9 promotor [35] y que pueden ser inhibidos por los glucocorticoides [36, 39, 40].

Expresión de la IL-9 por las células T puede depender de los efectos de otras citoquinas producidas después de la activación [41]. Esto está en consonancia con el retraso en la inducción de IL-9 ARNm, en el que no pico hasta 24 h después de la activación (Figura 1A]. Por lo tanto, es posible que el efecto de DEX en la producción de IL-9 puede ser una consecuencia de su efecto inhibitorio sobre citoquinas producidas anterior después de la activación de células T. DEX inhibe la producción de las principales citoquinas Th1 IFN-γ a una medida similar a la IL-9 (Tabla 2]. En otros experimentos en PBMC, se observó que 10 -6 M DEX reducción de la secreción de IL-5 a 0,8% de las células de control de la PHA activado, y la de IL-13 a un 6,2% de los controles (n = 6 para IL-5 y IL-13) (M. & WA Irvine Sewell, observaciones no publicadas). Sin embargo, no todas son las citocinas Th2 marcadamente inhibida por DEX, IL-4, porque sólo se inhibe el 31% de los niveles de control (Tabla 2]. La relativa resistencia de IL-4 a los efectos inhibitorios de DEX puede explicar un inesperado efecto de la mejora de la DEX en el desarrollo de las células Th2 [42] Este hallazgo podría explicarse por más eficaz represión de DEX de IFN-γ que IL-4 , Dejando suficiente IL-4 a favor de la diferenciación de las células T en las células Th2.

Conclusión

IL-9 mRNA expresión y secreción de proteínas son muy marcadamente inhibida por DEX. Los resultados sugieren que los efectos beneficiosos de los glucocorticoides en el tratamiento de las enfermedades alérgicas puede, en parte, ser mediada por la inhibición de la producción de IL-9. Los glucocorticoides son un elemento fundamental en el tratamiento del asma alérgica y otras enfermedades alérgicas, pero su utilidad está limitada por los efectos secundarios. Los fármacos que inhiben las citoquinas efectoras, pero carecen de los efectos secundarios de los glucocorticoides, podría ser muy útil en el tratamiento de la alergia. Nuestros hallazgos sugieren que, cuando estos se evalúan nuevos fármacos, los efectos en la IL-9, debería tomarse en consideración.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

LEH realizó la RT-PCR experimentos. KPJ realizado experimentos de la ELISA. LEH y KPJ redactado el manuscrito. JvS preparado el anti-IL-9 anticuerpos y revisó el manuscrito. FC preparado el anti-IL-9 anticuerpos. Fue concebido el proyecto, bajo la supervisión y coordinación de su diseño, y revisó el manuscrito. Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

El trabajo fue apoyado por una beca del Hospital San Vicente de la Comisión de Investigación.