Malaria Journal, 2005; 4: 21-21 (más artículos en esta revista)

Plasmodium falciparum expresión de la proteína de membrana eritrocitaria 1 en seres humanos infectados experimentalmente

BioMed Central
Thomas Lavstsen (thomaslavstsen@vip.cybercity.dk) [1], Pamela Magistrado (pam@immi.ku.dk) [1], Cornelus C Hermsen (R. Hermsen @ ncmls.kun.nl) [3], Ali Salanti (Hecmp@biobase.dk) [1], Anja Jensen TR (atrj@cmp.dk) [1], Robert Sauerwein (R. Sauerwein @ mmb.umcn.nl) [3], Lars Hviid (lhcmp@rh.dk ) [2], Thor G Theander (theander@cmp.dk) [1], Trine Staalsoe (staalsoe@cmp.dk) [2]
[1] Centro de Parasitología Médica en el Instituto de Inmunología y Microbiología Médica de la Universidad de Copenhague, 24-2 Instituto Panum, Blegdamsvej 3, 2200 Copenhagen N, Dinamarca
[2] Centro de Parasitología Médica en el Departamento de Enfermedades Infecciosas, Hospital Universitario de Copenhague (Rigshospitalet), de Copenhague, Dinamarca
[3] Radboud University Nijmegen Medical Centre, Nijmegen, Países Bajos

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Parásitos que causan la malaria grave en pacientes no inmunes expresar una cerrada dentro de la variante de los antígenos de superficie (VSA), que están mejor reconocidos por los sueros inmunes que expresó durante VSA no graves de la enfermedad en los individuos semi-inmunes. Los más destacados son el VSA-var gen codificado Plasmodium falciparum eritrocitos proteína de membrana 1 (PfEMP1) familia, que se expresa en la superficie de eritrocitos infectados en el que medie unión a los receptores endoteliales. Así, el paludismo grave puede ser causada por parásitos expresando PfEMP1 variantes que ofrecen los parásitos óptima inmunológicamente ingenuo en el secuestro de personas y altos índices de multiplicación eficaz.

Métodos

La transcripción de genes var se analizaron mediante PCR en tiempo real y PfEMP1 expresión por Western-Blots, así como de plasma inmune reconocimiento de las culturas establecidas parásito de los voluntarios no inmunes poco después de la infección con el NF54 esporozoitos.

Resultados

En las culturas que representan a la primera generación de parásitos hepática después de la liberación, todos los genes var fueron transcritas, pero GroupA var genes se transcriben en los niveles más bajos. En las culturas establecidas de segunda o tercera generación de la sangre de los voluntarios etapa parásitos in vivo con altos índices de multiplicación del parásito, la transcripción de genes var patrón difiere notablemente de la transcripción patrón de las culturas que representan a la primera generación de parásitos. Esto indica que los parásitos específicos expresando genes var, principalmente pertenecientes al grupo A y B, se ha ampliado con más eficacia in vivo frente a los parásitos que expresan otros genes var. La expresión diferencial de PfEMP1 se confirmó a nivel de proteínas por análisis de inmunoblot. Además, escribiendo serológicas mostraron que el suero inmune reconoce más a menudo la segunda y tercera generación de parásitos primera generación parásitos.

Conclusión

En conclusión, los resultados presentados aquí apoyan la hipótesis de que los parásitos que causan la malaria grave expresar un subconjunto de PfEMP1, que otorga altas tasas de crecimiento del parásito en las personas con limitada inmunidad preexistente.

Antecedentes

Plasmodium falciparum codificada variante de los antígenos de superficie (VSA) se expresan en la superficie de eritrocitos infectados (IE) y la mediación obligatoria a una serie de receptores de las células del endotelio [1]. Adhesión endotelial contribuye a la particular virulencia de la P. Falciparum y muy probablemente ha evolucionado como un mecanismo para evitar la eliminación del parásito en el bazo [2 - 4]. Las personas que viven en zonas de transmisión de parásitos desarrollan inmunidad a la malaria grave temprano en la vida [5]. Parásitos que causan la malaria grave en los niños pequeños con limitada inmunidad preexistente tienden a expresar un pequeño, relativamente conservadas subconjunto de VSA (VSA SM), que es más a menudo y mejor reconocido por anticuerpos de la mayoría de los parásitos de los individuos expuestos a la más amplia y diversa VSA UM subconjunto expresadas por los parásitos que causan la malaria no complicada [6 - 8]. Así pues, parece que la expresión de VSA SM confiere una ventaja selectiva en individuos no inmunes, tal vez especialmente eficaz, al permitir el secuestro del endotelio y, por consiguiente, las tasas de crecimiento de alta eficacia. La mejor caracteriza VSA son los genes var codificada p. Falciparum eritrocitos proteína de membrana 1 (PfEMP1) familia [9 - 11]. Cada parásito haploides genoma contiene genes var 50-60, de los cuales los 59 genes var anotado en el secuenciado en su totalidad p. Falciparum clon 3D7 se puede dividir en tres grandes grupos, A, B y C, sobre la base de análisis de secuencias [12, 13]. La importancia funcional de esta agrupación cuenta con el apoyo de las diferencias en paralelo CD36 vinculante características de PfEMP1 CIDR1 α dominios. Así, GroupA CIDR1 α dominios no vinculan a CD36, mientras que α CIDR1 dominios Grupo y codificadas por los genes var GroupC hacer [14]. El repertorio 3D7 PfEMP1 puede representar la VSA UM-SM VSA espectro observado aislados en el campo, y los últimos hallazgos apuntan a GroupA como codificación VSA SM-PfEMP1 tipo de moléculas en pacientes aislados [13, 15 - 17]. Lamentablemente, poco se sabe acerca de la expresión de genes var in vivo, y los estudios se han visto frustrados por las dificultades en la detección y cuantificación de expresión en parásitos con repertorios desconocidos gen var. Esta dificultad ha sido superada por aprovechar el conocimiento de los genes var repertorio en 3D7 var y analizar la expresión de genes en los parásitos NF54 (de la línea parental 3D7) aislada de los individuos no inmunes experimentalmente infectadas por el mosquito desafío. Inmediatamente después de la liberación por parte del hígado, los parásitos parece transcribir todos los genes var, con GroupA genes que se transcriben los menos. Sin embargo, dentro de una o dos generaciones de parásitos este patrón cambió, en particular en los parásitos que exhiben las más rápidas tasas de crecimiento in vivo. En este caso, sólo unos pocos genes var transcripción dominado la población. Los datos indican que PfEMP1-determinado las diferencias en las tasas de crecimiento de la forma expresada PfEMP1 repertorio, y que algunas variantes de PfEMP1 confieren alta efectiva las tasas de multiplicación del parásito en las personas no inmunes.

Materiales y métodos
Parásitos de la malaria

Parásitos holandés fueron aisladas de voluntarios expuestos a los mosquitos infectados con P. Falciparum aislar NF54 [18] como parte de los estudios en curso experimental de p. Falciparum. El día 0, diez no inmunes voluntarios fueron sometidos a dos o cinco picaduras infecciosas. Cloroquina, el tratamiento se inició en los primeros días de la gota gruesa es positiva. Parásito culturas se establecieron a partir de 400 microlitros de células sanguíneas extraídas envasados en los días 8, 9, y 10 y parásitos fueron cultivados in vitro durante 27 o 33 días (Figura 1] para obtener suficiente material parásito de ADN, ARN y proteínas análisis. Los parásitos se cultivaron en 0 Rh + eritrocitos como se describe [19], con la adición de 2% no inmunes suero humano a la cultura de los medios de comunicación. A largo plazo in vitro 3D7 culturas expresando VSA UM-tipo o antígenos seleccionados in vitro para expresar VSA SM-tipo antígenos se utilizaron como controles [20].

DNA, RNA, cDNA y cuantitativos PCR en tiempo real

El desarrollo de la parasitemia fue supervisado por cuantitativos PCR en tiempo real, tal como se describe [21]. DNA, RNA y cDNA de la transcripción de genes var se prepararon análisis de las culturas parásito sincronizado, tal como se describe [17]. Cuantitativa en tiempo real PCR se realizó en un termociclador Rotorgene sistema (Corbett Research, Motlake, Australia). PCR en tiempo real optimizados y de genes primers específicos para cada uno de los de larga duración genes var y un pseudogen en el 3D7 isogénicas NF54 p. Falciparum genoma son las que se describen en [22], con la excepción de PFI1830c. Primers en tiempo real para este gen se adelante 5'ACAACAATTTCGCAAGCAAG 3 ', invertir 5'TTCCTCTGCCTCCTCTTCAT 3'. Las curvas de calibración para la estimación de los productos relacionados con el sesgo de fluorescentes y las eficiencias de amplificación se han generado para todos los pares de primers. Durante 15 primers juegos, las curvas de calibración se han generado tanto desde la dilución serie de ADN genómico y de fragmentos de genes clonados [17]. Como los dos enfoques idénticos llevaron a las curvas de calibración (no se muestra), las curvas de calibración para el resto de los genes se determina a partir de ADN genómico. Las curvas de nivel son lineales a través de una serie de siete registros de las concentraciones de ADN (R = 0,9779 a 0,9995), con amplificación de la eficiencia entre el 90 y 101%. Las curvas de calibración se utilizaron para primer sesgo correcciones en los cálculos de los niveles de transcripción absoluta. El límite de detección del sistema fue ≥ 20 copias. La limpieza genes seryl-tRNA sintetasa y fructosa-bisphosphate aldolasa han uniforme perfiles de transcripción a lo largo del ciclo de vida del parásito [22], y se utilizaron como controles endógenos. Var transcripción diferencias en la distribución entre las muestras se calcularon con el método ΔΔ CT utilizando el control endógeno de la normalización.

El análisis por inmunotransferencia y citometría de flujo

El análisis por inmunotransferencia se realizó a lo descrito previamente [17]. Flujo cytometryand plasma de la malaria-expuestos los niños y los adultos se utiliza para clasificar la VSA expresadas por los parásitos aislados en los días 8, 9 y 10 como anteriormente descrito [7, 20, 23]

Resultados
Experimental infecciones de parásitos y el establecimiento de líneas de la cultura

El éxito de las infecciones se establecieron en ocho de los 10 voluntarios. Parasitaemias pese a la baja, un total de 13 líneas de la cultura parásito de la sangre recogida en seis de los voluntarios en tres momentos se establecieron después de la infección (Figura 1A]. El parásito más altas tasas de crecimiento se observaron en los voluntarios 1 y 2 con pico parasitaemias de 13832 parásitos / ml y 4637 parásitos / ml, respectivamente, mientras que en el pico parasitaemias todos los demás voluntarios se encontraban por debajo de 1400 parásitos / ml. Como se reconoce similar de los anteriores ensayos de vacunación humana [21], parasitaemias fluctuó en una forma distinta, que refleja, probablemente, el hígado liberación, el secuestro de trophozoite / esquizontes y la liberación de las nuevas generaciones de merozoites de esquizontes. Los parásitos obtenidos en el día 8 fueron predominantemente de primera generación parásitos de la sangre, en el supuesto de que fueron liberados de parásitos en el hígado entre los días 6,33 y 7,33 [24] (Figura 1B]. Del mismo modo, day9 parásitos se supone que representan la segunda generación de parásitos, y los parásitos day10 una mezcla de la segunda y tercera generación parásitos.

Uniforme de transcripción de los genes var en la primera generación asexual los parásitos

El patrón de transcripción de genes var fue sorprendentemente coherente en todas las seis líneas de parásitos obtenidos en day8 de seis de los voluntarios (Figura 2]. Transcripción de todos los genes var puede ser detectado en etapas anillo culturas, y la mayoría fueron transcritas en los niveles más o menos similares. Curiosamente, nueve de los 10 más bajos transcribe genes var pertenecían a un subgrupo o B / A, que han sido previamente asociados con malaria grave [13]. De acuerdo con estudios anteriores [17] var todos los genes se transcriben en niveles notablemente inferiores en thetrophozoite / schizont etapas en comparación con anillo etapas parásitos (datos no presentados). El pseudo-gen PFE1640w (var1) se comportan de manera diferente y se expresó en niveles similares a fines de parásitos etapa, que comprende aproximadamente el 20% del número total de genes var transcripciones en trophozoite etapas parásitos (datos no presentados).

Marcados cambios en la transcripción de genes var patrones de la primera a la segunda y tercera generaciones de parásitos asexual

La transcripción de genes var patrones de los cinco aislamientos obtenidos en day9 y los dos obtenidos en day10 eran diferentes de los de la day8 aislados, en particular en los aislamientos obtenidos de los voluntarios 1 y 2 en los cuales el crecimiento de alta parásito se observó (Figura 1 y 3 ). Ring-parásitos de la etapa 1 de voluntarios mostró notablemente transcripcional grandes cambios durante cinco genes var. Cuatro (PF11_0008, PFD1235w, MAL6P1.1, MAL7P1.55) fueron transcritas en mucho mayor (20 veces) y un gen (PFA0015c) en niveles notablemente inferior (12 veces) en la comparación day10 aislar a la day8 aislar . La estimación del número de copias absolutas (no se muestra) reveló que PF11_0008, MAL6P1.1 y MAL7P1.55 fueron los tres más altos transcritas var genes en el day10 aislar, que comprende aproximadamente el 22%, 40% y 8% de todas las transcripciones var, respectivamente. Los citados cinco genes también puso de manifiesto la más pronunciados cambios en la transcripción de genes (10-20 veces) cuando trophozoite etapa de parásitos días 8 y 10 se compararon. El cambio más destacado entre los anillos de los parásitos de voluntarios etapa 2 fue el aumento de 15 veces la transcripción de PFD0020c, que fue el más alto (~ 8%) var gen transcrito en el día 9 aislar (Figura 3]. Sólo pequeños cambios en los patrones de transcripción de genes var entre los días 8 y 9 / 10 se observaron en los parásitos aislados de voluntarios de 4, 6 y 10.

En general, ninguno de los genes var constantemente alterado tuvo una transcripción proporción en todos los voluntarios. Sin embargo, la transcripción de siete genes (PFD0005w, PFD0020c, PFD1235w, MAL6P1.1, PF10_0406, PF11_0007 y PFL0005w) aumentó en más de un voluntario, mientras que la transcripción de los tres genes (PFA0015c, MAL6P1.4 y PFE1640w) disminuyó en más de un voluntario (Figura 3]. En general, el análisis de los anillos de etapa y trophozoite / schizont etapas parásitos arrojado resultados similares.

Los cambios previstos en PfEMP1 expresión entre la primera, segunda y tercera generación asexual los parásitos fueron confirmados por el oeste blot

Para investigar PfEMP1 traducción en los 13 aislamientos, occidental blot de las proteínas se realizaron extracciones de trophozoite / schizont etapa de las culturas de conejo y murino antisueros planteadas en contra de la serie de sesiones de terminal conservadas ácidas (ATS) y en contra de DBL5 δ PFD1235w, respectivamente (Figura 4] . El análisis de los parásitos de voluntarios de 1 puesto de manifiesto la expresión diferencial de day8 a day10 (Figura 4A]. Así, una banda de alto peso molecular de aproximadamente 400 kDa fue visto sólo en el día 10 cuando se utiliza la cultura ATS-de anticuerpos específicos (Figura 4A]. Esta banda tamaño corresponde a la espera de PFD1235w tamaño, el cual también presentó un gran aumento en la transcripción de day8 a day10 entre los parásitos de este donante, y su identidad fue confirmada mediante la PFD1235w DBL5 δ anticuerpo (Figura 4B]. PFD1235w No se detectaron en ninguna de las otras culturas, a pesar de una ligera aceleración de la transcripción se encontraron en varias de las culturas (no se muestra). Dos bandas de 350 kDa y 260 kDa fueron especialmente intensos en el day10 cultura de voluntariado 1 (Figura 4A]. Este hallazgo se correlaciona con el tamaño de espera y elevación de la transcripción de PF11_0008 (345 kDa), MAL6P1.1 y MAL7P1.55 (~ 258 kDa). Transitorios bandas en alrededor de 230 kDa y 310 kDa parece surgir en el día 9 y desaparecen en el día 10 en las culturas de los voluntarios 1. No obvia la identidad podrían ser asignados a estas proteínas. En las demás culturas, la expresión diferencial de PfEMP1 ATS detectado por el anticuerpo se encontró en 6 y 10 voluntarios. En ambos casos una banda de 310 kDa fue observada en day10 parásitos y 9, respectivamente. El mejor candidato para este gen es PFD0005c banda, que se prevé que han observado el tamaño y se encontró que era más alta en el transcrito estas culturas. Todo el día 8 culturas son muy similares y todos parecían expresar PfEMP1s predominantemente en torno a 260 kDa, que se corresponde con el tamaño de espera de la más alta transcriben los genes en estas culturas (figura 2].

Segunda y tercera generación expresar VSA parásitos que se reconoce con más frecuencia por plasma inmune primera generación de parásitos

El VSA fenotipo de los parásitos se pueden clasificar en relación con los demás y en el espectro entre VSA SM y VSA UM, en función de la proporción de individuos de un área endémica que poseen anticuerpos frente a la expresada VSA [7, 20]. Para establecer su fenotipo VSA, el reconocimiento serológico de la parásitos aislados NF54 fue probada usando un panel de plasma obtenido de los niños y adultos que viven en las zonas costeras Ghana (Figura 5]. Todo el día 8 de parásitos aislados, que representan la primera generación de la sangre-fase asexual los parásitos, expresó VSA que fueron reconocidos por IgG en muestras de plasma sólo una minoría de los niños y de alrededor de la mitad de los adultos (Figura 5]. Estos parásitos son también menos bien reconoció que el estándar 3D7 VSA UM línea, que se expresa predominantemente PfEMP1 codificadas por los genes var GroupC. Las siete líneas aisladas en los días 9 o 10 todos los VSA expresó que con mayor frecuencia se reconoce que la línea correspondiente day8 (P = 0,01, Wilcoxon firmado clasificado de la prueba). Esta tendencia es especialmente clara para la day9/10 voluntarios de las líneas 1, 2 y 10, que fueron reconocidos por todas las muestras de plasma de los adultos y de la mayoría de los niños, al igual que el reconocimiento de 3D7 seleccionados para la expresión de VSA SM De tipo IE antígenos de superficie (Figura 5]. Sin embargo, cuantitativamente los niveles séricos de reconocimiento de todos los aislados fue más bajo que el de la línea SM 3D7 (datos no presentados). 3D7 VSA SM La línea ha sido seleccionado para VSA SM expresión utilizando IgG semi-inmune de los niños y expresa predominantemente el producto de PFD1235w (VAR4) en la superficie de eritrocitos infectados. Curiosamente, los parásitos de los voluntarios 1, 2 y 10 tuvo un aumento de la transcripción de un gen var (PFD1235w; var4) (Figura 2] así como 3D7 en respuesta a la selección para VSA SM expresión [17].

Discusión

La inter-e intra-clonal variabilidad de los genes var han frustrado los intentos de investigar las funciones de los PfEMP1 codifican proteínas en la patogénesis y la protección. La estrategia más común ha sido el de cuantificar var transcripción por contar la frecuencia de las etiquetas de secuencia única, y ampliada en los cebadores degenerados orientación semi-DBL conservan bloques de dominios. Esto se ha utilizado para estudiar fenotípicamente distintas líneas de laboratorio [10, 25 - 29] y parásito cepas aisladas de pacientes con resultados clínicos definidos [16, 30 - 32] El único estudio previo de la transcripción de genes var infectados experimentalmente en los seres humanos también se aplica esta estrategia [33]. Sin embargo, se requiere la secuencia de un gran número de clones de significación estadística y es intrínsecamente susceptibles a la primer parcialidad. En conjunto, esto hace difícil la interpretación de los datos. Para superar estas dificultades, y sensible de genes específicos de las herramientas utilizadas para analizar en detalle la estructura y la dinámica de la expresión de genes var no inmunes en voluntarios infectados con un parásito conocido con un repertorio de genes var. La necesidad de expansión in vitro de parásitos de muestras de sangre con submicroscopic parasitaemias este enfoque hace susceptibles a dos tipos de sesgo. En primer lugar, las culturas se establecieron desde un número relativamente pequeño de los parásitos y los perfiles de transcripción de estos parásitos no representa el perfil de toda la población en vivo. Sin embargo, en la mayoría de las culturas fue el fundador de población entre 100 y 4000 parásitos, y sólo dos culturas, que no presentan patrones de transcripción sesgada (día 8 cultura de los voluntarios 1 y 4) se establecieron desde menos de 100 parásitos. En segundo lugar, P. Falciparum ha informado a cambiar la expresión de los genes var a tipos variables in vitro [34, 35]. Por lo tanto, la expresión de genes var, en las culturas en el momento de la transcripción de análisis puede no reflejar el perfil de expresión in vivo en el momento de recogida de sangre. La transcripción perfiles de las culturas aisladas en el día 8 son similares y diferentes a los perfiles de los parásitos aislados en los días 9 y 10. Esto, y el hecho de que el diferencial de genes var transcripción, traducción y reconocimiento serológico de PfEMP1 correlacionada con el crecimiento de parásitos, sin embargo, indica que el cambio in vitro no invalida el análisis.

N var gen dominante fue transcrito en el día 8 culturas. En lugar de ello, un grupo relativamente grande de genes var pertenecientes a los grupos B, C, y se expresaron en niveles casi similares y curiosamente, nueve de los 10 más bajos genes transcritos pertenecen al grupo A ó B / A. Estos datos implican que el patrón de expresión PfEMP1 al comienzo de la infección es amplia y anticipada. Además, el consecuente aumento en el reconocimiento por los sueros inmunes con el tiempo de infección y la aparente asociación entre altas tasas de crecimiento y de la expresión diferencial de algunos grupos AyB genes de la primera a la segunda y tercera generación implica que es el Estado el medio ambiente que modula PfEMP1 la expresión. Esta es una hipótesis plausible, debido a la gran e inmediata de las diferencias en la supervivencia de fitness que es probable que se imponga sobre la asexual los parásitos por la fisiología y la pre-existentes de la inmunidad del huésped. Si bien la mayoría - o todos - de la PfEMP1 variantes que pueden ser expresadas por un parásito se expongan al sistema inmunológico de acuerdo a este modelo, la mayoría de las variantes, es probable que se presente muy brevemente para inducir una importante respuesta inmune. Es crucial, a la supervivencia de fitness diferencias dependen de PfEMP1 variantes que se expresan y requieren un parásito respuesta mucho más rápida que la que puede lograrse el cambio a ventajosa genes var. Aunque las diferencias en las tasas de conmutación puede contribuir a la estructura de la expresión de genes var [35] y pueden ser responsables de las diferencias observadas en la transcripción en el día 8 (Figura 2], las diferencias en las tasas de supervivencia puede ser mucho más importante para orientar y ordenar PfEMP1 Expresión in vivo. En individuos no inmunes este proceso se espera que centren su atención en la expresión relativamente restringido y conservadas subconjunto de VSA (VSA SM) asociados a la enfermedad grave en pacientes con poca inmunidad preexistente [13, 17] Ha sido documentado que en 3D7 vitro de selección para la adquisición del fenotipo VSA SM se asocia con la expresión de un subconjunto de los genes var [[15]. Sorprendentemente, cuatro de los cinco marcados diferencialmente transcribe genes (PF11_0008, PFD1235w, MAL7P1.55 y PFA0015c) en el voluntario 1 culturas, se encontraban entre los pocos genes diferencialmente transcritas a la selección de los genes 3D7 SM el fenotipo, en la que hubo selección de expresión De PF11_0008, PFD1235w y MAL7P1.55 y contra la expresión de PFA0015.

En el estudio de Peters et al [33], el clon de frecuencia estrategia se utilizó para investigar var transcripción perfiles de los parásitos aislados de dos voluntarios en el día 12 y 13 después de la infección con 3D7 por ocho o nueve infecciosas picaduras de mosquito. Una transcripción, PF11_0007, pertenecientes a var el grupo B, compuesto por la mitad de los 39 y 41 secuencias de clonado de los dos voluntarios, respectivamente. En total 10 y nueve var etiquetas se encontraron y sólo uno pertenecía a var el grupo A. Los parásitos se prevé que ser 3 ª o 4 ª generación y el parasitaemias en los dos voluntarios fueron 212000 y 18000 parásitos / ml. Por lo tanto, estos perfiles son mejores en comparación con la del día 10 de aislar voluntarios 1 presentado en este estudio. Teniendo en cuenta las posibles ambigüedades en la interpretación de los resultados presentados por Peters et al, creemos que los dos conjuntos de datos podrían reflejar una dinámica similar en el huésped humano.

Conclusión

En conclusión, los datos - en combinación con resultados anteriores - sugieren que PfEMP1 expresión está determinada y ordenados principalmente por la fisiología y la inmunidad de acogida, y que esto puede producir infecciones en personas no inmunes a ser dominado por VSA SM-tipo variantes como las que se Codificada por el Grupo A y B genes var.

Abreviaturas

PfEMP1 Plasmodium falciparum proteína de membrana eritrocitaria 1

VSA UM variante de los antígenos de superficie relacionados con el paludismo no

VSA SM variante superficie antígenos asociados con malaria grave

Contribuciones de los autores

TL llevó a cabo el análisis de la transcripción, tomó parte en la toma de muestras y el cultivo de parásitos y preparó el manuscrito. PM realiza el oeste blot. CCH corrió la vacunación de los juicios humanos. TS gestionado la recogida de muestras, el cultivo de los parásitos, así como realizar y el análisis de citometría de flujo. TL, CCH, TGT y TS concebido el diseño del estudio. Todos los autores en la elaboración y aprobado el manuscrito final.

Agradecimientos

Damos las gracias a Liselotte Wolters para realizar QRT-PCR y Petra Schneider y el equipo de Clínica Centro de Estudios para la Malaria, el Centro Médico de la Universidad de Nijmegen, Países Bajos para la toma de muestras de parásitos de los voluntarios. Maiken Kirsten Pihl Christensen y se agradece por su excelente asistencia técnica. PlasmoDB http://www.plasmodb.org La base de datos ha sido un recurso valioso para este trabajo y la base de datos de desarrolladores e investigadores que han hecho de sus datos disponibles aquí se agradece. El estudio recibió el apoyo financiero de El danés Consejo de Investigación Médica (SSVF subvención no. 63.686), y la Comisión de las Comunidades Europeas (concesión no. QLK2-CT-2002-01197, EUROMALVAC). PM AS y cuentan con el apoyo de la Gates Malaria Partnership Ph.D. Becas.