Reproductive biology and endocrinology : RB&E, 2005; 3: 21-21 (más artículos en esta revista)

Efecto de la electro-acupuntura de ovario expresión de α (1) - y β (2) adrenorreceptores, y p75 neurotrophin receptores en ratas inducida por esteroides con ovarios poliquísticos

BioMed Central
Luigi Manni (l.manni @ in.rm.cnr.it) [1], Thomas Lundeberg (thomas.lundeberg @ lidingo.mail.telia.com) [3], Agneta Holmäng (Agneta.Holmang @ wlab.gu.se ) [1], Luigi Aloe (aloe@in.rm.cnr.it) [2], Elisabet Stener-Victorin (elisabet.stener-victorin @ wlab.gu.se) [1]
[1] Instituto Cardiovascular y Laboratorio Wallenberg, Academia Sahlgrenska, Universidad de Göteborg, SE-413 45 Göteborg, Suecia
[2] Instituto de Neurobiología y Medicina Molecular (CNR), Roma, Italia
[3] Medicina de Rehabilitación, Karolinska Hospital, SE-171 77 Estocolmo, Suecia
[4] Departamento de Obstetricia y Ginecología, Hospital Universitario Sahlgrenska, Sahlgrenska, SE-413 45 Göteborg, Suecia
[5] Instituto de Terapia Ocupacional y Terapia Física, Academia Sahlgrenska, Universidad de Göteborg, SE-405 30 Göteborg, Suecia

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Estradiol valerate (EV) inducida por ovarios poliquísticos (PCO) en ratas se asoció con un aumento en la salida de ovario simpático. De baja frecuencia (2 Hz) electro-acupuntura (EA) se ha demostrado que modulan simpático marcadores de ovario, así como el flujo de sangre como un reflejo de la respuesta ovárica a través de los nervios simpático, en ratas con EV-inducida PCO.

Métodos

En el presente estudio, aún más a prueba la hipótesis de que repetidos tratamientos de 2 Hz EA ováricos modulan salida simpático en ratas con PCO, inducida por una sola inyección im de EV, mediante la investigación de la expresión mRNA, la cantidad y distribución de las proteínas de un α1, Α1-b, d-α1, y β2 adrenorreceptores (DA), así como la baja afinidad neurotrophin receptor (p75NTR).

Resultados

Se encontró que la inyección EV resultados significativamente mayor en la expresión de mRNA de ovario α1 y b-d-AR α1 PCO ratas en comparación con las ratas control. El p75NTR y β2-DA expresión mRNA fueron sin cambios en la PCO ovario. EA baja frecuencia como resultado una menor expresión de ARNm β2-DA expresión en ratas PCO. El p75NTR ARNm no fue afectado en ambos PCO y control de las ratas. PCO ovarios muestran significativamente mayor cantidad de proteínas de α1 de a, b α1 y α1-d-DA, y de p75NTR, en comparación con el control de ratas, que se repitió todos los contrarrestado por la baja frecuencia de EA tratamientos, con excepción de los b-AR α1.

Conclusión

El presente estudio demuestra que EA se normaliza la mayoría de los cambios inducidos por EV-DA en el ovario. Además, EA ha podido impedir que el EV-inducido hasta la regulación de p75NTR, probablemente por la normalización de la simpática respuesta ovárica a NGF acción. Nuestros datos indican un posible papel de la EA en la regulación de la respuesta ovárica a los insumos y simpático representan un posible enfoque terapéutico complementario a la superación de simpatizantes relacionados con anovulación en mujeres con SOP.

Introducción

El síndrome de ovario poliquístico (SOP) es un heterogéneo endocrinas y metabólicas trastorno reconocido como la principal causa de infertilidad en las mujeres de la edad reproductiva [1]. El síndrome se asocia con disfunción ovulatoria, la obesidad abdominal, hiperandrogenismo, y la profunda resistencia a la insulina [1].

La etiología exacta de la enfermedad es desconocida, aunque las alteraciones detectadas en pacientes con SOP se ha atribuido a defectos de primaria en el hipotálamo-hipofisario-adrenal (HPA) del eje, el microambiente de ovario, la glándula suprarrenal, y la insulina / crecimiento similar a la insulina Factor (IGF)-I sistema de regulación metabólica [1]. Que el sistema nervioso simpático puede ser un factor primordial en el desarrollo y mantenimiento de SOP ha sido sugerida por varios investigadores [2 - 5].

La utilidad de los modelos murinos de ovarios poliquísticos (PCO) se ha discutido [6]. Aunque es imposible de reproducir humanos SOP en un modelo animal, por ejemplo, un modelo puede ofrecer importantes pistas. Los estudios sobre el ciclo normal de las ratas adultas encontraron que una única intramuscular (im) de inyección de estradiol valerate (EV) acyclicity causas y la formación de PCO [7]. El EV-rata inducida PCO modelo refleja algunos endocrinológicas y características morfológicas de la SOP, y se supone que la actividad en los nervios simpático ovario es más alto que en las ratas [8 - 10]. Esto se pone de manifiesto por un pronto aumento de los niveles de ovario de norepinefrina (NE), una mayor liberación de NE de las terminales nerviosas de ovario, un aumento de la actividad de la catecholamine limitante de la síntesis de enzimas tirosina hidroxilasa (TH), y la baja regulación de β 2 -- Adrenorreceptores (DA) en células intersticiales del caso-[8 - 10].

La expresión de otros tipos de técnicos en el ovario, es decir, la α 1-DA, ha sido evaluada por estudios funcionales. Α 1-técnicos son miembros de la proteína G-acoplada y receptores desempeñan papeles críticos en la regulación de una variedad de procesos fisiológicos [11]. Dentro de esta clasificación, hay tres subtipos: α 1 bis, 1 ter α, α y 1d [11]. La α 1 bis-AR subtipo ha informado de que están involucradas en el mantenimiento del tono vascular basal, la α-AR 1b subtipos de participar en la respuesta a los agonistas exógenos, y que la α-AR 1d subtipo predominante es un mediador de la vasoconstricción arterial . Los estudios in vitro han demostrado que la α-AR están involucrados en la regulación del flujo sanguíneo de ovario [12] y, muy probablemente, en la esteroidogénesis ovárica [13]. En un estudio reciente, se encontró que la expresión de todas las α 1-AR subtipos en los ovarios de ratas PCO difiere significativamente de la de los controles y el tiempo varía en diferentes puntos EV después de la inyección, lo que indica una posible participación de este técnicos en el desarrollo De EV-PCO inducida [14].

Se ha demostrado que el desarrollo de quistes foliculares en el ovario de esteroides inducida en ratas PCO está precedida por un aumento de la síntesis de factor de crecimiento del nervio ovárico (NGF) y baja afinidad neurotrophin receptor (p75 NTR) ARNm [10]. Por lo tanto, el bloqueo de las acciones de los intercambios intracomunitarios de ovario NGF restaura ciclicidad del estro, así como las características estructurales y funcionales de ovario en EV-PCO inducidos en ratas [10], lo que sugiere que la activación de hiper simpático de entrada en PCO está relacionado con un exceso de NGF .

Electro-acupuntura (AE) es un método no farmacológico conocido para iniciar una serie de reacciones en la columna vertebral a nivel central y en el cerebro [15, 16]. Recientemente hemos demostrado que la baja frecuencia repetidos tratamientos EA ordinario de ovulación inducida en más de un tercio de las mujeres afectadas por el SOP y normalizado endocrino y neuroendocrino parámetros sin ningún tipo de efectos secundarios negativos [17]. Estas observaciones sugieren que los efectos son mediados por EA a través de la inhibición de la actividad del sistema nervioso simpático desde EA se conoce autonómica para modular diferentes funciones [17]. Además, el uso de esteroides inducida PCO modelo, encontramos que repetidos tratamientos de baja frecuencia de EA en el segmento somáticas relacionadas con la inervación del ovario, la reducción de las altas concentraciones de ovario NGF, factor liberador de corticotrophin (FCI), y de la endotelina-1 Así como del aumento de concentraciones bajas de hipotalámico β-endorphin [18 - 21]. Por otra parte, EA de baja frecuencia de ovario aumenta el flujo de sangre como un reflejo de la respuesta ovárica a través de los nervios simpático, mientras que una frecuencia alta de ovario disminuye el flujo de sangre como una respuesta pasiva siguientes cambios en el sistema circulatorio normal y PCO ratas [22, 23]. Estos resultados sugieren que repetidos tratamientos de baja frecuencia, pero no de alta frecuencia de EA, puede inhibir la actividad de alta en el sistema nervioso autónomo. Sin embargo, el mecanismo implicado en este caso no se sabe claramente.

El presente estudio fue realizado para investigar el efecto de tratamientos repetidos de baja frecuencia EA sobre la inervación simpática de ovario en ratas inducida por esteroides con PCO. Para abordar esta cuestión, hemos realizado un estudio de la expresión del mRNA y de cantidad de proteína y la distribución de la simpatía marcadores α 1 bis -, α 1b -, α 1d -, y β 2-AR, y de p75 NTR.

Materiales y métodos
Animales

Treinta y dos adultos en bicicleta virgen de las ratas Wistar Kyoto (Möllegaard, Dinamarca) un peso de 205-230g fueron alojados cuatro a una jaula a temperatura controlada de 22 º C con una luz de 12 h :12-h oscuro ciclo de por lo menos 1 semana antes de Y durante todo el período experimental. Las ratas tuvieron libre acceso a pildoradas alimentos y agua del grifo. Dieciséis ratas, en las que los dos grupos de PCO se describe a continuación, cada uno se da una sola inyección im de 4 mg EV (Riedeldehaen, Alemania) en 0,2 ml de aceite, para inducir bien definidos PCO [7, 18]. Dieciséis ratas, en las que los dos grupos de aceite se describe a continuación, recibieron una única inyección im de 0,2 ml de aceite (arachidis con óleum, Apoteket AB, Umeå, Suecia). Treinta a treinta y tres días después de la inyección im de EV, es decir, 2 días después del último tratamiento de la EA, las ratas fue muerto por decapitación. Las inyecciones y la finalización de la prueba se hizo independiente del ciclo día [7, 18]. Los experimentos se llevaron a cabo de acuerdo con los principios y los procedimientos establecidos en el Instituto Nacional de Salud (NIH) Guía para el Cuidado y Uso de Animales de Laboratorio y fueron aprobadas por el comité de ética local animal en la Universidad de Göteborg, Göteborg, Suecia

Electro-acupuntura

Las ratas fueron divididas en cuatro grupos experimentales: i) un grupo de Petróleo (control, n = 8), ii) un grupo que recibió Petróleo EA (EA, n = 8), iii) un grupo PCO (PCO, n = 8), Y iv) un grupo que recibió EA PCO (PCO + EA, n = 8).

Todos los grupos se anaesthetized durante 25 minutos en 12 ocasiones, tal como se describe a continuación. La EA y el PCO PCO + EA + EA + EA PCO EA grupos recibieron cada dos días durante la anestesia. La EA y el PCO PCO + EA + EA + EA PCO grupos se realizó el primer tratamiento EA 2 días después de la inyección EV. Los puntos elegidos para la estimulación fueron bilaterales en el mm. Bíceps femoris y erector spinae, somáticas en los segmentos correspondientes a la inervación de los ovarios (Figura 1]. Las agujas (Hegu: Hegu AB, Landsbro, Suecia), se añadieron a una profundidad de 0.5-0.8 cm y luego bilateralmente adjunto a un estimulador eléctrico (CEFAR ACUS 4, Cefar, Lund, Suecia). Los puntos fueron estimuladas eléctricamente con una ráfaga de baja frecuencia de 2 Hz; cada pulso tuvo una duración de 180 μ segundos, una ráfaga longitud de 0,1 segundos, y una ráfaga de frecuencia de 80 Hz. La intensidad (1.5-2 mA) se ajustó hasta el local se observaron contracciones musculares para reflejar la activación de los músculos de los nervios afferents (A-delta y fibras, posiblemente, las fibras C). La ubicación y el tipo de estimulación son los mismos en todas las ratas.

Anaesthetization

Durante cada tratamiento, todas las ratas fueron anaesthetized superficialmente con un intraperitoneal (ip), la inyección de una mezcla de Ketamin (50 mg / kg; PARKE-DAVIS, Warner Lambert Nordic AB, Solna, Suecia) y Rompun (20 mg / kg; Bayer, Bayer AG, Leverkusen, Alemania). El día 30 después de la inyección im de EV, la rata fue decapitado, es decir, 1-2 días después del último tratamiento de la EA.

Tejidos

En la realización del experimento, los ovarios fueron disecados rápidamente en hielo seco. Un ovario fue dividida en dos piezas, pesada, y broche de congelados en nitrógeno líquido y se almacenan a -80 ° C hasta la extracción. El segundo ovario se fijó en el 4% tamponada formaldehído durante al menos 24 horas en la preparación de AR, y p75 NTR inmunohistoquímica.

Real-Time PCR para adrenorreceptores

Total de ARN se extrajo el ovario utilizando RNeasy Mini Kits (Qiagen, Hilden, Alemania). Primera línea de cDNA fue sintetizado a partir del 1 μ g de RNA total con TaqMan transcripción reversa reactivos (Applied Biosystems., Foster City, CA). Cada 100 μ l de RT-PCR figura 1 μ g del total, 1X TaqMan RT buffer, 5 mM MgCl2, 2,5 mM hexámeros al azar, 1 mM dNTPs, 0,4 U / ml RNasa inhibidor, y 1,25 U / ml Multiscribe RT (PE Applied Biosystems, Foster City, CA, EE.UU.). Transcripción reversa se llevó a cabo en un PTC-200 sistema de PCR (MJ Research., Boston, MA, EE.UU.) a 25 ° C durante 10 min, 48 º C por 30 min y 95 ° C durante 5 min.

La reacción en cadena de polimerasa (PCR), el análisis se realizó a través de ABI Prism 7700 Sequence sistema de detección (PE Applied Biosystems, Estocolmo, Suecia) y FAM-etiquetados sonda específica para α 1 bis-AR (Rn00567876m1), 1b α-AR (ADRA-A1B EX 152027A02), α 1d-AR (Rn00577931ml), y β 2-AR (Rn00560650s1) (PE Applied Biosystems). Diseñado primers y una sonda VIC-etiquetados para Glyceraldehyde-3-fosfato deshidrogenasa (GAPDH) (NM_031144) se incluyeron en las reacciones como patrón interno. CDNA se amplificó en las siguientes condiciones: 1 ciclo a 50 ° C durante 2 min y 95 ° C durante 10 min, seguido por 40 ciclos a 95 ° C durante 15 s y 60 ° C durante 1 min. La cantidad de mRNA de cada gen se calculó utilizando el método estándar de la curva (siguiendo las instrucciones del usuario en el Boletín No. 2, PE Applied Biosystems), y adaptado para la expresión de GAPDH.

Transcriptasa Reversa-PCR-ELISA para p75 NTR

La expresión de mRNA p75 NTR-se evaluó usando la transcriptasa inversa (RT)-PCR ensayo inmunoenzimático (ELISA) de protocolo, tal y como ha sido descrito previamente por Tirassa y compañeros de trabajo [24]. ARN total fue extraído de los ovarios mediante el método de Chomczynski y Sacchi [25], modificado en el TRIzol Kit (Invitrogen AB, Lidingö, Suecia). Complementarias de ADN fue sintetizado a partir del 1 μ g de RNA total usando 250 ng Oligo (dT) 12-18 cartilla y 200 unidades de M-MLV RT (Promega Italia, Milán, Italia), en 20 μ l de volumen total de reacción. GAPDH genes p75 y se co-amplificados en un solo tubo de reacción de PCR (35 ciclos de: 1 min a 95 ° C, 1 min a 55 ° C, 2 min a 72 ° C), utilizando 5'-biotina primers específicos para generar biotina Detectables por PCR productos etiquetados digoxygenin-sondas en un ensayo inmuno-enzimática. Primer / sonda secuencias son las siguientes: p75 NTR adelante con biotina: 5 'CGTGTT CTCCTGCCAGGACA 3'; p75 NTR inversa: 5 'GAGATGCCACTGTCGCTGTG 3'; p75 NTR digoxygenin-etiquetados sonda: 5 'ACAGCAGCCAAGATGGAGCAATAGACAGG 3'; GAPDH adelante con biotina: 5 'CACCACCATGGAGAAGGCC 3 '; GAPDH inversa: 5' GATGGATGCCTTGGCCAGG 3 '; GAPDH digoxygenin-etiquetados sonda: 5' ACAATCTTGAGTGAGTTGTCATATTTCTCG 3 '. El importe de los productos amplificados se midió a una densidad óptica (DO) de 450/690 nm (OD 450/690) usando un ELISA Dynatech Reader 5000. A nivel de GAPDH OD 450/690 se utilizó para normalizar las diferencias relativas en el tamaño de la muestra, las diferencias en la integridad de la persona ARN, y las variaciones en la eficiencia RT. Para obtener detalles metodológicos ver Tirassa et al. [24].

Inmunohistoquímica para adrenorreceptores y p75 NTR

Disponible en el comercio se utilizaron anticuerpos para detectar α 1 bis-AR1 bis-AR [C-19]: sc-1477, Santa Cruz, California, EE.UU.), 1b-AR α (α 1 ter-AR [C-18]: sc -1476, Santa Cruz, California, EE.UU.), α 1d-AR1d-AR [H-142]: sc-10721, Santa Cruz, California, EE.UU.), y β 2-AR2-AR [M -20]: Sc-1570, Santa Cruz, California, EE.UU.) por inmunohistoquímica. El anticuerpo monoclonal anti-p75 NTR (clon 192) [26] fue producida y purificada en nuestro laboratorio.

Serial, 15 - μ m de espesor cada una de las secciones de ovario fueron cortadas con un criostato y procesadas para inmunohistoquímica. En resumen, las secciones estaban bloqueadas con 10 minutos de incubación en el 3% de peróxido de hidrógeno y 10% de metanol en PBS que contenía 0,1% Tritón X-100 (PBST), seguido de una incubación de 30 minutos en el 10% disuelto en el suero normal PBST. A continuación, las secciones se incubaron durante la noche a 4 ° C con el anticuerpo primario diluido en PBST (conejo y de cabra anti-DA: 5 μ g / ml; monoclonales anti p75 NTR: 1 μ g / ml). Las secciones fueron incubadas con biotina IgG anti-conejo (α 1d - y β 2-AR), IgG anti-cabra (α 1 bis - y α 1b-AR) o IgG anti-ratón (p75 NTR) anticuerpos (todos ellos de Vector Lab. Inc, Burlingame, CA, y se utiliza de acuerdo con el fabricante en las instrucciones de dilución 1:300) diluido en PBST. Diaminobenzidine se utilizó para detectar la inmuno-complejos. Para evaluar la especificidad de la tinción, las secciones fueron incubadas con no específicos de conejo, la cabra o el ratón IgG (Zymed Lab Inc, San Francisco, Ca) y utilizados como controles. Immunostained secciones fueron evaluados bajo el microscopio Nikon Eclypse E600 equipado con la Nikon DMX 1200 cámara digital conectada a un ordenador PC. Secciones fueron codificados, y se contaron las células positivas en 10 secciones procedentes de 5 diferentes ovarios (es decir, 2 secciones por ovario) por grupo experimental. De células se llevó a cabo mediante el procesamiento de imágenes y el programa de análisis de Nikon-Lucía, y las mediciones fueron normalizados entre los grupos experimentales utilizando el mismo sistema de calibración y umbral (véase más adelante). El número de células inmunorreactivas (media ± SEM) se determinó en 20 × magnificación de imágenes sobre un área de 40000 imagen μ m 2. Cinco zonas no superpuestas fueron contados por sección. Dado que el analizador de imagen determina la densidad óptica de immunoreactions utilizando una escala de grises thresholding operación, las mediciones fueron normalizados entre los grupos con los siguientes criterios: 1) todas las mediciones se realizaron después de la calibración de la misma imagen de sistema de análisis, 2) thresholding se llevó a cabo a El mismo valor para cada imagen, 3) la escala de grises fue calibrado a un rango de 25-150 unidades arbitrarias. Objetos con mayores o menores niveles de gris no se consideraron. Un programa morfológicos, que selecciona sólo los órganos de la célula -, pero no los pequeños fragmentos o células que no se tiene una soma - también se utilizó para cuantificar immunopositive células.

Los análisis estadísticos

Todas las evaluaciones estadísticas se realizaron mediante el paquete Stat Ver para Macintosh (Abacus Concepts Inc, Berkeley, CA, EE.UU.). Immunopositive expresión mRNA y de células de α 1 - y β 2-DA, y p75 NTR en los ovarios, se evaluó el empleo de un sólo sentido en el análisis de la varianza (ANOVA), y los grupos se sometieron a pruebas de comparaciones múltiples con la corrección de Fisher PSD. Todos los resultados se presentan como media ± error estándar de la media (SEM). Un valor de p menor de 0,05 fue considerado significativo.

Resultados
Ovárica expresión y la distribución de α 1 bis-AR

La expresión del ARNm de α 1 bis-AR en el ovario no fue modificado en el PCO grupo en comparación con el grupo control. Repetida de baja frecuencia EA tratamientos no afectan a la expresión mRNA de α 1 bis-AR en la EA o la PCO PCO + EA + EA + EA PCO grupos (Figura 2A].

Significativamente mayor número de células de immunopositive α 1 bis-AR se encontró en el grupo PCO en comparación con el grupo control. EA tratamientos impedido el aumento de la α 1 bis-AR inmunoreactividad de proteínas, ya que el número de células en el immunostained PCO + EA grupo no fue diferente del grupo control. EA tratamientos no afectó el número de células immunopositive en los ovarios de las ratas control. El análisis inmunohistoquímico de serie en secciones mostró que α 1 bis-AR proteína (Figura 2C y 2D] se expresó sobre todo en torno a los vasos sanguíneos y de la granulosa regiones.

Ovárica expresión y la distribución de α-AR 1b

La expresión del ARNm de α-AR 1b en el ovario fue significativamente mayor en el PCO que en el grupo control y el grupo de EA. La expresión de mRNA α 1b-AR fue significativamente mayor en el PCO PCO + EA + EA + EA PCO grupo en comparación con los dos grupos de control, pero no al grupo PCO (Figura 3A].

Como se ilustra en la Figura 3B, significativamente mayor número de células de immunopositive α 1b-AR se encuentra en los ovarios y de PCO PCO PCO + EA + EA + EA PCO ratas en comparación con los controles. EA tratamientos no afectar a la cantidad o la distribución de α-AR 1b proteína en la EA y el PCO grupos. Como se muestra en la Figura 3C-D, α 1b-AR proteína se encuentra alrededor de los vasos sanguíneos y en la región granulosas de folículos maduros.

Ovárica expresión y la distribución de α 1d-AR

La expresión de mRNA α 1d-AR en el ovario fue significativamente mayor en el grupo PCO que en el grupo control. La expresión de mRNA α 1d-AR en el PCO PCO + EA + EA + EA PCO no era diferente de la que en el grupo PCO (Figura 4A].

Como se ilustra en la figura 4B, significativamente mayor número de células de immunopositive α 1d-AR se encontró en el grupo PCO en comparación con el grupo control. EA tratamiento redujo significativamente el número de células en el immunopositive PCO + EA grupo. El 1d α-AR immunopositive número de células no fue afectada en el grupo de EA en comparación con el grupo control. Como se muestra en la Figura 4C-D, la α 1d-AR se encuentra expresado en células de la granulosa de folículos sanos y el cuerpo lúteo, y alrededor de los vasos sanguíneos (no se muestra) en todos los grupos experimentales.

Ovárica expresión y la distribución de β 2-AR

La expresión de mRNA β 2-AR en el ovario de la PCO grupo no se ha modificado, en comparación con el grupo control. Β 2-AR mRNA fue significativamente menor tanto en el grupo de EA y en el PCO + EA grupo en comparación con el grupo control (Figura 5A].

No hay diferencia en el número de β 2-AR inmunorreactivas células se encuentran en los ovarios PCO (Figura 5B], mientras que EA tratamientos en ratas PCO (PCO + EA grupo) aumentar significativamente la cantidad de β 2-AR immunostained células en comparación con el grupo PCO. Β 2-AR immunopositive número de células en el control de los ovarios es la misma por EA tratamientos. Los β 2-AR se encontró expresada en degenerando cuerpo lúteo (Figura 5C] y folículos (Figura 5D] en todos los grupos experimentales.

Ovárica expresión y la distribución de p75 NTR

La expresión mRNA p75 NTR en el ovario (Figura 6A] permaneció sin cambios en la PCO grupo en comparación con el grupo control. EA baja frecuencia tratamientos no afectaron el ovario expresión mRNA p75 NTR en el PCO + EA grupo en comparación con el grupo PCO, y no difieren de los del grupo de control.

Como se muestra en la Figura 6B, el número de p75 NTR-células teñidas en el grupo PCO fue significativamente mayor que en los controles, mientras que EA repetidos tratamientos disminuyó significativamente la proteína p75 NTR inmunoreactividad en el PCO + EA grupo. El número de ovario p75 NTR immunopositive células fue significativamente inferior en el grupo de EA en comparación con los controles. Como se muestra en la Figura 6C-D, de ovario p75 NTR expresando células se distribuyeron principalmente alrededor de los folículos en las capas del caso, con algunas inmunoreactividad también propagación en el estroma ovárico (Figura 6D].

Discusión

El objetivo del presente estudio fue investigar si repetidos de baja frecuencia EA tratamientos modulan la expresión de mRNA y de la cantidad y distribución de las proteínas de α 1 -, y β 2-DA, y p75 NTR en ratas inducida por esteroides con PCO. Los resultados de este estudio demostraron que las inyecciones im EV resultado significativamente mayor en la expresión de mRNA de ovario α 1b - y α 1d-AR PCO ratas en comparación con las ratas control. EV-PCO inducida inducido una cantidad significativamente más alta de las células de immunostained α 1 bis -, α 1b - y α 1d proteínas, que fue impedida por las reiteradas baja frecuencia EA tratamientos, a excepción de α-AR 1b. La EA tratamiento indujo además un aumento de β 2-AR proteínas en la EV-ratas inyectadas.

Se ha sugerido que los simpatizantes de alta a la unidad de ovario podría ser importante en ambos EV-PCO inducidos en ratas y SOP en los seres humanos [4, 5, 9, 10, 27]. Los estudios clínicos muestran que las mujeres con SOP recuperar temporalmente la función ovárica normal bilaterales después de la resección en cuña de ovario o de perforación, que en parte denervates el ovario [28]. Estas observaciones sugieren que el ovario nervios podrían estar involucrados en el éxito de la resección en cuña bilaterales y ovárica. Actualidad tratamiento farmacológico utilizando citrato de clomifeno es el tratamiento de primera línea para la inducción de la ovulación en mujeres con SOP [29]. Esto es efectivo, pero los efectos secundarios como la super ovulación son bastante comunes [30]. Existe una clara necesidad de identificar nuevos enfoques terapéuticos - incluyendo estrategias no farmacológicas - para reducir o sustituir la intervención de drogas.

EA, que puede reducir la hiperactividad en el ovario fibras nerviosas periféricas simpático es coherente con la teoría de que EA podría modular sensorial, motora, autonómica y salida en el nivel segmental [16]. También se ha demostrado que la EA se activa los sistemas de control superior, lo que resulta en la liberación de una serie de neuropéptidos que son importantes en la modulación de central y autonómica segmentaria y salida de la Oficina eje [16, 31]. Recientemente hemos demostrado que repetidas de baja frecuencia induce EA ovulaciones regulares en más de un tercio de las mujeres con SOP y normaliza endocrino y neuroendocrino parámetros sin ningún tipo de efectos secundarios negativos [17]. Los efectos de baja frecuencia repetidas EA Luego se atribuye a una inhibición de la hiperactividad en el sistema nervioso simpático [16, 32]. En el presente estudio se indica además que EA es eficaz en la prevención de EV-inducida disregulación de ovario simpático marcadores.

El aumento de la salida periférica simpática en ratas inducida por esteroides con PCO se pone de manifiesto en el aumento de las emisiones de NO, la concentración de NO en el ovario, y un número reducido de β 2-AR en el compartimiento de ovario que reciben inervación catecolaminérgicos [8, 9]. El papel de la β 2-AR en la fisiología y fisiopatología de ovario se ha relacionado con la regulación de la esteroidogénesis ovárica [8]. Transection del nervio ovárico superior inducida por esteroides en el PCO reduce la respuesta de esteroides, plantea β 2-AR expresión a los niveles normales, y restaura los ciclos del estro y la ovulación [8]. Así las perturbaciones en la producción de esteroides - por lo menos en el actual modelo de ratas PCO - podría ser secundaria a la elevada adrenérgicos control de la esteroidogénesis ovárica mediada por β 2-AR. Curiosamente, repetidos tratamientos de baja frecuencia EA inducido un aumento de β 2-AR-EV proteína inyectada en ratas, y esto es de acuerdo con la hipótesis de que las EA-regula la actividad en el sistema nervioso simpático. Por otro lado, la expresión mRNA de β 2-AR fue disminuido en la EA y en el PCO + EA grupo en comparación con el grupo control. Una explicación plausible de la discrepancia entre el mRNA y los niveles de proteína podría ser a su vez más de un desequilibrio entre la β 2-AR ARNm y proteínas. Así, el menor nivel de ARNm, en comparación con los de la proteína, podría ser el reflejo de su utilización para la síntesis de proteínas, no equilibrada de la correspondiente sustitución ARNm. Este mecanismo también podría reflejar diferentes niveles de reglamentación para nuestros tratamientos, que podrían actuar en la producción de proteínas por separado, tanto en el gen de transcripción y la síntesis de proteínas. Son necesarios más estudios para aclarar este mecanismo (s).

La importancia funcional de los diferentes α 1-DA en el ovario de ratas PCO no ha sido claramente identificados. La función de estos tipos de técnicos tradicionalmente se ha caracterizado en la fisiología ovárica como principalmente relacionadas con la regulación de la circulación de la sangre de ovario. Curiosamente, α 1-agonista de la estimulación Recientemente se ha demostrado que modulan la liberación de progesterona en células granulosas cultivadas por la potenciación de péptido vasoactivo intestinal (VIP) y hipofisarias Adenylate Cyclase-Activar polipéptido (PACAP) [33]. En un estudio reciente, por primera vez, a nuestro conocimiento, hemos demostrado que la expresión de todas las α 1-AR subtipos tanto en el mRNA y los niveles de proteína están reguladas en una de las primeras (30 días) y en una tarde ( 60 día) EV etapa después de la inyección [14]. De este modo se puede inferir que α 1-DA participar no sólo en la regulación fisiológica de la progesterona del ovario de ratas normales [33], pero también, muy probablemente, en la sobre regulación de la liberación de progesterona se describe en el EV-inducida PCO ovario [8 ]. Además, la dysregulated α 1-DA puede estar relacionada a la alta actividad simpática en los ovarios de ratas PCO [8]. De hecho, encontramos que repetidos tratamientos de baja frecuencia EA impide a la disregulación de α-AR 1a y 1d α-AR en ratas la proteína inducida por esteroides con PCO que las pruebas de la eficacia de EA en la reducción de la simpática campaña para el ovario. La expresión de mRNA α 1d-AR fue normalizado por la baja frecuencia de EA, pero no la de α 1 bis - y α 1b-AR. Una vez más, la discrepancia entre la expresión del mRNA y los niveles de proteína podría ser a su vez más de un desequilibrio entre α 1 bis - y α-1b DA ARNm y proteínas, por lo tanto, el mRNA que se dedica a la traducción de proteínas no se sustituye por completo, mientras que este no es el 1d caso de la α-AR. Estos resultados indican que un mecanismo vinculado a la presencia y la función ovárica de los técnicos podrían ser activa en este contexto.

Los resultados están en línea con los resultados de un reciente estudio que demuestra que la baja frecuencia de EA aumentó el flujo sanguíneo y la disminución de la actividad simpática en el ovario [22, 23]. Estas observaciones llevaron a la hipótesis de que los efectos de la baja frecuencia de EA en el flujo sanguíneo de ovario fueron mediados por α 1-técnicos [22], y esto está en línea con otro estudio reciente de Uchida et al. [12], que sugiere que la regulación de la circulación de la sangre a través de ovario estimulación sensorial está mediado por la α 1-DA evidencia por el bloqueo de α 1-DA.

En el presente estudio, también demuestran que los tratamientos repetidos de baja frecuencia EA mantiene mRNA p75 NTR y cantidad de proteínas en los niveles basales de los animales en el PCO. Esto coincide con los resultados de nuestros estudios anteriores [18, 20]. Se sabe que la p75 NTR ayudas al desarrollo de poblaciones específicas de neuronas simpático [34], y que este receptor es responsable de la capacidad de respuesta de los adultos las neuronas simpático a meta-NGF derivados [35]. La evidencia de que la inyección EV en ratas adultas intraovarian aumenta la síntesis de ambos NGF y p75 NTR [10] sugiere un posible vínculo funcional entre el PCO y NGF / NGF receptor del sistema. Curiosamente, estos cambios estuvieron acompañados de la activación selectiva de las neuronas noradrenérgico a la proyección de ovario. La activación del sistema nervioso simpático después de la inyección EV se ha puesto de manifiesto por una mayor actividad de TH en los ovarios de ratas PCO [9] y por el aumento de TH mRNA expresión en la catecolaminérgicos células ganglionares de la celíaca selectivamente a la proyección de los ovarios [10]. Además, intraovarian bloqueo de NGF y p75 NTR generado una disminución en la síntesis de p75 NTR por células de ovario teca y restaurado ciclicidad estral y ovulatoria capacidad EV-inyectado en ratas [10]. Así, uno de los mecanismos posibles en el efecto de la baja frecuencia de EA en tono simpático podría ser disminuido p75 NTR simpática mediada por la acción de respuesta a NGF. EA que contrarrestaron las EV inducida por aumento de la expresión de ovarios y la cantidad de p75 NTR apoya esta hipótesis.

Curiosamente, una de las principales neurohormone FCI en el control del hipotálamo-hipofisario-adrenal (HPA) del eje, se ha demostrado que se aumente tanto en la eminencia media y en el ovario en ratas con PCO inducida por esteroides [19]. En el mismo estudio, de baja frecuencia repetidas EA restaurado el aumento de las concentraciones de FCI que indica que el FCI y periféricos eje HPA desempeña un papel crucial en la regulación de la función ovárica de esteroides inducida PCO [19]. Estos datos, junto con el actual, EA sugieren que podría actuar como un modulador de la central de control de la salida simpática en ratas inducida por esteroides con PCO. Son necesarios más estudios para aclarar este punto.

En conclusión, el presente estudio demuestra que EA impedido que la mayoría de los cambios inducidos por EV-DA en el ovario. Además, EA ha podido contrarrestar el EV-inducido hasta la regulación de p75 NTR, probablemente por la normalización de la simpática respuesta ovárica a NGF acción. Nuestros datos indican la eficacia de la EA en la regulación de la respuesta ovárica a los insumos y simpatizantes muestran a una posible aproximación terapéutica complementaria a la prevención y / o superación de simpatizantes relacionados con anovulación en mujeres con SOP.

Contribuciones de los autores

LM participado en el diseño del estudio, llevado a cabo parte de la preparación de animales, realizó RT-PCR y análisis inmunohistoquímico, realizó el análisis estadístico y redactó el manuscrito. TL, y AH LA participado en el diseño del estudio y por escrito, el manuscrito. ES-V participado en el diseño del estudio, llevado a cabo parte de la preparación de animales y redactó el manuscrito. Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

Este estudio fue apoyado por becas de Wilhelm y Martina Lundgrens del Fondo de Ciencia, la Fundación Hjalmar Svensson, La Sociedad Real de Arte y Ciencias en Gotemburgo, Magnus Bergwalls stiftelse, la Fundación Novo Nordisk, la Sociedad Médica de Gotemburgo, el Consejo de Investigación Médica (Proyecto n . 12206, 2004-6399 y -6827), y el sueco Heart Lung Foundation. La contribución de Luigi Luigi Manni Aloe y cuenta con el apoyo de Progetti Strategici FISR / Neurobiotecnologie y por la Fondazione CARISBO, Bologna, Italia.