Journal of Biology, 2005; 4(2): 9-9 (más artículos en esta revista)

Guanina-nucleótido de cambio fijo en los ribosomas factor de elongación G inicia la translocación de tRNAs

BioMed Central
Andrey V Zavialov [1], Vasili Hauryliuk V [1], Måns Ehrenberg (ehrenberg@xray.bmc.uu.se) [1]
[1-75124 Uppsala, Suecia

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Durante la traducción de mRNA en polipéptido, la elongación factor G (EF-G) cataliza la translocación del peptidil-tRNA del sitio A al sitio P del ribosoma. Según el «clásico» de modelo, EF-G en el GTP determinada forma promueve la translocación, mientras que la hidrólisis de la GTP obligado promueve el factor de disociación de la translocación después de los ribosomas. De acuerdo a un modelo más reciente, EF-G opera como un 'motor de proteínas y de las unidades de la translocación peptidil-tRNA GTP después de la hidrólisis. En tanto el clásico motor de proteínas y modelos, el PIB-a-GTP intercambio se supone que se producen espontáneamente en "libre" EF-G incluso en la ausencia de una guanina-factor de intercambio de nucleótidos (FMAM).

Resultados

Hemos hecho una serie de conclusiones que el reto ambos modelos. En primer lugar, libre EF-G en la célula es probable que sea en el PIB determinada forma. En segundo lugar, el ribosome actos como el FMAM para EF-G. En tercer lugar, después de guanina-intercambio de nucleótidos, EF-G en el GTP determinada forma mueve el tRNA 2-mRNA complejo a un estado intermedio translocación en la que el ARNm es, en parte, trasladadas. En cuarto lugar, el alojamiento posterior de la 2-mRNA tRNA complejo en el período posterior a la translocación estado requiere GTP hidrólisis.

Conclusión

Estos resultados, junto con los publicados anteriormente crio-microscopía electrónica de reconstrucciones de los ribosomas en diferentes estados funcionales, sugieren un nuevo mecanismo para la translocación de tRNAs sobre los ribosomas por EF-G. Nuestras observaciones sugieren que el ribosoma es una universal guanosina-factor de intercambio de nucleótidos EF-G como se indica anteriormente para la clase II-péptido-release factor 3.

Antecedentes

Durante la traducción de las proteínas, péptidos elongación en cada ciclo, una aminoacil-tRNA y llega a la liga a un sitio de los ribosomas. Entonces, la transferencia peptidil lleva a los ribosomas antes de la translocación (preT) estatal, con una peptidil-tRNA en el sitio A (Figura 1a, b]. Posterior translocación del complejo, compuesto de dos acusados tRNAs y el ARNm - el tRNA 2-mRNA complejo - a la situación posterior a la translocación (postT) (Figura 1c] completa el ciclo de elongación. En las bacterias, translocación de peptidil-tRNA del sitio A al sitio P del ribosoma es catalizada por el factor de elongación EF-G (Figura 1b, c]. Al igual que el ribosomal GTPasas RF3, EF-Tu y IF2, EF-G pertenece a la familia de las pequeñas GTPasas [1]. Conserva características de la GTP vinculante dominio de estas proteínas factores son responsables de su función como interruptores moleculares [2]. En la activa GTP determinada conformación, la GTPasas unen perfectamente a sus objetivos. Después de la hidrólisis GTP, que adoptan un inactivos determinada conformación del PIB, y rápidamente se desvinculen de sus objetivos [1]. Tal GTPasas exigen por lo general una guanina-factor de intercambio de nucleótidos (FMAM), que cataliza el intercambio de PIB a GTP, y una GTPasa de la activación de la proteína (BPA), que estimula la hidrólisis de GTP [2]. En el caso de G-EF, el papel de las BPA ha sido adscrito al ribosomal L7/L12 tallo [3]. No FMAM ha sido hasta el momento identificados para EF-G, sin embargo, y se ha postulado que el rápido y amplio intercambio de GTP a PIB se produce espontáneamente en la libre EF-G [3]. Por consiguiente, se ha supuesto que es EF-G-GTP en la forma obligada, ya que entra en el ribosoma, aunque esta estructura ha eludido la detección en solución [4], y sólo se ha observado en ribosomal complejos [5].

Según el «clásico» de modelo, la unión de la EF-G • GTP a la preT ribosome complejo (Figura 1b] promueve la translocación del peptidil-tRNA de la Aa la P sitio. A continuación, elimina la hidrólisis de GTP EF-G de la postT ribosome [4, 6]. Los recientes experimentos, lo que sugiere que la hidrólisis de GTP EF-G, y que precede a la translocación EF-G, junto con el PIB puede promover la rápida translocación, han llevado a la sugerencia de que en contraste EF-G es, de hecho, un "motor de proteínas" que impulsa translocación con la energía Liberado por hidrólisis GTP [7]. Anteriormente, demostramos que la postT ribosome complejo tiene baja afinidad por el EF-G • GTP [8], presumiblemente como resultado de la incapacidad de un peptidil-tRNA que ser alojados en un híbrido P / E tRNA sitio, en donde el sistema de evaluación común - Final del tRNA se encuentra en el sitio electrónico de la subunidad ribosómica grande, y el anticodon-final del tRNA se encuentra en el sitio P de la subunidad ribosómica pequeña. Esto impide la formación de la 'retorcido' ribosome conformación [5] con una alta afinidad por la forma de GTP EF-G. Estos resultados también indican que la translocación no puede ser llevada a cabo por EF-G y el PIB, en línea con la noción de que el EF-G, al igual que otras pequeñas GTPasas, tiene una activa e inactiva GTP-PIB determinada forma [1].

En este estudio, reto actual de las ideas sobre el mecanismo de translocación. El cambio de paradigma que proponemos la siguiente manera de acuerdo a nuestras observaciones que intracelulares EF-G es probable que sea en el PIB determinada forma, que el PIB de forma rápida el factor que puede entrar en el complejo preT ribosoma, y que los ribosomas preT actos como el FMAM para EF-G, similar a la manera en que la etapa posterior a la terminación ribosome actos como el FMAM para la péptido-RF3 factor de liberación [9, 10]. Nuestros resultados, en parte basado en el uso de un sitio específico de la división de ARNm por la toxina bacteriana RelE [11] para controlar la posición de la translocación mRNA en diversos pasos, muestran que el intercambio de PIB para la no cleavable GTP analógico GDPNP sobre EF-G vinculado a la compleja preT impulsa el ribosoma en un estado intermedio translocación (transT *), en el que el tRNA 2-mRNA complejo se ha movido en relación con la subunidad 30S. La eliminación de los EF-G • GDPNP de un ribosome transT * Además de por exceso de PIB hace que el ribosoma preT de nuevo a su estado, mientras que GTP además lo lleva al postT estado. A partir de estos datos y bioquímicos anteriores [8], en conjunción con la crio-microscopía electrónica (crio-EM) reconstrucciones de los complejos funcionales ribosomal [5], se hacen una reinterpretación mecanicista de los principales pasos de la translocación.

Resultados
El ribosoma es el que falta guanina-factor de intercambio de nucleótidos EF-G

Se ha informado de que EF-G de Escherichia coli se une a GTP con diez veces menor afinidad que la que se une con el PIB [12]. En el supuesto de que existe un exceso de diez veces el PIB de más de GTP en el citoplasma y rápido en el libre intercambio de nucleótidos EF-G, se sugirió que la limitación de la tasa de paso de guanina-intercambio de nucleótidos en el EF-G es el ciclo Disociación de EF-G • PIB de la postT ribosome [3].

Nuestros datos anteriores, que muestra el ribosome a ser una FMAM para RF3 [9], nos llevó a comprobar la re-unión de libre EF-G con el PIB o el GTP. La disociación constante (K D) para el EF-G • PIB complejo fue alrededor del 9 μ M (figura 2a], cerca de una estimación anterior de 4 μ M [12]. Los resultados de los experimentos en los que [3 H]-PIB en el complejo con EF-G fue perseguido sin etiqueta y con más purificada GTP [9] (véase más abajo y Figura 4 bis de depuración de datos), sin embargo, muestran una 60 veces más grande eficaz K D - El valor de la unión de la EF-G a GTP que al PIB (figura 2b]. Este factor de 60 proporciona un límite inferior para el valor correcto, porque purificada GTP soluciones contienen algunos fracción del PIB a partir de la hidrólisis de GTP. El GTP intracelular: el PIB se ha estimado en 7:1 de Salmonella enterica serovar Typhimurium [13], y es probablemente similar en E. Coli. Esto sugiere que una importante fracción de libre EF-G en E. Coli está ligada al PIB.

Si vinculante de EF-G de la pre-translocación (preT) ribosome el factor necesario para la obligación de GTP, esto reduciría significativamente la tasa de asociación de EF-G con los ribosomas. Este problema, sin embargo, sería eliminado si EF-G en el PIB determinada forma asociada rápidamente con los ribosomas y el PIB-a-GTP tuvo lugar el intercambio, en lugar de despegue, los ribosomas. Para poner a prueba estas dos últimas hipótesis, hemos preparado preT ribosomas con fMet-Ile-tRNA Ile y su correspondiente en el codón un sitio y un codón de parada UAA inmediatamente aguas abajo de la Ile codón. Translocación fue catalizada por EF-G en esa pequeña concentración que cada molécula EF-G ciclo tuvo que muchas veces para obtener una gran parte del tiempo trasladadas ribosomas. La concentración de GTP se fijó en 0,5 mM durante las incubaciones con diferentes concentraciones del PIB, y la concentración de ribosomas elegido es suficientemente baja que la tasa de translocación por ribosome se aproximó por la concentración de libre EF-G multiplicado por la eficacia de su asociación constante de velocidad ( K cat / K m) para ribosome vinculante (ver Materiales y métodos). Debido a la translocación codón de parada UAA en la ribosomal un sitio, en la medida de translocación fue convenientemente cuantificado como la fracción de fMet-Ile péptido que podría ser rápidamente liberados por RF2, RF2 cuando se añadió a una concentración superior a la de los ribosomas A diferentes tiempos de incubación (figura 2c].

Se obtuvo un 50% de inhibición de la tasa de EF-G reciclado a 0,25 mM PIB, en la que la concentración de la concentración de EF-G • PIB (K D = 9 μ M) debe haber sido por lo menos 30 veces mayor que la concentración de EF - G • GTP (K D> 0,6 mM). Si la entrada de EF-G de los ribosomas habían exigido la EF-G • GTP complejo, ello habría dado lugar a una de 30 veces, en lugar de la observó dos veces, la inhibición de la translocación a 0,25 mM PIB (ver Materiales y métodos) . Esto implica que la EF-G debe haber entrado en el complejo de los ribosomas con el PIB, y que el intercambio de PIB para GTP debe haber tenido lugar en, en lugar de despegue, los ribosomas. Los parámetros que determinan la forma en la k cat / K m valor de la entrada de EF-G de la preT ribosome complejo depende de diversos ratios del PIB a GTP se definen en Materiales y métodos para un esquema cinético.

El preT ribosome contiene una deacylated tRNA en el sitio de P (Figura 1b], que puede ser importante para el PIB-a-GTP intercambio de reacción. Esto es sugerido por los experimentos con guanina-nucleótido vinculante a EF-G en otro tipo de ribosomas complejo. Aquí, EF-G se incubaron con [3 H]-GDPNP y, o bien después de la terminación (postTerm) o desnudos ribosomas en diversas concentraciones de la etiqueta de PIB (Figura 2d]. El postTerm ribosome tiene un deacylated tRNA en el sitio P y un vacío Un sitio programado con un codón de parada (Figura 1d], mientras que el desnudo ribosome carece de ligandos. La fracción de [3 H]-GDPNP retenido en un filtro de nitrocelulosa, correspondiente a los ribosomas determinada EF-G • [3 H]-GDPNP, se redujo a un 50% a un 160 veces superior a la del PIB en postTerm caso, o A 13 veces el exceso de desnudos ribosomas. Esto implica que la EF-G, obligado a los diferentes tipos de ribosomas, había mucho mayor afinidad por GDPNP que para el PIB, y que la diferencia fue más pronunciada para postTerm que para desnuda ribosomas (Figura 2d, e]. En consecuencia, la presencia de un deacylated tRNA en el sitio P de los ribosomas condujo a preT más estable vinculante de EF-G • [3 H]-GDPNP a este complejo que a simple ribosoma. Un correspondiente estabilización de la EF-G • GTP complejo en preT ribosomas por el sitio P-tRNA se espera, y contribuiría a la eficacia de guanina-intercambio de nucleótidos (figura 2c].

Hasta el momento, no hemos abordado la cuestión de si la formación de un complejo entre el EF-G • PIB y la preT ribosomas conduce directamente al intercambio de guanosina, o si el intercambio de reacción es precedida por un cambio en la conformación de los ribosomas. Este problema se aborda en la siguiente sección.

EF-G • PIB impulsa el preT ribosome en un estado híbrido, que ha tRNA sitios

EF-G • GTP se une al mal antes de la terminación (preTerm) ribosome con una peptidil-tRNA en el sitio P y un vacío Un sitio programado con un codón de parada (Figura 1c], pero se une con gran afinidad por el ribosoma con postTerm Deacylated un tRNA en el sitio P [8] (Figura 1d]. En este último caso, crio-EM resultados muestran la postTerm ribosome ratcheted en un estado con el P-tRNA en el sitio híbrido P / E sitio [5]. Esto sugiere que la alta afinidad de unión de la EF-G • GTP al ribosome requiere la ratcheted estado híbrido con tRNA sitios; este estado no puede ser formada cuando hay peptidil-tRNA en el sitio P. Es probable que la conformación ratcheted ribosome aparece también en el proceso de traslado, lo que sugiere que EF-G • PIB puede mover el preT ribosome del estado relajado, con tres sitios de unión para los tRNAs [5], a la ratcheted estado, con E sitio no vinculante y sólo dos sitios de unión para los tRNA [14]. Esto facilitaría la rápida PIB-a-GTP intercambio sobre EF-G, y hemos comprobado una de las predicciones que se desprende de esta hipótesis, a saber, que la aparente afinidad de un deacylated tRNA para el sitio de la E preT ribosome se reducirá en Además de la EF-G • PIB. Esta predicción fue confirmada por un experimento que muestra que la afinidad del tRNA fMet para el sitio de la E preT ribosome fue sucesivamente reducidos por cantidades cada vez mayores de EF-G, en presencia del PIB (Cuadro 1, serie 1).

Con el fin de supervisar la translocación acontecimientos que seguir en el intercambio de guanina-EF-G en la preT ribosomas, hemos utilizado un sitio-específica de la división de las ARNm por la toxina bacteriana RelE, y esto se describe a continuación.

Translocación eventos supervisados por RelE división de la A-sitio codón

RelE recortes mRNA específicamente en el sitio ribosomal A [11], y hemos utilizado esta actividad para vigilar ribosome movimiento a lo largo de mRNA en la translocación pasos (Figura 1]. Un complejo de iniciación (Init; Figura 1a] con fMet-tRNA fMet P en el sitio fue constituido por ribosomas incubando en presencia de factores de iniciación IF1, IF2 y IF3, fMet-tRNA fMet, y 33 P-final-mRNA codificación de la etiqueta Dipeptide Met-Ile-stop (AGO AUU SAU). La exposición de este complejo a RelE único llevado a la división de la A-codón sitio a la Unión Africana * U (Figura 3a, carril 2). El complejo de inicio (Figura 1a], se convertirá en el complejo preT (Figura 1b] de la adición de la ternarias EF-Tu GTP • • Ile-tRNA Ile complejo. El resultado de la presencia fMet-Ile-en el tRNA Ile Un sitio bloqueado la entrada de la RelE a un sitio y la reducción de la tasa de hidrólisis de la AUU codón (Figura 3a, carril 3). Además de EF-G • GTP a la preT complejo catalizado rápida translocación de fMet-tRNA Ile Ile-de la Aa la P sitio, generando el complejo postT (Figura 1c], y se trasladó el codón de parada en el sitio A de la postT Complejos, en los que fue rápidamente cleaved por RelE (Figura 3a, línea 4).

Complete translocación requiere GTP y GTP hidrólisis

Con el fin de seguir estudiando la guanina-nucleótido dependencia de la translocación medidas, el complejo ribosomal preT fue separado de todos los demás componentes de la mezcla de traducción [8]. RelE división de la A-codón sitio se vigila después de la adición de G-EF a la purificado preT complejas en presencia de GTP, el PIB o el GTP no cleavable analógico GDPNP (Figura 3b]. En un tipo de experimento, el complejo preT se incubaron con EF-G y GTP o bien el PIB de 10, 25 o 40 minutos y luego los ribosomas están expuestos a RelE durante 5 min. En presencia de GTP, hubo una amplia división por RelE del codón de parada (Figura 3b, + GTP), lo que significa que una gran fracción de los ribosomas habían pasado de la preT a la postT estado.

En presencia del PIB, no hubo pruebas de RelE dependen de los productos básicos de la división en el codón de un sitio, incluso durante el más largo tiempo de incubación de 45 minutos (Figura 3b, + PIB), lo que significa que los ribosomas habían permanecido en su estado preT Durante todo el período de incubación. Esto implica que la EF-G y el PIB no están en condiciones de promover la translocación, en aparente contradicción a los anteriores resultados, que muestran una rápida translocación por EF-G y el PIB [7]. Hemos tomado nota de que la contaminación GTP, comercial común en los preparativos del PIB, puede tener profundos efectos en la GTPasas de la síntesis de proteínas. Un típico perfil de elución (Figura 4a], muestra esa PIB preparación para contener entre 1 y 2% GTP, y el efecto de este bajo nivel de contaminación se estudió en un experimento en el que la translocación de fMet-[14 C]-Ile-tRNA De la A al sitio P sitio fue determinada por la fracción del péptido que podría ser rápidamente liberados por RF2. La tasa de translocación es insignificante purificado con el PIB, con intermedios unpurified PIB o purificado con el PIB + 2% más rápido con el GTP y GTP (Figura 4b]. Del mismo modo, no con pura translocación PIB se detectó mediante la evaluación de la RelE dependiente de la división de las ARNm (Figura 4c]. Nuestros preparativos de nucleótidos fueron nuevamente purificada por cromatografía de intercambio iónico en una columna MonoQ [9], mientras que los de Rodnina et al. [7] no lo son. Esto indica que su PIB que dependen de la translocación 'fue, de hecho, debido a la contaminación de GTP. En tan gran exceso del PIB, la guanina-intercambio de reacción en la preT ribosome se espera que sea limitante de la tasa de paso de translocación, y esto conducirá a la lentitud, monofásicos translocación, exactamente como lo observó (ver Materiales y métodos) [ 7].

En presencia de GDPNP, alrededor del 11% de los codones de parada se cleaved después de la adición de RelE, independientemente del tiempo de exposición de los ribosomas a preT EF-G y GDPNP (Figura 3b, + GDPNP 2). En un experimento similar, que fue modificado a fin de que RelE estuvo presente desde el inicio de la incubación de los ribosomas con preT EF-G GDPNP y, la fracción de los codones de parada cleaved aumentado lentamente con el tiempo (Figura 3 B, GDPNP + 1). Esto significa que los EF-G GDPNP y de los ribosomas condujo a un estado que se mantuvo estable durante los 45 minutos de incubación en ausencia de RelE (Figura 3 B, GDPNP + 1). En este estado, el codón de parada fue parcialmente disponible para RelE mediada por una división en el sitio, por lo que muy lento el truncamiento de los ARNm (Figura 3b, + GDPNP 2). A priori, este ribosomal estado podría ser el estado de la postT Ribosome o una novela de transición estado ( 'transT *') en el proceso de translocación que, en ambos casos, RelE mediada por hidrólisis de la codón de parada en el sitio fue un inhibida por ribosomas determinada EF-G • GDPNP. Un experimento en el que las tasas de RelE división en el sitio A-codones de ribosomas en el nuevo estado supuestamente postT ribosomas y se compararon en la misma concentración de EF-G y GDPNP (Figura 3c] muestra que RelE cleaved el ARNm en el postT Complejo mucho más rápido que el ARNm en los ribosomas en el estado desconocido complejo, que demuestre que la ribosomal complejos no podría haber sido el mismo. Esto significa que el estado es desconocido transT *, y en la siguiente sección que caracterizan a estos complejos con respecto a la intercambiabilidad de tRNA.

Intercambiabilidad de tRNA fMet en preT, transT * postT y ribosomas

Nos caracteriza el estado transT * con respecto a la intercambiabilidad de sus deacylated tRNA fMet. En primer lugar, hemos utilizado nitrocelulosa filtración a la disociación de estudio [33 P]-tRNA fMet, originalmente en el sitio P de la preT complejo (Figura 1b], de los ribosomas incubadas con EF-G, junto con el PIB, o el GTP GDPNP. En un tipo de experimento, la fracción de los ribosomas determinada [33 P]-tRNA fMet fue monitorizada en función del tiempo en la presencia de una u otra etiqueta tRNA fMet o tRNA Phe fijo en las concentraciones (Figura 5a]. En otro tipo de experimento, la fracción de los ribosomas determinada [33 P]-tRNA fMet se vigila a la hora mientras que variando la concentración de tRNA fMet sin etiqueta o tRNA Phe (Figura 5b].

En el PIB experimento en el que no se produjeron translocación (Figura 3b, + PIB), no hubo pruebas de la eliminación de [33 P]-tRNA fMet del ribosoma durante 6 minutos en la presencia de cualquier etiqueta tRNA, como cabría esperar de ribosomas Con deacylated tRNA fMet estable vinculado a la P peptidil sitio después de la transferencia (Figura 5a, b]. En el caso GTP, en la que hubo una rápida translocación (Figura 3b, + GTP), es rápido de disociación [33 P]-tRNA fMet en presencia de cualquiera de tRNA fMet o tRNA Phe (Figura 5a]. La titulación experimento (Figura 5b] muestra que una fracción de [33 P]-tRNA fMet disociarse de la postT ribosomas en la ausencia de expulsar los tRNAs, y que la fracción restante se podría ajustarse a cabo con cualquiera de tRNA fMet o tRNA Phe. Estos resultados reflejan la comparativamente baja afinidad de [33 P]-tRNA fMet E para el sitio y la falta de especificidad para el codón E-sitio determinado tRNAs ([15], véase también a continuación).

En el caso de GDPNP, [33 P]-tRNA fMet disociarse lentamente en presencia de tRNA fMet, pero no hay disociación en la presencia de tRNA Phe, lo que sugiere una alta afinidad por [33 P]-tRNA fMet y mantenerse codón-especificidad Para deacylated tRNAs (Figura 5a]. En esta línea, la titulación experimento (Figura 5b] muestra que [33 P]-tRNA fMet podrían intercambiarse con tRNA fMet sin etiqueta, pero no con la etiqueta de tRNA Phe.

En un tercer tipo de experimento, [33 P]-tRNA fMet fue perseguido con la etiqueta de tRNA fMet de preT ribosomas incubados durante un período de tiempo en la presencia de EF-G en una constante concentración y GDPNP a diferentes concentraciones (Figura 5c] . La fracción de los que carecen de ribosomas [33 P]-tRNA fMet aumentó de 0 a 50% cuando se GDPNP varió de 0 a 40 μ M y el aumento de más de casi el 100% a 250 μ M PIB. Este resultado pone de manifiesto que la afinidad de la EF-G • GDPNP para la transT * ribosomas, que contenga una deacylated y una peptidil tRNA, fue de aproximadamente 100 veces más débil que la afinidad de la EF-G • GDPNP para la postTerm ribosomas, que contienen un solo deacylated tRNA (Véase más adelante) [8].

Otro experimento (Figura 5d], muestra que tRNA Phe no puede sustituir [33 P]-tRNA fMet en transT * ribosomas, ya sea con o ARNm intacto con mRNA que se había cleaved por RelE. Esto significa que el transT * ribosomas no pasar a la postT estado como resultado de la división del mRNA, ya que ello habría dado lugar a la debilidad, no selectivo E-sitio vinculante de la deacylated tRNAs (como se muestra en la Tabla 1 y Figura 7 ).

Además del PIB a transT * ribosomas trae de vuelta a la preT estado

Cuando el PIB se añadió a transT * ribosomas, en los que hemos observado RelE mediada por hidrólisis de la codón de parada a la AU * A (Figura 3b, + GDPNP 1, y Figura 6 bis, GDPNP +), el codón de división fue totalmente eliminado y reemplazado Por hidrólisis de la AUU codón (Figura 6 bis, GDPNP + + PIB). Esta última división es la reacción típica de la preT ribosomas y se produjo cuando la peptidil-tRNA disociarse de las de un sitio (Figura 3a]. Cuando, en contraste, el PIB se añadió a postT ribosomas que se incubaron en presencia de EF-G y GDPNP, los ribosomas postT permanecido en el estado y hubo una rápida división de la SAU codón (datos no presentados). Estos resultados sugieren fuertemente que además del PIB a la transT * ribosome traído de nuevo a la preT Estado, dar más pruebas de que el estado transT * es diferente de la postT estado de los ribosomas.

De acuerdo con los resultados previos [8], además de EF-G • GDPNP a preT ribosomas les dio un estado puromycin-reactiva (Figura 6b); puromycin simulando un aminoacil tRNA, y es un péptido naciente del ribosoma al actuar como un receptor Peptidil-en la transferencia. Cuando se incluyó también el PIB, sin embargo, el puromycin-reactividad de los ribosomas se perdió (Figura 6b], que muestra una vez más que el estado resultante no podía haber sido la postT ribosomas, que es totalmente reactiva a puromycin [9].

Un deacylated [33 P]-tRNA fMet en el transT * ribosoma podría fácilmente ser perseguidos con la etiqueta de tRNA fMet, pero su tipo de cambio en la preT ribosome fue casi nulo (Figura 5a, b]. Si además interpuso el PIB transT * ribosome a la preT estado, uno, por lo tanto, esperamos que el tipo de cambio del tRNA fMet a descender drásticamente. Esta predicción fue confirmada por los experimentos muy bien demostrando que además del PIB a transT * ribosomas, efectivamente, evitar que el intercambio de [33 P]-tRNA fMet con tRNA fMet (Figura 6d].

Cuando liberación factor RF2 fue agregado a transT * ribosomas, hubo liberación lenta de péptido (Figura 6c], lo que sugiere que existe disponibilidad parcial de la SAU en el codón de un sitio, una condición necesaria para la extinción, por clase-1 factores de liberación [ 8]. Además del PIB a transT * ribosomas les hizo no reactiva, no sólo para puromycin (Figura 6b], pero también a la liberación de péptidos por inducción RF2 (Figura 6c]. Estos resultados mRNA división (Figura 6a], junto con los de puromycin (Figura 6b], RF2 (Figura 6c] y tRNA de cambio (Figura 6d] muestran que la eliminación de los EF-G • GDPNP de la transT * ribosoma mediante la adición del PIB Interpuso el ribosoma a la preT estado con peptidil-tRNA en la A sitio. Esto confirma que el estado transT * no puede ser idéntica a la postT estado de los ribosomas, y corrobora que transT * es un estado de transición en el proceso de translocación, en la que la rápida hidrólisis de GTP nativos sobre EF-G normalmente ocurre. Cuando EF-G disociarse de la transT * ribosomas, el ARNm se deslizó rápidamente de nuevo a su preT posición, pero hubo un corto período de tiempo durante el cual RelE podría cleave y RF1 podría interactuar con el codón de parada expuestos en un EF-G-Un sitio libre .

Deacylated tRNAs obligar a la ribosomal E sitio con baja especificidad codón

Nos mostró que anteriormente [33 P]-tRNA fMet podría ser perseguido por tRNA fMet pero no por tRNA Phe en transT * (Figura 5d]. Esto contrasta con E-sitio de unión del tRNA deacylated, de la siguiente manera. Hemos diseñado experimentos para obtener constantes de disociación de la unión de la deacylated tRNA fMet o tRNA Phe al sitio de E postT ribosomas, programados con Met (AGO), Phe (UUU) o Thr (ACG) codones. La unión de [33 P]-tRNA fMet al sitio E fue ensayada por nitrocelulosa filtración, y un representante experimentar con la Thr (ACG) en el codón E sitio se muestra en la Figura 7. Constantes de disociación de la unión de tRNA Phe Thr o tRNA diferente a la programada E sitios de postT ribosomas se obtuvieron valores como I 50 experimentos en la competencia con una constante y casi saturar de concentración [33 P]-tRNA fMet y diversas concentraciones de tRNA sin etiqueta O tRNA Phe Thr (Figura 7b]. El resultado de los experimentos típicos, el sondeo de la unión de tRNA Phe a E sitios programados con Met, Phe Thr o codones, se muestra en la Figura 7b, y todos los datos están recogidos en la Tabla 1. Los resultados muestran que tRNA fMet y tRNA Phe obligado a postT ribosomas con afinidades similares y débiles codón especificidad. En experimentos similares, también encontró que la afinidad de tRNA fMet para el sitio E fue similar para postT ribosomas, postT ribosomas con RelE mediada por la división de un mRNA en el sitio, y preT ribosomas, todos con el mismo codón en el E Sitio (Tabla 1].

Discusión

En este trabajo, presentamos los resultados experimentales que redefinir las funciones de intercambio de nucleótidos de guanina y GTP hidrólisis en el factor de elongación EF-G durante la translocación de tRNAs en los ribosomas. Tomando ventaja de un sistema in vitro con componentes puros y de alta actividad, se caracterizaron los diferentes estados de los ribosomas durante tRNAs y translocación de ARNm como catalizadas por EF-G. Sobre la base de estos resultados experimentales se propone un nuevo mecanismo para la translocación, de un proceso que se conserva en todos los reinos de la vida.

El ribosoma es una FMAM para EF-G

Sobre la base de las mediciones de las afinidades del PIB y GTP gratis EF-G [12], se ha supuesto que EF-G en la forma determinada GTP se une a la pre-translocación (preT) ribosoma, y que el intercambio de PIB de GTP se produce después de la liberación de EF-G • PIB de los ribosomas [1, 3]. En este trabajo, sin embargo, encontramos la constante de disociación para el EF-G • PIB complejo (PIB K = 9 μ M) a ser más de 60 veces más pequeña que la constante de disociación para el EF-G • complejo GTP (GTP K> 0,6 mM) (Figura 2 bis, b]. Habida cuenta de que el GTP: PIB en la célula viva es sólo alrededor de 7:1 [13], una importante fracción de EF-G se espera que esté vinculado con el PIB en vivo (Figura 2 bis, b]. Se demostró además que EF-G en el complejo con el PIB puede rápidamente entrar en el preT ribosoma, y que el intercambio de nucleótidos guanina-EF-G en lugar de, en lugar de despegue, los ribosomas (Figura 2c y Materiales y métodos). Esto define la preT ribosomas como hasta ahora desconocidas para el FMAM EF-G.

El cristal de las estructuras de guanina-nucleótido libre de PIB-y obligado EF-G son prácticamente idénticos [16], y ha sido difícil de obtener la estructura cristalina de GTP determinada EF-G. En cuanto a las estructuras de solución, un estudio con un pequeño ángulo de dispersión de rayos X (SAXS) se realizó por Czworkowski y Moore [4] sobre EF-G de Thermus thermophilus. Encontraron la dispersión de los datos obtenidos de guanina-nucleótido-libre, el PIB fijo, fijo y GTP GDPCP-EF-G obligado a ser prácticamente idénticas y muy cerca de la curva de dispersión virtual calcula a partir de la estructura cristalina del PIB determinada T. Thermophilus EF-G. Se estima que la disociación de equilibrio constantes de la obligatoriedad del PIB, y el GTP no cleavable GTP analógico GDPCP como 0,92, 14,1 y 790 μ M, respectivamente. Lamentablemente, el GTP vinculante experimentos se realizaron sin más purificación de la solución GTP, en el sentido de que contiene una fracción desconocida del PIB. En consecuencia, puede haber sobreestimado significativamente la afinidad de la EF-G de GTP, que parece probable a la luz de nuestros nuevos resultados (Figura 2 bis, b]. Aunque su SAXS experimentos se realizaron en presencia de un sistema de regeneración de la energía, el PIB de bombeo de nuevo a GTP, la fracción del PIB fue significativo (2-5%) [4]. Se podía, pues, que la dispersión de los datos reflejados EF-G moléculas principalmente vinculado al PIB. Nuestros datos (Figura 2 bis, b] no excluye la posibilidad de que una pequeña fracción de EF-G en la célula está determinada GTP. Como se muestra en el archivo de datos adicional 1 con la versión en línea de este artículo, esto no significa necesariamente que la conformación de EF-G ha cambiado a su GTP determinada forma, en línea con la estrecha similitud de una muy reciente de una estructura cristalina EF-G mutantes en el complejo con GDPNP [17] o la estructura cristalina de EF-G vinculado al PIB [18, 19]. Además, el mecanismo que proponemos con ribosome dependientes de guanina-nucleótido de cambio hacen que todos los EF-G moléculas activas en ribosome vinculantes independientemente de su contenido guanina-nucleótidos, y previene de manera efectiva la actividad de GTPasa ralentí EF-G [8].

Guanina-nucleótido intercambio exige la 'retorcido' ribosome conformación

Cryo-EM estudios [5] han demostrado que la deacylated tRNA en el sitio P de la etapa posterior a la terminación (postTerm) ribosoma se desplaza a la híbrido P / E sitio cuando el ribosoma forma un complejo de alta afinidad con EF-G • GDPNP ( Figura 8d]. Durante este movimiento, la subunidad 30S rota (retorcido), en relación con la subunidad 50S. La afinidad de EF-G • GDPNP para después de la translocación (postT) ribosome con una peptidil-tRNA en el sitio de P (Figura 8a, k] es débil [8]. Un peptidil-tRNA, en contraste con un deacylated tRNA, no se puede adaptar a la categoría P / E híbrido sitio, y se llegó a la conclusión de que, por lo tanto, de alta afinidad vinculante del EF-G • GDPNP (o EF-G • GTP) a los ribosomas requiere Que el ribosoma es en la conformación retorcido [5, 8]. Esto sugiere que el intercambio de nucleótidos de guanina sobre EF-G, y el consiguiente conformacionales pasar de su PIB-a su GTP determinada forma durante la translocación debe tener lugar cuando el ribosoma es retorcido en la conformación con híbridos para sus sitios tRNAs. Si es así, esto sería análogo al mecanismo por el cual la clase-1 factores de liberación son reciclados por RF3. En ese caso, se comprobó que el FMAM para RF3 es la postTerm ribosomas (Figura 8b], con una deacylated P tRNA en el sitio y una clase-I-péptido factor de liberación en el sitio A [9, 10]. Antes de examinar las pruebas experimentales de apoyo a esta hipótesis, vamos a hablar de lo que parece ser evidencia experimental en conflicto con respecto a la conformación de la preT ribosomas.

Moazed y Noller [14] encontró que, después de la formación de péptidos de los bonos, una peptidil-tRNA originalmente vinculado Un sitio en el que se mueve el híbrido A / P sitio (Figura 8i]. Se sugirió además que el 30S ribosome debe rotar relativo a la subunidad 50S para preservar la estructura del tRNA [20]. Al mismo tiempo, la reconstrucción de la ribosomal preT complejas utilizando crio-EM muestra un estado relajado de los ribosomas con tres tRNAs en el 'clásico' A, E y P sitios [5]; (Figura 8e]. Esta aparente contradicción entre dos conjuntos diferentes de los resultados experimentales puede, le sugerimos que, se explica por las diferentes condiciones experimentales. El retorcido preT estado [14] se observó en la ausencia de libre deacylated tRNAs (D. Moazed, comunicación personal), mientras que el estado relajado preT se vio en su presencia [5, 8]. Porque llenado de la E sitio es incompatible con el estado retorcido (Figura 8i], la presencia de deacylated tRNA en exceso puede conducir el ribosoma de su retorcida [14] a su relajado [5] preT estado (Figura 8e].

En el presente trabajo, nos demuestran que deacylated tRNA se une a la del sitio de E preT así como postT ribosomas con el codón-anticodon baja especificidad, y con afinidades favorecido por la baja temperatura (Figuras 5 bis, 7 bis y ter, b, e]. Estos datos pueden explicar la presencia de E-tRNA sitio fijo en la crio-EM reconstrucciones de la preT relajada (Figura 8e; [5]] y postTerm (Figura 8b; [21]] ribosomas. Los recientes resultados [22] indican que los tRNAs de la preT ribosome fluctúan entre «clásico» de AP (Figura 8e] y un híbrido / PP / E (Figura 8i] sitios en un equilibrio que puede depender de la disponibilidad del sitio de E, y Por lo tanto, sobre la concentración de libre deacylated tRNA.

Ahora hemos descubierto que además de EF-G • PIB a preT ribosomas reduce la afinidad de deacylated tRNAs al sitio E (Tabla 1]. Esto apoya la hipótesis de que la EF-G • PIB puede conducir un preT ribosomas de su relajada [5] para su conformación retorcido [5, 20] (Figura 8e, f], ya que esto reduciría la aparente afinidad de deacylated tRNAs de la E Sitio. De ahí que se proponga que cuando EF-G • PIB encuentra un relajado preT ribosomas, que induce una retorcida ribosome conformación en la que el intercambio de PIB a GTP sobre EF-G tiene lugar.

EF-G en el GTP determinada forma impulsa el ribosoma en un estado de transición

Cuando el PIB se cambia por GDPNP sobre EF-G en el preT ribosomas, EF-G cambia de conformación y el ribosoma se mueve de la preT estado a la transición estado transT * (Figura 8j]. TransT * La estructura no se ha observado directamente, pero algunas de sus características se puede adivinar a partir de la crio-EM reconstrucción de la compleja entre EF-G • GDPNP y la postTerm ribosomas (Figura 8d, [5]]. En este caso, de dominio IV, que se encuentra en la punta del G-EF y la imitación de la final del anticodon del tRNA [23], se coloca en el sitio A de la subunidad 30S. La forma de EF-G • GDPNP recuerda a los anteriores observaciones de la EF-Tu PIB • • aminoacil-tRNA ternarias complejo, estancado en el A / T postT sitio de los ribosomas con el antibiótico kirromycin [24]. En el A / T sitio, el anticodon final de la aminoacil-tRNA se une a la A sitio de la subunidad ribosómica pequeña, mientras que su final ECP está obligado a EF-Tu. Proponemos que, a fin de adoptar una conformación similar a la preT ribosomas, EF-G deben desplazar a la peptidil-tRNA del sitio A de la subunidad 30S (Figura 8g]. The transT* state is formed, we suggest, by translocation of the tRNA 2 -mRNA complex in relation to the 30S subunit. Esto permitiría ribosomal RNA ribosomal y hélice h44 proteína S12 de interactuar con dominio IV del EF-G [5], lo que podría impedir el deslizamiento de los tRNAs de vuelta a sus posiciones preT. El papel fundamental que proponemos para el dominio de la IV EF-G cuenta con el apoyo de observaciones anteriores de que el truncamiento, o mutaciones en un único punto, IV inhibir la translocación de dominio [25]. Además, el hallazgo de que la afinidad de la EF-G • GDPNP a la transT * ribosomas (Figuras 5c, 8j] es mucho más bajo que para la postTerm ribosome [8], se explica por la propuesta de la competencia por la unión a un sitio entre el dominio IV del EF-G • GDPNP y de la parte del anticodon del tRNA peptidil-en el primer caso (Figura 8j], pero no en este último caso (Figura 8d].

Hemos demostrado anteriormente que peptidil-tRNA, situado en el sitio A de la preT ribosoma, se convierte en puromycin-reactiva en el ribosomal transT * estado, pero que la tasa de esta reacción es mucho más lenta que para peptidil-tRNA en el estado postT ( Figura 6b; [8]]. La clase-1 factor de liberación RF1 o RF2, que normalmente se une al codón de parada de la preTerm estado, que aparece aquí en una conformación idéntica a la postT estado (figura 8k], también lento péptido induce la liberación de la peptidil-tRNA en el transT * Ribosomas (Figura 6c]. Esto significa que el codón de parada, que en el ribosoma es preT abajo de ésta y adyacente a la A-sitio codón (Figura 8e], debe ser de al menos intermitentemente presente en el sitio una de las transT * ribosomas (Figura 8j]. Al mismo tiempo, la disociación del péptido de la transT * ribosomas, en presencia de RF2 es considerablemente más lento de lo peptidil transferencia a puromycin (Figura 6b, c], y mucho más lento que RF2-dependiente de la liberación de péptidos postT (figura 8k] O preTerm (Figura 8 bis] ribosome [9, 10]. Estos resultados sugieren que la EF-G • GDPNP bloquea el acceso de la liberación factor a la de un sitio (Figura 3c]. Es sólo cuando EF-G • GDPNP desvincula de los ribosomas que RF2 puede obligar a un sitio y el péptido induce la liberación (Figura 6c; [8]].

Una prueba más de que el ARNm se mueve un codón en relación con la subunidad 30S del ribosoma cuando cambia de preT a transT * estado proviene de experimentos con RelE. Estas revelan un corte en el codón de parada de transT * ribosomas, lo que implica que debe haber movido al menos intermitentemente en el sitio A (Figuras 3b, 6a]. El ARNm división es lento, lo que sugiere que EF-G • GDPNP debe disociarse antes de RelE pueden entrar en el ribosoma y cortar el ARNm (Figura 8j]. Después de la división de las RelE ARNm, el ribosoma permanece en el estado transT * (Figura 5d].

También hemos demostrado aquí que la deacylated tRNA, que en un principio estaba en el sitio de P (Figura 8e], sigue en contacto con el ARNm transT * en el estado y, por tanto, sólo se pueden cambiar con un deacylated tRNA del mismo tipo (Figura 5 bis , B). Esto indica además que los tRNAs * transT en el estado no han sido completamente postT alojados en el estado en que un deacylated tRNA vinculado a la falta de sitio E codón especificidad (Figura 7 bis, ter y Tabla 1].

Ribosome movimiento estado de la transición a la etapa posterior a la terminación de estado

Para entender cómo se mueve el ribosoma de la transT * a la postT estado, uno debe entender el papel de la hidrólisis de GTP en el proceso de translocación.

Un hallazgo sorprendente del trabajo descrito en este caso es que la eliminación de EF-G • GDPNP de los ribosomas por transT * Además del exceso de PIB no conduce a la translocación completa, tal como se desprenden de la «clásico» de modelo [4, 6], pero En vez trae el ribosoma a la preT estado (Figura 6]. Esto significa que, después de la disociación de EF-G • GDPNP, la estructura es transT * espontáneamente devuelta al preT, en lugar de la postT, la estructura de los ribosomas (Figura 8e, i, j]. La fuerza motriz de este movimiento es proporcionado por la afinidad del anticodon final de la peptidil-tRNA para la decodificación centro de la 16S rRNA, lo que falta en la transT * y preT presentes en el estado. Con posterioridad volver a la transT * estado por la acción de EF-G es impedido por la presencia del PIB (Figura 8i, j]. Cuando, en cambio, el GTP se agrega a una transT * ribosomas que se estabiliza por EF-G • GDPNP, translocación se completa (Figura 8g, h, j].

Sorprendentemente, hay otro camino para completar la translocación. Es decir, RF2 cuando se añade a un ribosoma en el estado con transT * EF-G • GDPNP SAU, que cuenta con un codón de parada en el sitio de una de sus postT estado, el ribosome eventualmente termina en el estado postTerm con RF2 en la A Sitio y deacylated tRNA en el sitio de P (figura 8k]. Esto significa que la fuerza impulsora, generados por la gran afinidad de RF2 de la relajada postTerm ribosome [10], es suficiente para superar la fuerza de contrarrestar proporcionada por la afinidad del anticodon final de la peptidil-tRNA para la decodificación en el centro preT Ribosome. Cuando GTP es hidrolizado en EF-G en el transT * ribosomas (Figura 8g, h, k], el factor de elongación debe adoptar una conformación que puede hacer el mismo truco como RF2.

Esta conformación de EF-G en la figura 8h no puede ser la estructura de EF-G • GDPNP [5], dado que este último tiene muy baja afinidad por los ribosomas postT [8]. En lugar de ello, sugieren que la hidrólisis de GTP EF-G trae EF-G • GDPNP de su GTP determinada forma, con una alta afinidad por la retorcida transT * ribosomas y baja afinidad para el relajado postT ribosome [8], a una EF-G • • PIB P i forma que tiene gran afinidad por el ribosoma postT relajado. Durante este cambio conformacional, la subunidad 30S es tirado por dominio IV del EF-G relajado en la conformación de acoplamiento con el tRNA 2-mRNA complejo en el estado postT (figura 8k]. En este paso, la deacylated tRNA en el híbrido P / E sitio de la transT * ribosome pierde contacto con el ARNm y se mueve en la E / S sitio (Figuras 5 bis, ter y 7; [15]]. Es posible que el PIB • P i forma de EF-G es similar a la EF-G • PIB se encuentra en el formulario de postT ribosomas, en presencia de ácido fusídico [5]. Cuando se libera fosfato inorgánico de EF-G, en ausencia de ácido fusídico, EF-G adopta la libre PIB determinada conformación con baja afinidad a la postT estado, y rápidamente se disocia de los ribosomas. Cuando, por el contrario, está presente el ácido fusídico, EF-G permanece en el EF-G • • PIB P i forma, estable vinculado a la postT ribosomas.

La comparación con los modelos anteriores

Nuestra propuesta de que los EF-G en el GTP forma impulsa el ribosoma en un estado de transición (transT *), con propiedades distintas de las de la preT y postT ribosomas, contrasta con el 'motor' mecanismo propuesto por Rodnina et al [7]. , En la que la acción de la EF-G viene después de la hidrólisis GTP. También hemos identificado el GTP determinada conformación de EF-G en el estado de transición con el crio-EM reconstrucción de EF-G • GDPNP sobre la postTerm ribosome [5].

Nuestra propuesta se diferencia más lejos de la clásica modelo [4, 6], así como del modelo propuesto por Rodnina et al. [7] en el que el movimiento de los ribosomas a la postT estado requiere tanto GTP y GTP hidrólisis, y no puede ocurrir con EF - G en presencia de un GTP analógico o PIB. El presente hallazgo que completa a la translocación postT ribosome requiere GTP hidrólisis es compatible con la observación que precede a la hidrólisis GTP translocación [7]. Sugerimos, además, que el PIB dependen de los productos básicos observada por translocación Rodnina et al. [7] se origina en una GTP-contaminados PIB solución, que tendría como resultado exactamente de la lenta, monofásicos translocación que observar (ver Materiales y métodos para más detalles).

Nuestro modelo propone las funciones de la EF-G • • PIB P i estructura y la liberación de fosfato inorgánico que son distintos de las anteriores sugerencias [7]. Es decir, proponemos que la hidrólisis de GTP EF-G en el ribosomal transT * estado de resultados en una conformación de EF-G • • PIB P i ribosome que cataliza el movimiento de la transición al estado postT estado. Entonces, la disociación de EF-G de la ribosome exige liberación de fosfato inorgánico (P i), que favorece la formación del PIB determinada estructura de la EF-G [16] con baja afinidad por el ribosoma [8]. Si se parte del supuesto de que la conformación de EF en el G-EF-G • • PIB P i complejo es la misma que la conformación de EF en el G-EF-G • • PIB ácido fusídico complejo [5], entonces la mecánica La acción de ácido fusídico podrían racionalizarse como una congelación de los EF-G en la conformación que cataliza el segundo paso importante de la translocación, con lo que el ribosoma de la transT * estado a la postT estado. En cambio, Rodnina y colaboradores [26] asociar liberación de fosfato inorgánico con una 'relocking' cambio conformacional de los ribosomas, que lleva a la postT estado.

Conclusión

El mecanismo de translocación en eubacterias que hemos sugerido es radicalmente distinta de todos los modelos anteriores [4, 6, 7, 26, 27] en la que nos proponemos los siguientes: en primer lugar, que la EF-G entra en la preT ribosomas en el PIB-favoreciendo forma [16], en segundo lugar, que la EF-G • PIB impulsa el preT ribosomas de su estado relajado con pleno sitios de unión para tres tRNAs [5] a una retorcida conformación híbrido con sitios para dos tRNAs [5], y en tercer lugar, que el intercambio de PIB de GTP y un interruptor de acompañamiento de la EF-G conformación de su PIB-vinculado a su GTP determinada ocurren en la estructura, en lugar de despegue, los ribosomas.

Nuestros resultados sugieren que el ribosoma no identificados previamente desempeña un doble papel de los nucleótidos guanina-factor de cambio y de la activación de la proteína GTPasa por lo menos dos factores de la traducción en eubacterias, EF-G y RF3. Esto puede ser racionalizado por la exigencia de que la actividad GTPasa ribosomal ser estrictamente controlada [8] y que cada uno de los factores de la traducción debe orientar selectivamente un estado particular de los ribosomas.

Materiales y métodos
E. coli componentes para la síntesis de proteínas in vitro

Ribosomas de alta actividad, polymix de amortiguación, la iniciación factores IF1, IF2 y IF3, traducción factores EF-Tu, EF-Ts, EF-G y RF2, tRNA granel, tRNA Phe, y tRNA Ile sobreexpresa fMet-tRNA fMet, PheRS, ThrRS IleRS y se prepararon como se describe [9, 28]. El tRNAs fueron nuevamente purificada por HPLC según Cayama et al. [29] a aminoacilación actividades superior al 80%. [3 H]-GDPNP (Amersham Bioscience, Uppsala, Suecia) y otros nucleótidos (Sigma, de Estocolmo, Suecia) se han purificado en una columna MonoQ (Amersham Bioscience), tal como se describe ([9], la figura 4a]. Ellos están obligados a la MonoQ en un Buffer (20 mM Tris-HCl) y NaCl en eluye con buffer B (20 mM Tris-HCl y 1 M NaCl). El Met-Ile-mRNA de codificación usado para hacer complejos de translocación tiene la secuencia gggcccuuguuaacaauuaaggagguauxxx gggcccuuguuaacaauuaaggagguauxxx gggcccuuguuaacaauuaaggagguauxxx AGO AUU SAU uugcag (a) 21. Contenía un fuerte ribosome sitio de unión, un marco de lectura abierto una codificación de Met-Ile dipeptide (mayúsculas), un codón de parada UAA y un poli (A) para la purificación de cola en un poli (dT) columna; xxx fue bien un Thr (Acu) o un Phe (uuu) codón. El ARNm que codifica el Met-Phe-Thr-Ile tetrapeptide había abierto el marco de lectura AUG UUU ACG AUU. El mRNAs fueron sintetizados por T7 RNA polimerasa de transcripción de oligonucleótidos de ADN. [33 P]-etiquetado de tRNA fMet y mRNAs seguido protocolos estándar (Amersham Bioscience).

Ribosomal complejos

Init preT complejos y se prepararon de acuerdo a Zavialov y Ehrenberg [8]. PostT y preTerm complejos fueron obtenidos de acuerdo a Zavialov et al. [9]. En algunos experimentos ya sea [33 P] marcada con ARNm [11] o [33 P]-tRNA fMet se utiliza para la preparación compleja. La fracción del peptidil-tRNA en los complejos es de más del 80% (para el inicio, postT y preTerm complejos) o 70% (para preT).

Encuadernación del PIB, y GTP a GDPNP EF-G

Para el experimento se muestra en la Figura 2 bis, 5 μ M EF-G se incubó durante 2 min a 37 ° C con [3 H]-PIB (3-18 μ M) en 50 μ l. Los tubos con EF-G y el PIB se someten en hielo. Después de 15 min, 45 μ l de cada muestra fue de nitrocelulosa-filtrada y lavada con 500 μ l de helado polymix buffer. Todas las operaciones se realizaron en una habitación fría (4 ° C). El importe de EF-G • [3 H]-PIB retenido en el filtro se cuantificó contando scintillation [9]. Para el experimento se muestra en la Figura 2b, 5 μ M EF-G se incubó con 45 μ M [3 H]-PIB y de la etiqueta de GTP (0-2.5 mM) o del PIB (0-1.2 mM). Otras condiciones eran las mismas que en la Figura 2 bis. Para el experimento se muestra en la Figura 2d, 2 μ M EF-G, 92 nM ribosomas 70S con 1 μ M Met-Phe-Thr-Ile mRNA o 92 nM preTerm complejos con 0,4 mM puromycin se incubaron con 1 μ M [3 H]-GDPNP en La presencia de frío PIB (0-2 mM) por 7 min a 37 ° C en 50 μ l. Luego, el 45 μ l de cada muestra fue filtrada-nitrocelulosa. Para el experimento se muestra en la Figura 2e, 2 μ M EF-G, 92 nM ribosomas 70S con 1 μ M Met-Phe-Thr-Ile mRNA o preTerm complejos con 0,4 mM puromycin fueron pre-incubadas con 1 μ M [3 H]-para GDPNP 4 min a 37 ° C y luego 2 mM PIB (concentración final) se añadió. Después del PIB además 45 μ l-nitrocelulosa alícuotas fueron filtradas. Por Figura 2f, EF-G o bien se incubaron durante 4 min a 37 ° C con preTerm complejos, y puromycin [3 H]-GDPNP o de amortiguación y, a continuación, se añadió RF2, o alternativamente, [3 H]-GDPNP fue agregado a EF - G pre-incubadas con preTerm complejos, puromycin y RF2. Luego, el 50 μ l-nitrocelulosa alícuotas fueron filtradas para determinar la cantidad de EF-G • [3 H]-GDPNP obligado a la postTerm complejo. El final de las concentraciones de los componentes en las mezclas fueron: 92 nM preTerm, 0,4 mM puromycin, 2 μ M EF-G, 1 μ M RF2 y 1 μ M [3 H]-GDPNP.

Toxina inducible división de ARNm (TICOM)

Para el experimento se muestra en la Figura 3a, 0,12 μ M RelE se incubó durante 1 min a 37 ° C con 0,2 μ M iniciación complejo y 0,12 μ M preT complejas o con 0,24 μ M preT complejo, 2 μ M EF-G y GTP en 50 μ l. Luego, el 10 μ l de 'matar' mix (1,25% SDS y 0,25 M EDTA pH 8.1) se agregó a detener la reacción. Las muestras se extrajeron de fenol, precipitado con etanol y los fragmentos de ARN se ejecuta en una secuencia de gel (10% de poliacrilamida, 8 M urea; [11]]. La cantidad de mRNA cleaved por RelE, normalizado a la intensidad total de ARN bandas en el carril, se determinó a través de la "ImageQuant5.0" programa (Amersham Bioscience). Los antecedentes de hidrólisis de ARNm se utilizó como escalera de nucleótidos. Por Figura 3b, ya sea RelE fue agregado a preT ribosomas incubadas con EF-G y uno de los nucleótidos en diferentes momentos y, a continuación, la mezcla resultante se incubó 5 minutos más antes de apagado, o RelE estaba siempre presente en la mezcla. El final de las concentraciones de componentes de la mezcla (50 μ l) fueron: 0,1 μ M RelE, 2 μ M EF-G, 0,15 μ M preT y 1 mM de cada nucleótido. En todos los experimentos de división en el codón UAA, en presencia de EF-G GTP y se fijó en el 100%. Para la figura 3c, 120 nM RelE se incubó con 0,3 μ M postT o preT complejo, 2 μ M EF-G y 0,6 mM GDPNP a 37 ° C, y 50 μ l alícuotas fueron retirados y analizados en diferentes puntos de tiempo (0-4 min). A las 4 min, 100 mM GTP fue agregado para obtener 1 mM concentración final y la continuación de incubación de 1 min antes de desactivación.

Por Figura 4c, el 80 nM RelE se incubaron durante 3 min a 37 ° C en 50 μ l con 2 μ M EF-G, 0,15 μ M preT nucleótidos y como se indica en la figura.

Por Figura 6a, EF-G, GDPNP y preT fueron incubadas a 37 ° C durante 3 min. A continuación, la mezcla se dividió en dos tubos con el PIB en un buffer y en el otro. Las mezclas fueron incubadas con RelE a 37 ° C y 50 μ l alícuotas fueron analizados a los 15 y 28 min de incubación. Después de 29 min se añadió GTP y la continuación de incubación de 1 min antes de desactivación. El final de las concentraciones de los componentes fueron de 2 μ M EF-G, 40 μ M GDPNP, 0,4 μ M preT, 166 nM RelE, 2 mM PIB y 1 mM GTP.

Liberación de los [33 P]-tRNA fMet de la pre-translocación compleja

Para el experimento se muestra en la Figura 5a, EF-G de nucleótidos y se pre-incubaron con preT complejo [33 P]-tRNA fMet P en el sitio durante 3 min a 37 ° C. Luego, el frío o tRNA fMet tRNA Phe se añadió y 45 μ l-nitrocelulosa alícuotas fueron filtrados en diferentes momentos para determinar la fracción de [33 P]-tRNA fMet sobre los ribosomas. Las concentraciones de componentes de la mezcla fueron: 70 nM preT, 2 μ M EF-G, 1 μ M frío tRNA fMet o tRNA Phe y 1 mM de nucleótidos. Por Figura 5b, EF-G, un nucleótido, preT y 0-2 μ M tRNA fMet o tRNA Phe fueron pre-incubadas durante 9 minutos a 37 ° C. Luego, el 45 μ l-nitrocelulosa alícuotas fueron filtrados y lavados con 1 ml polymix buffer. Para la figura 5c, 2 μ M EF-G se incubó por 7 min a 37 ° C con 88 nM preT, 2 μ M tRNA fMet y GDPNP (0-240 μ M). Luego, el 45 μ l-nitrocelulosa alícuotas fueron filtradas. Por Figura 5d, preT con complejos [33 P]-tRNA fMet P en el sitio fueron pre-incubadas con EF-G y GDPNP, con o sin RelE, durante 3 min a 37 ° C. Luego, el frío o tRNA fMet tRNA Phe se añadió y 45 μ l-nitrocelulosa alícuotas fueron filtradas. Después de 27,5 min de incubación GTP fue agregado a la mezcla, que luego figuran 78 nM preT, 2 μ M EF-G, 0,4 mM GDPNP, 2 μ M tRNA fMet o tRNA Phe, 1 mM GTP y 80 nM RelE.

Para la figura 6d, EF-G se pre-incubaron durante 3 min a 37 ° C en polymix buffer con o sin preT y GDPNP. Entonces, el PIB o de amortiguación polymix se añadió. Después de 1 min de incubación, se añadió tRNA fMet y luego 45 μ l alícuotas se filtra después de nitrocelulosa de diferentes épocas. La mezcla final figura 88 nM preT, 2 μ M EF-G, 100 μ M GDPNP, 1 μ M tRNA fMet y 2 mM PIB.

Liberación de [3 H]-fMet-[14 C]-Ile péptido en RF2 o puromycin

Para el experimento se muestra en la Figura 4b, mezcla A, que contiene 1 μ M EF-G, 23 nM preT complejo y 0,4 μ M RF2, se pre-incubaron durante 3 min a 37 ° C. Luego mezcla B, que contiene nucleótidos, se agregó a la mezcla A, y 45 μ l alícuotas fueron retirados en diferentes puntos de tiempo para la determinación de la cantidad de péptido liberado según Zavialov y Ehrenberg [8]. La mezcla resultante figura 1 μ M EF-G, 23 nM preT, 0,4 μ M RF2 nucleótidos y como se indica en la figura.

Para la figura 2c, que contiene una mezcla EF-G, GTP, RF2, y las concentraciones que varían del PIB se pre-incubaron durante 3 min a 37 ° C. Luego, mezcla B contiene preT complejo y se añadió la cantidad de péptido liberado en 45 μ l alícuotas se determinó en diferentes puntos temporales. La mezcla resultante contenía 10 nM EF-G, 23 nM preT, 0,4 μ M RF2, 0,5 mM GTP y 0-0.8 mM PIB.

Para la Figura 6 ter y quáter, EF-G se pre-incubaron durante 3 min a 37 ° C con preT complejo y GDPNP o polymix buffer. Entonces, el PIB o de amortiguación se añadió, se continuó la incubación durante 1 min, y luego puromycin (Figura 6b] o RF2 (Figura 6c] y se añadió la cantidad de péptido liberado en 45 μ l alícuotas se determinó en diferentes puntos temporales. La mezcla final figura 2 μ M EF-G, 46 nM preT, 0,5 μ M RF2 o 0,4 mM puromycin nucleótidos y como se indica en la figura.

Encuadernación de tRNAs al sitio E

Típicamente, un complejo ribosomal (10-30 nM) se incubaron con [33 P]-tRNA fMet diluciones de 5 min a 37 º C y luego 45 μ l de la mezcla de nitrocelulosa fue filtrada a fin de estimar la cantidad de ribosomas determinada [33 P]-tRNA fMet. Para observar el efecto de un sitio de la división de ARNm, la incubación se llevó a cabo con 100 nM RelE. Para medir la unión de [33 P]-tRNA fMet al sitio de E postT ribosomas a 0 ° C, los tubos con la mezcla se incubaron en hielo durante 20 minutos antes de la filtración. Para medir el carácter vinculante (de cambio), de [33 P]-tRNA fMet a preT ribosomas, en presencia de EF-G, 3 μ M EF-G y 1 mM GDPNP, GTP o del PIB se añadieron a la mezcla de reacción. Para determinar la constante de disociación (K I) para la unión de tRNA Phe al sitio E de la inhibición de las curvas en la Figura 7b, un complejo ribosomal se incubaron con 0,8 μ M [33 P]-tRNA fMet y el aumento de las concentraciones de la etiqueta de tRNA Phe K Yo estudio se obtuvieron los valores de K I = I50 / (1 + [tRNA fMet] / Kd), donde 50 es [tRNA Phe] en el 50% de inhibición de tRNA fMet vinculante (disociación constante K d).

Translocación cinética con mezclas de PIB y GTP
Adicional de los archivos de datos

El siguiente texto se presenta como un nuevo archivo de datos con la versión en línea de este artículo. 1 archivo de datos adicionales, lo que demuestra que en el EF-G solución puede cambiar de un PIB a un GTP conformación.

Material suplementario
Archivo Adicional 1
Otro archivo de datos que muestran que en el EF-G solución puede cambiar de un PIB a la conformación GTP
Agradecimientos

Damos las gracias a Frank J. y M. Valle de valiosas sugerencias y F. Darfeuille de asistencia técnica. Este trabajo fue apoyado por becas de la Fundación Sueca para la Investigación Estratégica y el Consejo de Investigación sueco.