Genetic Vaccines and Therapy, 2005; 3: 4-4 (más artículos en esta revista)

Inmediata transfección de los pacientes derivados de la leucemia: una nueva fuente para la generación de vacunas basadas en células

BioMed Central
Jill A Gershan (jgershan@mail.mcw.edu) [1], Bryon D Johnson (bjohnson@mcw.edu) [1], James Weber (jweber@mail.mcw.edu) [1], Dennis W Schauer (dschauer @ Mail.mcw.edu) [1], Natalia Natalia (nnatalia@mcw.edu) [1], Stephanie Behnke (sbehnke@mcw.edu) [1], Karen Burns (kburns@mcw.edu) [1], Kelly W Maloney (kmaloney@mail.mcw.edu) [1], Anne B Warwick (awarwick@mail.mcw.edu) [1], Rimas J Orentas (rorentas@mail.mcw.edu) [1]
[1] Departamento de Pediatría, Colegio Médico de Wisconsin y el Instituto de Investigaciones de la Infancia, el Hospital de Niños de Wisconsin, 8701 Watertown Plank Rd., Milwaukee, WI 53226, EE.UU.

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

La producción de células de cáncer de vacunas por vectores gen de codificación de proteínas que estimulan el sistema inmune ha avanzado rápidamente en los sistemas modelo. Hemos tratado de no desarrollar métodos de transfección viral que puede transformar las células tumorales en los pacientes vacunas contra el cáncer, allanando el camino para la rápida producción de células autólogas basada en vacunas.

Métodos

Como se extendió la cultura y la expansión de la mayoría de las células tumorales del paciente no es posible, se solicita a la primera evaluación de una nueva tecnología que combina la electroporación y químicas transfección con el fin de determinar si el plásmido basado en vectores de genes podría ser entregado instantáneamente al núcleo, y para determinar Si era posible la expresión de los genes en una célula del ciclo de forma independiente. Pusimos a prueba las líneas de células cultivadas, un tumor murino primaria, y primaria de las células de leucemia humana de diagnóstico de trabajo para expresión de los transgenes, utilizando tanto RFP CD137L y vectores de expresión.

Resultados

Combinado electroporación-transfección de ADN plásmido entregado directamente al núcleo de las células transfectadas, como se ha demostrado por microscopía confocal y la PCR en tiempo real de análisis de los núcleos aislados. Expresión de la proteína de vectores del plásmido puede ser detectado tan pronto como dos horas después de transfección. Sin embargo, la cinética de la expresión de genes de plásmido basado en vectores en línea celular óptimo indicó que se sigue la expresión de genes dependientes de la división celular. A continuación, la prueba para ver si pediátrica leucemia linfocítica aguda (ALL) también mostrar la rápida cinética de la expresión génica de las células tumorales de líneas, la determinación de la expresión génica 24 horas después de transfección. Seis de las 12 muestras mostraron mayor que el 17% expresión de los transgenes, y todas las muestras mostraron al menos algunos expresión de los transgenes.

Conclusión

Dado que la expresión de los transgenes podría ser detectada en la mayoría de las muestras analizadas tumor primario en cuestión de horas, la electroporación directa basada en transfección de primaria de la leucemia tiene el potencial de generar paciente específicos de vacunas contra el cáncer. Plásmido basada en la terapia génica constituye una manera sencilla de generar células de cáncer vacunas y no requiere de la amplia infraestructura de un virus basado en el sistema de vectores.

Antecedentes

La eficacia de las células de tumores vacunas en modelos murinos de tumores malignos está bien establecida. El uso de las líneas de células tumorales transfectadas con las moléculas solubles estimulantes inmunes como la IL-2 o IL-12, o la superficie celular co-estimuladora incluyendo antígenos CD80, y CD137L, o incluso alogénico MHC resultados profundos en la activación inmunitaria [1 - 5]. La ventaja de trabajar en el modelo es que los sistemas de cantidades ilimitadas de tumor están disponibles para producir vacunas basadas en células. La capacidad de producir células basadas en la clínica de las vacunas derivadas de material, sin embargo, sigue siendo un desafío.

Basada en vacunas de células de tumor derivado de los materiales se han preparado y administrado en tanto una autólogo o alogénico de moda, recientemente revisado por Mocellin, et al. [1]. Una vacuna alogénico por lo general características de la expansión de una única línea de células tumorales que pueden crecer así en la cultura, la transducción genética de los vectores, y la preparación de las grandes reservas de la vacuna que puede ser calificado de uso clínico. Una vacuna para el neuroblastoma con la expresión de citoquinas tanto una de quimioquinas y un transgén (IL-2 y lymphotactin) por una sola línea celular humana neuroblastoma es un ejemplo reciente de esta estrategia [7]. La desventaja de una sola línea celular enfoque es que cada malignidad es, en cierta medida, singular, y quizás la más inmunogénica antígenos, o los más pertinentes para un determinado paciente, no podrán ser expresadas por el alogénico vacuna.

Dar estas limitaciones, proponemos que una célula basada en la vacuna podría producirse en forma autóloga para pacientes con una alta carga de morbilidad, como las que se presentan con una importante implicación de la médula ósea. Por ejemplo, la gran cantidad de material de tumor normalmente disponibles de los pacientes de leucemia hace que estas células autólogas accesible para los pacientes derivados de la producción de vacunas.

Un importante obstáculo que hay que superar en la utilización primaria de las células es la necesidad de la cultura células tumorales in vitro con el fin de transducción de transfección o procedimientos que se llevan a cabo. La mayoría de tumores malignos no sobrevivirá en la cultura en números suficientemente grandes para ser utilizados. Sin embargo, si el tiempo necesario para la manipulación in vitro se reducen al mínimo, por ejemplo de 8-24 horas, los pacientes derivados de la leucemia de células puedan ser aislados de la sangre o la médula ósea, transfectadas, y luego a la irradiación utilizada como base de células vacuna. Aquí mostramos la aplicación de una novela basada en la electroporación transfección metodología que tiene el potencial de transformar de inmediato un paciente en una muestra de tumor de células de cáncer de vacunas. Este proceso, denominado nucleofection, fue perseguido en nuestro laboratorio, ya que es el método más rápido de la introducción de vectores de genes disponibles. Demostramos que a pesar de la entrega de un plásmido vector de genes al núcleo es inmediata, a corto plazo aún se necesita cultura, y que una sola ronda de la división celular puede ser necesaria para alcanzar los niveles óptimos de expresión génica. Es importante destacar que el plazo para la preparación de vacunas tumor está ahora medido en términos de horas en lugar de días. Nuestros resultados confirman los estudios realizados por Schakowski et al., En donde 3 muestras de leucemia mieloide aguda (LMA) de los pacientes fueron transfectadas con un vector de expresión GFP [8]. El alto grado de expresión de los transgenes en la mayoría de los pacientes derivados de la leucemia linfoblástica aguda (ALL) los especímenes que presentamos aquí sugiere que un ensayo clínico utilizando estos procedimientos deben continuar.

Métodos
Líneas celulares

El ratón AGN2a línea de celulares de neuroblastoma, un agresivo subclone de Neuro-2a, se cultivaron en la Dulbecco modificado a medio Eagle (MEDM), 100 U / ml de penicilina, 100 μ g / ml estreptomicina, 2 mM L-glutamina y 10% fetal bovino inactivado por calor Suero (FBS), 1 mM MEM piruvato de sodio, 100 U / ml de penicilina, 100 μ g / ml estreptomicina, 0,01 M HEPES buffer, 2 mM L-glutamina, 0,05 M 2-mercaptoetanol, y 0,069 M L-arginina HCl [4] . Primaria tumor murino, se ha generado por la inyección subcutánea de 1 × 10 6 células cultivadas en AGN2a cepa A / J mice (Jackson Labs, Bar Harbor, ME). La línea celular humana osteosarcoma U2OS, proporcionado amablemente por el Dr Kent Wilcox, Colegio Médico de Wisconsin, el ratón y el carcinoma de células escamosas línea celular SCCVII, proporcionado amablemente por el Dr Scott Strome, Mayo Clinic, Rochester, MN, se cultivaron en MEDM como Supra. Mouse tumor primario fue transformada en una sola celda de suspensiones por la inyección de 1-2 ml de 1 mg / ml de colagenasa D extirpados en la masa tumoral (1 mg / ml en 10 mM HEPES, 150 mM NaCl, 5 mM KCl, 1 mM MgCl 2, 1,8 mM CaCl 2) y se incuba a 37 ° C durante 45 min seguidos de los trastornos mecánicos a través de una pantalla estéril. Tumor de células fueron lavadas en PBS y MEDM y viable células fueron separadas por centrifugación en un Ficoll-Paque ™ (Amersham Biosciences, Piscataway, NJ) gradiente de densidad.

Transfección de líneas de células tumorales

Tumor de células fueron transfectadas con cualquiera de las dos pcDNA3.1/Hygro (-) (Invitrogen, Carlsbad, CA) o pDSRed2-C1 (BD Biosciences, San Diego, CA) usando un plásmido vectores lípidos catiónicos basados en la metodología transfección (Novafection, VennNova, Inc ., Pompano Beach, FL) o un método de electroporación de propiedad (Nucleofection, Amaxa, Köln, Alemania). Las células se nucleofected con 0,5 μ g plásmido por 10 6 células o lípidos transfectadas con 0,5 μ g plásmido y 2 μ g de reactivo NovaFECTOR por 10 6 células. Del mismo modo, U2OS, SCCVII y AGN2a células fueron nucleofected con 0,5 μ g por 10 6 células pDSRed2-C1. Para determinar los niveles de expresión, las células se tiñeron con 7AAD (BD Biosciences), y la expresión de la proteína fluorescente de color rojo (RFP) viven en barrios privados células se analizó por citometría de flujo (FACScan, Becton Dickinson, Franklin Lakes, NJ) en el tiempo designado puntos. U2OS y SCCVII células fueron también nucleofected con pCI-neo (Promega, Madison, WI) codificación CD137L (4-1BBL) cDNA a una concentración de 1,5 μ g por 10 6 células [5]. El CD137L transfectadas las células se tiñeron con ficoeritrina (PE) conjugado de ratón anti-humano CDw137 ligando (BD Biosciences Pharmingen, San Diego, CA).

Las muestras de pacientes

Paciente de leucemia y linfoma de las muestras se obtuvieron de acuerdo a la Declaración de Helsinki de exceso de médula ósea o la sangre periférica especímenes presentado a la Célula de marcador de Laboratorio, Hospital de Niños de Wisconsin, para la leucemia de cribado de rutina. Estudios con estas muestras fueron aprobadas por el Colegio Médico de Wisconsin y el Children's Hospital de Wisconsin Juntas de Revisión Institucional. Se obtuvo el consentimiento de los padres o tutores de cada niño y cada muestra se le asignó un número identificador único para garantizar la confidencialidad.

Transfección de primaria de células de leucemia linfocítica aguda

Leucocitos de la médula ósea o la sangre periférica del paciente muestras fueron separadas por centrifugación en un Ficoll-Paque ™ gradiente de densidad. Las células se nucleofected con 1 μ g pDSRed2C-1 (proteína fluorescente roja, RFP, de expresión vector) plásmido por 10 6 células usando una variedad de soluciones Amaxa programa y parámetros, cultivadas en RPMI-1640, 100 U / ml de penicilina, 100 μ g / ml Estreptomicina y 10% de SFB inactivado por calor durante 24 horas luego de RFP expresión analizadas por citometría de flujo (FACScan, Becton Dickinson). FACS adquisición y el análisis se hizo utilizando cualquiera de yoduro de propidio (PI) o de excluir 7AAD células muertas. La explosión de población leucémica fenotipo es determinado por la citometría de flujo y perfil de la expresión del antígeno CD, en comparación con la población normal de las células. Tanto CD45 + y CD45-leucémica explosiones podrían gated cuando manchadas de anticuerpos anti-CD45 y analizadas por citometría de flujo para la expresión CD45 lado y propiedades de dispersión. Todos los anticuerpos utilizados fueron grado clínico directo fluorocromo conjugados (Becton Dickinson).

La microscopía confocal

U2OS células fueron nucleofected con 3 μ g fluoresceína etiquetados (Mirus Label ® IT Tracker, Madison, WI) plásmido pUC19 o pDSRed2C-1 plásmido por 10 6 células. Inmediatamente, o 3 días siguientes nucleofection, las células fueron lavadas en cDMEM y contados. Las células fueron fijadas en un portaobjetos de vidrio con formalina tamponada 3,7%, lavado, permeabilized con 0,5% Triton X-100 (Surfact-amp, Pierce, Rockford, IL) y lavar de nuevo. Pearmeabilized células fueron incubadas con 2,4 nM TOTO3 (Molecular Probes, Eugene, OR) y lavados. Vectashield (Vector Laboratories, Inc, Burlingame, CA) se agregó a las células antes de sellar con un coverslip. De secciones ópticas de las células se tomó secuencialmente utilizando argón (488 nm de excitación) y helio y neón (633 nm de excitación) en un láser Leica SPT S2 con un microscopio confocal de 100x de inmersión en aceite de lente.

Cuantitativo PCR en tiempo real

U2OS células fueron nucleofected con 0,5 μ g pDSRed2C-1 plásmido por 10 6 células. Las células fueron cosechadas y utilizado para el aislamiento de ADN nuclear. Antes de aislamiento de ADN, los núcleos se lavaron en PBS e incubadas con 0.5U DNasa I (Ambion, Austin, TX) a 37 ° por 10 minutos y lavar de nuevo dos veces en PBS. Se aisló el ADN nuclear (núcleos EZ prep, Sigma, Saint Louis, MO) de las células transfectadas en el tiempo designado puntos. El plásmido codifica la neomicina fosfotransferasa gen (neo) fue amplificado con los primers y sondas TaqMan hidrólisis como se describe por Sanburn, et al. [9]. ADN nuclear de cada una de las tres experimentales y tres muestras de control paralelo (U2OS células Nucleofected sin plásmido) se amplificó por triplicado en un Opticon ™ 2 Cycler (MJ Research ™, Inc, Waltham, MA) con el siguiente ciclo de protocolo: 50 ° C 2 min, 95 ° C 10 min, con 40 ciclos de 95 ° C durante 15 segundos., Y 62 ° C durante 1 min. Para normalizar el número de células / núcleos, la RNasa P fue amplificado utilizando el TaqMan ® RNasa P kit de reactivos (Applied Biosystems, Foster City, CA), o de células de ratón, el ratón Apo B fue amplificado utilizando los primers 5 'CACGTGGGCTCCAGCATT 3' Y 5 'TCACCAGTCATTTCTGCCTTTG 3' y la sonda TaqMan hidrólisis 5 '(FAM) CCAATGGTCGGGCACTGCTCAATA (TAMRA) 3' (cortesía Renee Horner, qpcrlistserver, grupos de yahoo, yahoo.com). El neo número de copias de genes por célula se determinó a través de un plásmido basado en la curva de nivel.

Análisis de la división celular

Las células se suspendieron en PBS e incubadas con CFDA SE (5 - (y -6)-carboxyfluorescein diacetato succinimidyl ester, CFSE (Molecular Probes, Eugene, OR) a una concentración final de 0,35 μ M por 4 × 10 6 células, incubados durante 10 Min a 37 ° C, y lavado en MEDM x3, 10% de SFB. CFSE expresión fue analizada por citometría de flujo para evaluar la división celular.

Bloqueo del ciclo celular

En el 50-60% confluency, 0,6 mM mimosine (Sigma, Saint Louis, MO) fue añadido a U2OS células (2). Ambos U2OS y U2OS células tratadas con mimosine fueron incubadas a 37 ° C durante 48 horas momento en el que las células han sido recolectados, y nucleofected contó con 1,5 μ g por 10 6 células pCI-neo vector de codificación humanos 4IBBL cDNA (CD137L) [5]. Como control, las células fueron también nucleofected sin plásmido. Cuatro horas después de la nucleofection células fueron cosechadas, contados, manchadas de phycoerytherin (PE) la etiqueta anti-humano CD137L (BD Biosciences) y 7AAD (BD Biosciences), y se analizaron por CD137L expresión-por citometría de flujo. Para determinar el contenido de ADN antes de nucleofection, las células fueron lavadas en buffer fosfato salino (PBS), fijado con paraformaldehido 4%, lavados de nuevo en PBS, y 1 μ l de yoduro de propidio (BD Bioscience) a 50 ug / ml se añadió. El yoduro de propidio etiquetados células fueron analizadas por citometría de flujo [11].

Resultados
Optimización de la transfección por electroporación

Para determinar las diferencias en la cinética y la fuerza de expresión de un gen reportero transfectadas utilizando ya sea un método de electroporación (nucleofection) liposomas catiónicos o una metodología basada en (novafection), U2OS humanos osteosarcoma células fueron transfectadas con 0,5 μ g pDSRed2C-1 (RFP) plásmido Por 10 6 células, y RFP expresión de la proteína en el tiempo medido por citometría de flujo. Tras nucleofection, RFP se expresó ya en 4 horas en U2OS células, la Figura 1A. En 12 horas, el 60% de la RFP nucleofected células expresó. Cuando este tipo de cambio se ajustó a la muerte celular asociada con nucleofection, la transfección tasa se redujo a 18% del total de células que expresan inicialmente transfectadas ahora RFP a las 12 horas. El día 3, cuando el porcentaje de viabilidad de las células nucleofected regresó al 100%, las tasas de transfección ya no necesitan corrección y la informó de las tasas son idénticas. Esta expresión se mantuvo durante varios días y disminuyó gradualmente hasta el día 14 cuando expresión ya no puede ser detectado. En cambio, utilizando novafection, RFP expresión requiere 12 horas de la cultura (en contraposición a 4 horas para nucleofection) y no pico enfoque de los niveles de expresión hasta el día 1, Figura 1B. La eficiencia de transfección se determinó utilizando idénticas cantidades de plásmido vector de genes en cada método. Al comparar los niveles de expresión de la RFP en el día 1, la superioridad de la electroporación basada transfección fue evidente. En el nucleofected viable fracción de las células, el 60% de estas células expresó RFP a las 24 horas, frente a un 15% de la novafected células. Incluso cuando las células corregidas por perdido a la electroporación asociada a la muerte celular, la expresión nucleofection tasa es de 26%. Como control, las células fueron también nucleofected con un RFP no expresar plásmido, pcDNA3.1/Hygro (-), y la mínima autofluoresence de células transfectadas (menos de 2%) resta de la información sobre el nivel de expresión. La solicitud de ofertas niveles de expresión en las células transfectadas con el reactivo basado en liposomas podría ser aumentado por el aumento de la cantidad de ADN plásmido, por lo que estas comparaciones son relativas y no al máximo de cada método (no se muestra).

A continuación, la prueba principal del ratón derivados de neuroblastoma en masa de la capacidad de ser transfectadas por estas metodologías. AGN2a células tumorales se inyecta por vía subcutánea en ratones de acogida cepa, A / J, y la consiguiente subcutánea de células tumorales en masa fue extirpada, transformada en una casa de una sola célula de suspensión, transfectadas con 0,5 μ g pDSRed2C-1 (RFP) por plásmido 10 6 células, y RFP expresión en el tiempo medido por citometría de flujo. Nucleofected primaria murino células tumorales comenzaron a expresar RFP antes de lo novafected células (5 horas frente a 1 día) y los niveles de expresión llegó a su máximo en el día 2 en las células viables nucleofected y el día 4 en novafected células, la figura 2. Este pico más adelante es probable debido a la mayor duración de la expresión de los transgenes en novafected células. Tanto la cinética y el total de la solicitud de ofertas para los diferentes niveles de expresión de la línea celular humana U2OS, la Figura 1, y el principal tumor derivado de ratón, AGN2a, Figura 2. El nucleofection tasas no son tan altos para la nucleofected tumor primario, mientras que la tasa de novafection mejorado. Estos sistemas son muy diferentes y la rápida división celular de la tasa U2OS cultivadas, la Figura 3, en contraposición a uncultured tumor que se extirparon, transformada en una única solución de células y, a continuación, transfectadas, pueden explicar en parte este resultado.

La principal limitación de la electroporación transfección está basada en la muerte de la célula. Experimentos preliminares confirman que el aumento de la fuerza del campo eléctrico correspondió a la vez una mayor tasa de transfección, y el aumento de la muerte de la célula. El nucleofection configuración que hemos encontrado óptimo resultado en el 70% la muerte de la célula, la Figura 1A. Gradualmente el número de células recuperadas después de los nucleofection, a partir de las 24 horas. En cambio, no hay disminución en el número de células tras novafection, Figura 1B.

Entrega del plásmido de ADN al núcleo de la electroporación es rápido y de corta duración

La incapacidad de la cultura primaria de la mayoría de tumores humanos nos llevó a la búsqueda de métodos de transfección que requeriría un mínimo de procesamiento de la cultura y el tiempo permitiendo a la vez que eficiente transfección de genes. Dada la rápida cinética de expresión utilizando nucleofection, tratamos de determinar si ello se debía a la entrega directa de plásmido de ADN en el núcleo. La microscopía confocal se utiliza para visualizar los distintos z-plano interno de las secciones que representan nuclear U2OS capas de células que se habían nucleofected con 3 μ g FITC-etiquetados plásmido pUC19 por 10 6 células, inmediatamente cytospun diapositivas en vidrio, y luego preparado para microscopía. El nucleares y citoplasmáticas nucleofected límites de las células se visualizaron por microscopía de contraste de fases, la figura 3A, grupo b, o por tinción con el colorante TOTO3 nuclear, la figura 3A, panel c. Los núcleos están teñidos de color azul oscuro, con un ligero azul en la tinción citoplásmica compartimento. El plásmido asociada a fluoresceína señal estaba presente tanto en el citoplasmáticas y nucleares compartimentos nucleofection inmediatamente después, la figura 3A, grupo d. La inspección visual revela que la mayoría de las células contenidas plásmido nuclear, la figura 3A, d (una superposición de la señal con el plásmido TOTO3 mancha).

Usando la misma técnica, y por la tarde se trató de determinar cuánto tiempo después de nucleofection el plásmido vector permanecieron en el núcleo. Tres días después de nucleofection de U2OS células con 3 μ g FITC-etiquetados pDSRed2C-1 (RFP) por plásmido 10 6 células, la presencia de vector de ADN plásmido, fue disminuido en gran medida, la figura 3B, grupo a. La presencia del vector de ADN plásmido, detectada por fluorescencia FITC, se observó en una pequeña minoría de las células, y cuando se presente en el día 3, que parece asociarse más con una fluorescencia punteada en el citoplasma, la Figura 3B, y d. A pesar de la pérdida de plásmido vector del núcleo, intensa fluorescencia de color rojo que se observa en muchas de las células en este momento, lo que indica la continuación de la presencia de la proteína fluorescente de color rojo, la figura 3B, paneles y b d.

Para confirmar aún más la presencia del plásmido en el núcleo, el número de copias de vector plásmido por célula fue calculado por PCR en tiempo real la amplificación de la pDSRed2C-1 codifica la neomicina fosfotransferasa gen (neo). U2OS células fueron nucleofected con 0,5 μ g pDSRed2C-1 por 10 6 células y de inmediato, o en el día 3, se aisló el ADN nuclear de la fracción nuclear de células lisados y amplificación de PCR usando primers neo-neo y una sonda TaqMan específicos. El número total de ejemplares neo plásmido se calculó sobre la base de comparación a una curva estándar generada con el mismo plásmido vector. El número de células (o núcleos) analizadas se determinó utilizando un estándar de la curva de calibrado para el ADN genómico de masas y señal de la única copia de genes RNAseP. Los núcleos son purificadas en un colchón de sacarosa, lavadas con PBS, digeridos con DNAse, a fin de eliminar la contaminación de ADN plásmido citoplásmica, y el total de ADN extraído. Inmediatamente después de nucleofection, había entre 200 y 400 copias de plásmido por célula, Figura 3C. De acuerdo con microscopía de datos, el número de copias en U2OS núcleos celulares se redujo a 50 copias por célula o menos por 3 días después de los nucleofection, la figura 3D. Inmediata localización de plásmido al núcleo siguientes nucleofection fue observado también por PCR en tiempo real en el AGN2a y SCCVII líneas celulares (datos no presentados).

Entrega de los vectores del plásmido gen al núcleo requiere de la división celular para una óptima expresión de genes

El ideal de células de cáncer vacuna recombinante permitiría la expresión de genes en las células tumorales primarias humanos. El principal obstáculo es que los tumores humanos no crecen y se dividen de manera eficiente en la cultura. Por lo tanto, es esencial para evaluar la asociación entre la división celular y la expresión de genes nucleofected. Para determinar el patrón de la división celular en las tasas de nucleofected línea celular (U2OS, AGN2a y SCCVII), líneas de células tumorales cultivadas fueron incubadas con carboxyfluorescein diacetato succinimidyl ester (CFSE). La intensidad de fluorescencia CFSE fue analizada por citometría de flujo cada dos horas durante 10 horas y luego al día durante 3 días después de nucleofection, la figura 4A-C. Según la CFSE disminución de la intensidad de fluorescencia con cada división celular (izquierda cambio de picos), las células U2OS sufrió alrededor de 3 divisiones de la célula en las primeras 10 horas después de la nucleofection, mientras, la AGN2a y SCCVII células dividen aproximadamente una vez en los primeros 10 Horas después de la nucleofection. CFSE células fueron también teñidas con nucleofected RFP-plásmido de codificación y no hubo diferencias en el patrón fluorescente CFSE por citometría de flujo en el nucleofected versus no nucleofected células (datos no presentados). Como se ha demostrado anteriormente, es la rápida división U2OS células que exhiben expresión de los transgenes a las 4 horas (20% de la RFP expresó viables), mientras que la solicitud de ofertas no puede ser detectada en la división más lenta AGN2a y SCCVII hasta 12 horas después de la nucleofection, Figura 4D .

Para estudiar más a fondo este hallazgo, hemos utilizado un suplente codificada por plásmidos transgén y comparó la cinética de expresión en la división rápida y lenta de las líneas celulares. Nuestro laboratorio ha producido una serie de co-estimulante inmune vectores de expresión, y hemos elegido un humano CD137L (4IBBL) de vectores de expresión para su estudio posterior. Expresión de esta célula-antígeno de superficie puede medirse directamente por citometría de flujo utilizando una etiqueta-CD137L de anticuerpos específicos. Una de nuestras preocupaciones con el uso de la solicitud de ofertas que se DsRed2 proteína que utilizan requiere aproximadamente 6 horas para llegar a la plena intensidad de fluorescencia debido a la exigencia de la oxidación intracelular [12]. Por lo tanto, una codificación-CD137L plásmido, 1,5 μ g por 10 6 células, se nucleofected en la U2OS y SCCVII células y de expresión en comparación. En la rápida división U2OS, el 40% de las células expresó CD137L tan pronto como 2 horas después de la nucleofection. A las 6 horas después de la nucleofection, el 80% de las células U2OS expresó CD137L, Figura 4E. En contraste, sólo el 10% de las células SCCVII expresó CD137L a las 6 horas después de la nucleofection. El nucleofection proceso también se asociaron con una muerte celular, demostrando que la muerte de las células no es un fenómeno asociado RFP-, la Figura 4F. Todas las células con experiencia de 60 a 80% la muerte de la célula a nucleofection, sin embargo las células SCCVII recuperaron mucho más rápidamente que cualquiera de las células de rápida división U2OS o menos rápida división AGN2a células, lo que indica que otros factores, además de la división celular celulares están involucrados en la recuperación de la electroporación Y los procesos de transfección.

Directamente a evaluar la necesidad de la división celular, U2OS células fueron incubadas con 0.6mM mimosine, que bloquea la progresión del ciclo celular, y CD137L expresión de nucleofected células en comparación con los controles no tratados, la figura 5A. En mimosine no tratadas U2OS células, aproximadamente el 20% de las células expresó CD137L a las 4 horas después de la nucleofection. En contraste, menos del 4% de las células tratadas mimosine expresó CD137L a las 4 horas después de la nucleofection. Para asegurar que el ciclo celular se produjo en bloque mimosine células tratadas, ciclo celular se realizó mediante tinción con yoduro de propidio. La mayoría de las células fueron tratadas mimosine en G1/G0 mientras que el mimosine sin tratar las células tenían una mayor proporción de células en S, y G2 / M fases del ciclo celular, la figura 5B. Este hallazgo indica que la progresión del ciclo celular aumenta la expresión de los transgenes por nucleofection. Este hallazgo fue inesperado, ya que implica que otros mecanismos están en el trabajo, además de la entrega de un plásmido de ADN al núcleo.

Aplicación de la electroporación de base para la transfección leucemias

Para evaluar la capacidad de la electroporación transfección de base que se utiliza en la producción del tumor autólogo vacunas para los pacientes, primero se determinó la óptima electrotransduction parámetros. Fresh primaria de la leucemia de células a partir del 6 de muestras de los pacientes fueron nucleofected con 1 μ g de plásmido pDSRed2C-1 por 10 6 células, utilizando tres diferentes soluciones Amaxa (R, T, V), y varios programas diferentes electrotransduction (T20, U15, T17, T27, E04 , O17, T16, T01, y O17). La expresión de la proteína RFP fue determinada por citometría de flujo 24 horas después de la nucleofection. Existe una amplia gama de expresión RFP dependiendo de las condiciones de electroporación, en el cuadro 1. R Amaxa solución con el programa y solución T20 T en combinación con el programa U15 proporcionado la más alta expresión de la proteína RFP. El más alto nivel de expresión visto era de 62%, (4 muestra PB) y la más baja expresión fue del 1,8% (muestra 12 BM). La solicitud de ofertas expresión total de 12 muestras recogidas utilizando solución R T20 programa y, a lo largo de los que se dispone de información de diagnóstico fenotípico, se presentan en la Tabla 2. El R/T20 ajustes fueron escogidos sobre la base de un perfil ligeramente mejor que la viabilidad T/U15. Superior al 5% de expresión se observó en 9 de 12 muestras y 20% mayor que la expresión se observó en 5 de 12 muestras. Estos pacientes fueron leucemias caracteriza por marcadores estándar de la leucemia infantil, y el fenotipo no está claramente asociada con la capacidad de ser transfectadas estamos utilizando los parámetros establecidos. Aunque no se informó, el número de células leucémicas obtenidos por paciente fue variable-como las muestras obtenidas para este estudio fueron esencialmente de diagnóstico es que se descartan. Para dos de las muestras (5 y 6) hemos tenido tanto de sangre periférica y de médula ósea procedentes de las muestras corresponde. En ambos casos las células de sangre periférica mostró una mayor tasa de transfección. Nuestra certeza de que las células analizadas fueron transfectadas la leucemia de células proviene de la experiencia clínica de diagnóstico de la célula de marcador de Laboratorio del Hospital de Niños de Wisconsin, donde el idénticos procedimientos utilizados para el diagnóstico clínico de malignidad se utilizaron para analizar las muestras nucleofected. La mayoría de las muestras que fueron analizadas aspirado de médula ósea. En los pacientes con enfermedad avanzada, autólogo de médula ósea puede ser tanto una fuente accesible y abundante de las células tumorales que pueden ser modificados por el plásmido basado en vectores de genes para producir vacunas basadas en células.

Discusión

Autólogo de células basadas en vacunas contra el cáncer son muy prometedores en el esfuerzo por cambiar el sistema inmune adaptativo de la ignorancia o la anergia hacia inmune mediada por células reconocimiento de cáncer. La generación de un tipo Th1-respuesta inmune con células basadas en vacunas, y la consiguiente CTL mediada por el asesinato de tumor, han ofrecido la más eficaz de lucha contra el tumor de las respuestas pre-clínicos en modelos, y también puso en marcha la clínica, revisado por Nitti Et al. [13]. Ex vivo introducción de genes de los vectores de la activación inmune codificación de señales (como co-estímulo antígenos, citocinas y moléculas de adhesión) en las células tumorales con la posterior re-introducción de las células tumorales irradiadas modificados en los pacientes está siendo perseguido Con el objetivo de iniciar un clínicamente relevantes de la respuesta inmune contra el tumor [14, 15]. Debido a que este tipo de terapia consiste en la transformación de células, la cultura procedimientos, así como de transmisión genética, cualquier medida que racionalizar el proceso de hacer una contribución importante hacia el desarrollo de una vacuna tumoral.

Más reciente generación de transfección procedimientos basados en la electroporación o ramificadas polyethyleneamine (PEI) se ha informado al ser independiente de los efectos del ciclo celular [14]. Sin embargo, encontramos que la progresión del ciclo celular hace aumentar la expresión de los transgenes y de que ciertas líneas de células tumorales (como U2OS) piensa que podría ser muy "transfectable" puede ser altamente susceptibles de vector de expresión de los transgenes derivados precisamente porque tienen rápidos de las tasas de división celular . La mayoría de los informes no se analizan expresión de los transgenes en las primeras veces (2-8 horas) nos informe aquí, y menos que se demuestre lo contrario, la contribución de la progresión del ciclo celular en las primeras 8 horas de transfección no se puede excluir. Hemos examinado esta cuestión en detalle, porque nuestro objetivo es transfect primaria leucemias humanas que no persistir en el cultivo de tejidos y, por tanto, han limitado la capacidad de proliferación in vitro.

De ese modo, se define el problema, se examinaron en detalle un procedimiento de transfección que parece ser el más rápido. Nucleofection entrega plásmido vector de ADN en el núcleo de inmediato, la figura 3. Sin embargo, como lo demostramos aquí, nucleofection todavía se beneficia de la progresión del ciclo celular y la división celular, las cifras 4, 5. Usando nucleofection encontramos que las células tumorales cosechados directamente de un ratón que lleva el AGN2a neuroblastoma podría nucleofected con alta eficiencia. Así, el proceso de transformación tumoral desglose y no hacer que el neuroblastoma se estudiaron las células resistentes a la nucleofection. Confiando en estos resultados, hemos iniciado el análisis primario de tumores humanos.

El tumor se analizaron muestras de los pacientes fueron sometidos a diagnóstico de sospecha de leucemia en la infancia. Si las muestras de sangre o de médula ósea se mantuvo después de los procedimientos de diagnóstico se terminaron, que fueron analizadas por la capacidad de ser nucleofected. Nueve de las 12 muestras mostraron mayor que 5% de expresión de los transgenes, y la mitad de estos mostraron mayor que el 17% de expresión, de la Tabla 2. Esto significa que para la mayoría de los pacientes que probaron, nucleofection con transgenes que codifican inmune, ya sea co-estimulantes moléculas o citocinas puede ser viable. No hemos analizar la expresión de genes en nucleofected TODOS especímenes en el tiempo, ya que nuestro objetivo a largo plazo es transfect y luego utilizar estas células, como las vacunas experimentales poco después. Estudios con otras líneas de células tumorales cultivadas en nuestro laboratorio han demostrado que la expresión de los transgenes rara vez persiste más allá de 9 días, como vectores del plásmido nucleofected no integrarse en el genoma. Si bien las muestras clínicas pueden ser congelados, descongelados, cultivadas de la noche a la mañana, y luego nucleofected, la viabilidad del congelado y descongelado muestras clínicas fue baja, entre el 10-25% (no se muestra). Proponemos que las más altas tasas de nucleofection se puede esperar que se utilizan frescas las células leucémicas, y que la viabilidad a la descongelación puede no ser crítica, ya que las células se irradiados antes de su uso como vacuna. Los futuros estudios se llevarán a cabo para abordar esta cuestión. Nuestro informe también destaca que la principal nucleofection de TODOS es muy variable. Las razones de esto podría ser debido a un fenotipo que pueda ser identificado por perfiles de expresión. Sobre la base de nuestros datos in vitro puede ser la capacidad de una muestra clínica a someterse a la división celular, o incluso limitada expansión en la cultura sobre otra cultura durante el período de la noche a la mañana siguiente nucleofection puede permitir una mejor expresión de los transgenes. Así, la inclusión de factores de crecimiento o citoquinas pueden aumentar nucleofection tasas superiores a los que estamos aquí.

Conclusión

El proceso de entrega nucloefection plásmido de ADN directamente al núcleo. Aunque la entrega al núcleo está pensado para eludir la dependencia de la división celular, encontramos que los más altos niveles de antes y de expresión de los transgenes de los vectores basados en el plásmido se produjeron en rápida división celular. También pudimos demostrar que la primaria de células de leucemia linfocítica aguda (ALL) de los pacientes pediátricos también podría nucleofected con plásmido basado en vectores, lo que abrió la puerta a los pacientes específicos de la manipulación de células. A la luz de los estudios de laboratorio nos presente, la transfección de los tipos de muestras clínicas puede aumentar aún más si algún grado de división celular puede ser inducida durante el cultivo in vitro de estas muestras. Aunque la cultura de este tiempo es de menos de 24 horas, una única división de las células potencialmente podría aumentar los niveles de expresión de los transgenes, y por lo tanto la inmunogenicidad de la vacuna preparación. El trabajo futuro incluirá el análisis de la correlación entre la capacidad de ser nucleofected, marcadores de la progresión del ciclo celular, y la inducción de la progresión del ciclo celular después de los nucleofection.

Declaración de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

JG, BJ, SB y JW llevado a cabo estudios de laboratorio sobre células de las líneas establecidas. JG llevado a cabo todos los microscopía confocal. DS marcador expresión analizados en muestras clínicas y organizados los datos clínicos, NN es responsable de transfección de muestras clínicas, KB, KM, AW y fueron responsables de la atención clínica, el consentimiento del paciente, y la interpretación patológica, RO era responsable de la ejecución y el diseño del estudio.

Agradecimientos

Queremos dar las gracias a C. Elizabeth Glaser para la asistencia técnica de expertos, y el doctor James Casper y el doctor Bruce Camitta útil para los debates y el liderazgo clínico. Este trabajo fue apoyado por becas de los atletas Midwest contra el cáncer infantil, el Fondo de MACC, Inc, y por una Beca Interna de Investigación de la Sociedad Americana del Cáncer, Colegio Médico de Wisconsin Cancer Center.