Journal of Carcinogenesis, 2005; 4: 10-10 (más artículos en esta revista)

Diferencial regulación de los receptores de somatostatina 1 y 2 ARNm y la expresión de la proteína por el tamoxifeno y estradiol en células de cáncer de mama

BioMed Central
A Juan Rivera (juan.rivera @ mcgill.ca) [1], Haydar Alturaihi (haydar.alturaihi @ elf.mcgill.ca) [1], Ujendra Kumar (ujendra.kumar @ muhc.mcgill.ca) [1]
[1] Para Fraser Laboratorios de Investigación de Diabetes, Departamento de Medicina, Royal Victoria Hospital, McGill University Health Centre, Montreal, Quebec, H3A 1A1, Canadá

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen

La somatostatina (SST) la inhibición de la hipersecreción de hormona de tumores mediada por los receptores de somatostatina (SSTRs). SSTRs también desempeñan un papel importante en el control del crecimiento tumoral por medio de acciones concretas antiproliferativa. Estos receptores están bien expresadas en numerosos tejidos tumorales y normales y son susceptibles a la regulación de una serie de factores. Estradiol, un potente trófica y mitogénica de hormona en sus tejidos diana, se sabe que modulan la expresión de la TSM y sus receptores. En consecuencia, en el presente estudio, hemos determinado los efectos de tamoxifeno, un selectivo de los receptores de estrógeno (ER) modulador (SERM), y estradiol en SSTR1 y SSTR2 en la expresión del mRNA y los niveles de proteína en ER-positivos y negativos-células de cáncer de mama. Encontramos que SSTR1 se upregulated por tamoxifeno en una forma dependiente de la dosis, pero no se observó efecto con estradiol. En cambio, SSTR2 se upregulated por tanto el tamoxifeno y el estradiol. El tratamiento combinado causó la represión del SSTR1 debajo de los niveles de control, pero no tiene efecto significativo sobre SSTR2. El tratamiento con agonistas específicos SSTR1-fue significativamente más eficaz en la supresión de la proliferación celular de las células pre-tratadas con tamoxifeno. Teniendo en cuenta estos datos, nos indican que el tamoxifeno y estradiol ejercen efectos variables sobre SSTR1 y SSTR2 ARNm y la expresión de la proteína y el patrón de distribución de los receptores. Estos cambios son los subtipos específicos de células y afectar a la capacidad de SSTR agonistas de inhibir la proliferación celular.

Introducción

La somatostatina (SST) es un regulador neuropéptido producido y neuroendocrino y secretada por las células inflamatorias [1]. Inhibe las respuestas proliferativa y secretora en una serie de células objetivo. En los tumores, no sólo TSM bloques hipersecreción de hormona, pero también causa grados variables de reducción tumoral. Esto implica efecto antiproliferativo citostático (detención del crecimiento) y citotóxicos (apoptosis). El efecto biológico de TSM está mediada directamente a través de una familia de cinco específicos de alta afinidad de la proteína G-junto denomina receptores SSTR1-5. Estos receptores están presentes en la mayoría de las células tumorales y normales [2]. TSM también actúa indirectamente mediante la reducción de la síntesis y secreción de los entes locales y la promoción de factores de crecimiento sistémico. Otras acciones de SST incluyen la inhibición de la angiogénesis, la promoción de la vasoconstricción, y la modulación de la función inmune celular [1, 2].

La mayoría de los tumores sólidos, incluidos los de mama, próstata, colon, páncreas, cerebro y cáncer de hígado, expresar SSTRs niveles de la variable y, por consiguiente, son susceptibles de tratamiento con análogos de TSM [1 - 3]. El anti-proliferativa efectos de la SST y su análogo octreótido (OCT) en otros tipos de cáncer de mama y se han demostrado claramente [4 - 8]. En modelos animales de cáncer de mama, el aumento de la PTU anti-neoplásicas efecto de tamoxifeno (Tam) o la castración [6]. Además, TSM análogos de causar un potente en la reducción de los niveles circulantes de la hormona del crecimiento (GH) y su mediador de la hormona IGF-1, un potente mitogen de mama y otros tipos de cáncer [9]. Los estudios clínicos, sin embargo, no han podido demostrar un beneficio clínicamente significativo de la administración de PTU, además de la terapia estándar con tamoxifeno en pacientes con cáncer de mama avanzado [10, 11]. Aunque la mayoría de los tumores en pacientes con cáncer de mama primario expresar SSTRs [12], la disminución de los niveles de expresión en los tumores más agresivos puede explicar el fracaso de los PTU con Tam en estos entornos [13]. Por lo tanto, upregulation de SSTR expresión en tumores agresivos puede ser un objetivo terapéutico deseable.

Algunos de los factores conocidos que upregulate SSTR expresión son también promotores de la proliferación celular. Esta presumiblemente obras como una forma de contrarrestar la regulación endógena [1]. En varios tejidos, la hormona sexual estradiol (E2) actúa como un potente factor mitogénico y de proliferación y se sabe también de aumentar la expresión de la TSM y sus receptores [14 - 18]. Estudios anteriores han descrito el efecto de las variables de E2 sobre SSTR-mRNA en una serie de líneas de células [14 - 18]. En células de cáncer de mama, el tratamiento con E2 causado hasta reguladas SSTR2 expresión de ARNm, mientras que los efectos de las variables Tam había dependiendo de la línea celular utilizada [14, 15]. Visser-Wisselaar et al [16] informó de la inducción de la expresión SSTR2 y SSTR3 por estrógenos en la rata trasplantable prolactina-pituitaria secretora de las células tumorales. Del mismo modo, Djordijevic et al [17] informó de la regulación positiva de SSTR2 y SSTR3 junto a la inhibición de la SSTR1-mRNA por E2 en cultivos primarios de ratas hembra pituitaria células que expresan los cinco SSTRs. En cambio, Kimura et al [18] mostraron upregulation de SSTR1, SSTR2, y SSTR3, y drásticas downregulation de SSTR5 células de la hipófisis en ratas ovariectomizadas tratadas con E2 para un mes. A partir de estos estudios, es evidente que la precisa regulación de las de los estrógenos sobre SSTRs y sus consecuencias en el control del crecimiento de células necesitan mayor aclaración. Además, el papel de Tam no se ha investigado en detalle.

Tam, un modulador de ER, inhibe potentemente el crecimiento de ER-positivo células de cáncer de mama [19]. Las células cancerosas de los tejidos no clásicamente considerados estrógeno-dependientes (por ejemplo, la tiroides, piel, páncreas, hígado, neuroglia y meninges) también muestran un inhibidor respuesta proliferativa a Tam [20 - 24]. Algunas de las propiedades inhibidoras de crecimiento de Tam están relacionados con su capacidad de modificar la expresión del crecimiento de las células reguladoras. Una de esas regulador, factor de crecimiento transformante β1 (TGF-β1), un inhibidor de la proliferación celular, es upregulated por Tam, en tanto ER-ER-positivos y negativos células [23, 25]. En cambio, Tam reduce los niveles circulantes de IGF-1 [26] e interfiere con la IGF-1 en la vía de señalización del receptor de células de cáncer de mama mediante la reducción de su fosforilación y por la inhibición de la inducción de su sustrato IRS-1 [27, 28].

Se ha demostrado que previamente SSTR1 y SSTR2 son altamente expresado en células de cáncer de mama [29], y ejercen un papel inhibitorio sobre la proliferación de las células tumorales y la migración [30 - 35]. En consecuencia, en el presente estudio, se compara el efecto de Tam y E2, solos o en combinación, en SSTR1 expresiones y 2 en células de cáncer de mama en el mRNA y los niveles de proteína. Nos informan de que Tam y E2 exhibió efectos contrastantes sobre SSTR1 ER-positivo en las células. Sin embargo, sus acciones en SSTR2 expresión en las células ER-negativos fueron similares. Asimismo, discutir nuestras conclusiones en términos de los posibles implicaciones clínicas de estas interacciones.

Materiales y métodos
Reactivos

Todas las células de la cultura se obtuvieron de ATCC. Tamoxifen, Estradiol y 3 - (4, 5-dimethylthiazolyl-2) -2, 5-bromuro diphenyltetrazolium (MTT) fueron adquiridos de SIGMA (Sigma-Aldrich Canadá Ltd). Anti conejo isotiocianato de fluoresceína (FITC) conjugados con anticuerpos secundarios se obtuvieron del Laboratorio Jackson. Medio de cultivo celular fue de Invitrogen y FBS se adquirió de Wisent, Canadá. Todos los demás reactivos fueron adquiridos de los diferentes proveedores, como se indica.

Líneas celulares

ZR-75-1 y T47D células se mantuvieron en Medio RPMI 1640 (Gibco BRL) en condiciones normales (humidificado atmósfera, a 37 ° C, con 5% de CO 2). MDA-MB-231 células se mantuvieron en Leibovitz L-15 del medio a 37 ° C. Cultura de los medios de comunicación se complementaron con 10% de suero fetal bovino (SFB) y el nivel de tratamientos antifúngicos. Cultura de los medios de comunicación se sustituyeron las 24 horas anteriores al tratamiento con rojo fenol libre de los medios de comunicación complementado con un 10% de dextrano revestida de carbón tratado con FBS. Se realizaron experimentos sobre células pasajes entre 4 a 8.

Célula de Tratamiento

En confluency ~ 70%, las células fueron tratadas con un aumento de la concentración (10 -10 M, M 10 -8 y 10 -6 M), de Tam y β-estradiol (E2), sola o en combinación. Tiempo curso experimentos (6, 12, 24, 48, y 96 h) mostró que los cambios en los niveles de mRNA ya máxima a las 24 horas y sostenida después. Así, un 24-36 h el tiempo de exposición fue utilizado para estos experimentos. Con el fin de determinar la expresión de SSTR1 y SSTR2 por inmunocitoquímica, las células fueron tratadas con 10 -6 M, de los correspondientes compuestos de 30-36 h. La proliferación de las células para los experimentos, las células fueron expuestas a Tam, E2, ambos o ninguno durante 30 h. 0,5 μ M de la nonpeptide SSTR1-agonista específico L-797, 591 [36] o vehículo se añadió a la media, y la tasa de proliferación se evaluaron después de 42 h.

RT-PCR

ARN total fue extraído mediante el reactivo TRIzol (Invitrogen), de acuerdo con las instrucciones del fabricante. Potencial de la contaminación de ADN genómico fue degradado por incubación con RQ1 ribonucleasas libre desoxirribonucleasa (Promega Corp) durante 30 minutos a 37 ° C en presencia de inhibidores de RNAse (Invitrogen). 10 μ g de ARN total fue transcrita inversa (RT) a través de M-MLV-transcriptasa inversa (tecnologías de la Vida Inc), y luego amplificado utilizando primers específicos para SSTR1, SSTR2 y β-actina como control interno. Primers utilizados fueron los siguientes:

SSTR1 adelante-5 'TATCTGCCTGTGCTACGTGC 3' (nt 714-733)

SSTR1 inversa-5 'GATGACCGACAGCTGACTCA 3' (nt 911-930)

SSTR2 adelante-5 'ATCTGGGGCTTGGTACACAG 3' (nt 600-619)

SSTR2-invertir 5 'CTTCTTCCTCTTAGAGGAGC 3' (nt 728-747)

Β-actina de avance 5 'ATCATGAA GTGTGACGTGGAC 3' (nt 885-905)

Β-actina-invertir 5 'AACCGACTGCTGTCA CCTTCA 3' (nt 1325-1345)

Para la amplificación de PCR 4 μ l de productos RT (cDNA) se mezclaron en 100 μ l de volumen total de PCR-buffer (Invitrogen), que contiene 2% DMSO, 2,25 mM MgCl 2, 50 μ M de cada dNTP, 15 pmol de primers SSTR-, y 3 Pmol de β-actina primers.

Después de desnaturalización inicial a 94 ° C durante 10 min, Taq ADN polimerasa (Invitrogen) (2,5 U / reacción) se añadió, y las muestras fueron sometidas a 38 ciclos de desnaturalización a 94 ° C durante 1 min, recocido a 58 ° C durante 45 segundos , Y la extensión a 72 ° C durante 45 segundos, seguido por 10 min de extensión final a 72 ° C. 20 μ l de los productos de PCR fueron fraccionadas por electroforesis en geles de agarosa al 1,5% que contiene bromuro de etidio y visualizados a la luz ultravioleta. La especificidad de los productos amplificados SSTR y las correspondientes bandas observadas fueron confirmados por Southern blot utilizando hibridación específicas P-32-dCTP azar-primer etiquetados SSTR ADNc. AlphaEaseFC (Alpha Innotech Corporation, San Leandro, CA) se utiliza para la densidad óptica (DO) las mediciones del producto. OD objetivo de la banda se corrige con las correspondientes β-actina-banda (OD ratio) y luego normalizó en contra de la OD proporción de las células no tratadas (OD índice).

La inmunocitoquímica

Expresión de SSTRs en ZR-75-1, T47D y MDA-MB-231 se determinaron por inmunocitoquímica, utilizando anticuerpos policlonales de conejo para hSSTR1 y hSSTR2, diluido a lo descrito previamente [37, 38]. En pocas palabras, las células se cultivaron en placas de 24 y 60% a confluency, y luego tratados con Tam o E2, solos o en combinaciones. Las células fueron fijadas con paraformaldehído al 4% y se incubaron durante la noche a 4 ° C con anticuerpos primarios diluido (1:300) en PBS. Después de tres lavados posteriores en la cadena PBS, las células fueron incubadas a temperatura ambiente durante 1 h FITC-conjugado con anticuerpos secundarios (de cabra anti-conejo IgG). La especificidad de la inmunofluorescencia se determinó en ausencia de anticuerpos específicos hSSTR.

La proliferación de las células de ensayo

La proliferación celular se evaluó 72 horas después del tratamiento por el método MTT. Las células fueron sembradas en el 1000 células / pozo en placas de 96 pozos con 100 μ l de nivel medio. Los tratamientos se inició, como se ha descrito anteriormente, 24 h más tarde. Al final del período de tratamiento, 25 μ l de solución MTT, 5 mg / ml en PBS se añadió a cada pocillo. Después de 2 h de incubación a 37 ° C, 100 μ l de solución (50% dimetil-formamida, el 50% de H 2 O, 20% SDS, pH 4.7) se agregó a cada pozo y las células fueron incubadas por un período adicional de 20 h para solubilizar la Cristalizado Dye. Densidades ópticas de las soluciones, en cada pozo, se determinaron por espectrofotómetro.

Análisis Estadístico

Los resultados se expresan como medias ± SE. Significación estadística se determinó a través de la unpaired Student's t test.

Resultados
Efectos del Tamoxifen y Estradiol sobre SSTR1 y SSTR2 mRNA y de proteínas Expresión en ZR-75-1 Células

Con el fin de evaluar los efectos de Tam y E2 sobre SSTR1 y SSTR2 expresión, primero dependiente de la dosis determina cambios en la expresión mRNA. En el ER-positivo línea celular de cáncer de mama ZR-75-1, Tam tratamiento resultó en un aumento significativo de SSTR1-ARNm, de hasta 2,2 veces en comparación con las células no tratadas, en altas concentraciones (10 nM y 1 μ M) (Fig. 1A]. En contraste, el tratamiento disminuyó significativamente E2-SSTR1 expresión mRNA de> 25%. El tratamiento con ambos Tam E2 y dio lugar a una nueva disminución en los niveles de mRNA SSTR1. Por el contrario, tanto el aumento de E2 y Tam SSTR2 expresión mRNA. Sin embargo, el efecto fue más fuerte de Tam (4,5 veces más en el 1 μ M), además de ser dependiente de la dosis (Figura 1B]. En este caso, el tratamiento simultáneo con Tam y E2 no tiene efecto significativo sobre SSTR2 expresión mRNA, en comparación con el control (Figura 1B].

Hemos ampliado aún más nuestro estudio y se decidió la distribución de celulares SSTR1 y SSTR2 por inmunofluorescencia indirecta utilizando SSTR1-y SSTR2 anticuerpos específicos. Como se muestra en la Fig. 2, en la ZR-75-1 células, los cambios observados después de un 30-36 h de tratamiento eran comparables a los cambios descritos en el ARNm. En el control de las células, SSTR1 y SSTR2 inmunoreactividad había desigual distribución de la superficie de la célula. Tras Tam tratamiento, SSTR1 y SSTR2 inmunoreactividad aumentado significativamente y los receptores se expresó de manera más uniforme en la superficie de la célula (Fig. 2B y 2F]. El tratamiento con E2 solo o en combinación con Tam dado lugar a la expresión, ya sea disminuido o no cambios significativos en SSTR1-y SSTR2-como inmunoreactividad en todos los puntos del tiempo (Fig. 2C, D, G y 2H].

Efectos del Tamoxifen y Estradiol sobre SSTR1 y SSTR2 mRNA y Expresión de proteínas en células de T47D

Para evaluar si estos efectos fueron similares en otras ER-positivo líneas celulares, se estudiaron las células T47D. En virtud de los estrógenos sin condiciones, no tratados T47D células expresan ARNm para ambos SSTR1 y SSTR2 (Fig. 3A y 3B]. SSTR1 mRNA mostraron una respuesta bifásica a Tam tratamiento, con ligero descenso, con 0,1 nM Tam tiempo que aumenta hasta en un 300% con ~ 1 μ M (Fig. 3A]. En cambio, en E2 regulada SSTR1 ARNm. El tratamiento combinado causó una mayor disminución en los niveles de mRNA SSTR1 en comparación con las células tratadas con E2. En comparación, SSTR2-mRNA en el aumento de las células T47D con Tam o E2. Sin embargo, el tratamiento combinado no cambió de forma significativa SSTR2 expresión mRNA en comparación con el control de las células (Fig. 3B]. Con el fin de examinar la distribución de celulares SSTR1 y 2 en respuesta a Tam y E2, solos o en combinación, en la expresión del receptor a nivel de proteínas, las células T47D también fueron estudiados por inmunofluorescencia indirecta. En el control de las células (Fig. 4], ambos receptores se expresan como proteínas de membrana. SSTR1 y 2, inmunoreactividad disminuido en células T47D a 30-36 h de tratamiento con cualquiera de las dos Tam o E2, solos o en combinación. Además, un patrón puntiforme de los receptores de inmunoreactividad se detectó en todas las células tratadas (Fig. 4].

Efectos del Tamoxifen y Estradiol sobre SSTR1 y SSTR2 Expresión en MDA-MB-231 Breast Cancer Cells

Seguidamente, examinó los efectos de Tam y E2 en α ER-negativos células de cáncer de mama MDA-MB-231. En condiciones de base, las células parecían expresar una baja cantidad de mRNA SSTR1-en comparación con SSTR2 (Fig. 5]. Tam tratamiento aumentó significativamente SSTR1-mRNA en una concentración de 10 nM (Fig. 5A]. El aumento observado en SSTR2 con Tam fue modesto y no alcanzó significación estadística (Fig. 5B]. Cambios similares se produjeron cuando las células fueron tratadas con E2: ambos SSTR1 y SSTR2-mRNA se upregulated; sin embargo, en este caso, el efecto es más fuerte en SSTR2. El tratamiento combinado dio lugar a una tendencia a la baja regulación de mRNA SSTR1-mientras que no hubo variación significativa en SSTR2-mRNA en comparación con el control.

Del mismo modo, muy suave SSTR1 y SSTR2 se observó inmunoreactividad en MDA-MB-231 células bajo condiciones basales (Fig. 6]. La distribución siguió un patrón puntiforme difusa para ambos receptores. SSTR1 y SSTR2 se upregulated Tam después de tratamiento mientras que también se SSTR2 inmunoreactividad upregulated por E2. El tratamiento combinado también se asoció con aumentos modestos en SSTR1 y SSTR2 inmunoreactividad.

SSTR1 selectivo Agonist Acelera el Tamoxifen-inducida por inhibición de la ZR-75-1 proliferación de células

Como se ilustra en la Fig. 7, la SSTR1-agonista específico potenció el efecto antiproliferativo de Tam en ZR-75-1 células. Las células fueron pretratadas con Tam y E2, solos o en combinación, durante 30 h, y luego expuestos a SSTR1-agonista selectivo para 42 h. Tras el tratamiento con Tam sola, una importante reducción en la proliferación celular se observó en el ER-positivo células de cáncer de mama. Combinar SSTR1-agonista específico con Tam más reprimida proliferación en comparación con Tam solo. Cabe señalar que el tratamiento con agonistas SSTR1 por sí solo no tiene efecto significativo sobre la proliferación celular. Curiosamente, cuando ambos Tam y E2 se dieron simultáneamente seguida por SSTR1 agonista, hubo una leve pero significativa disminución de la tasa de proliferación celular. Además, en T47D y MDA-MB-231 células, el tratamiento previo con Tam seguido por SSTR1-agonista específico traducido en leves, pero no significativa, la inhibición de la proliferación adicionales en comparación con Tam sola (datos no presentados).

Discusión

En el presente estudio, que demuestran los papeles de Tam y E2 sobre SSTR1 y SSTR2 ARNm y la expresión de la proteína en ER-ER-positivos y negativos células. Este es el primer estudio que analiza sistemáticamente no sólo la regulación de los SSTR por E2 y Tam, en células de cáncer de mama, tanto en el mRNA y los niveles de proteína, pero también demuestra cómo esto se traduce en cambios en el control de la proliferación de las células del cáncer con análogos de la somatostatina. Nuestra primera observación fue el contraste de los efectos de E2 y Tam sobre SSTR1 ER-positivo en las células. Un efecto inhibidor de E2 sobre SSTR1-mRNA se ha informado anteriormente en ratas células de la hipófisis anterior [17]. SSTR1 ha demostrado inhibir la proliferación celular y la migración de las células tumorales [30 - 33]. Por lo tanto, lo más probable es que su baja regulación por E2 desempeña un papel en el efecto proliferativo de E2 en tejidos susceptibles. Asimismo, observó la sobre regulación de SSTR1 por Tam puede representar un importante mecanismo por el cual Tam ejerce un efecto inhibitorio sobre la progresión tumoral. En CCL39 fibroblastos humanos expresando SSTR1, TSM inhibe la activación de Rho (un regulador clave de la actina basada citoesqueleto celular), con lo que la inhibición de la reunión de coordinadores de adherencias y de las fibras de actina estrés, y alterar la migración celular [30]. Este efecto no se observó en células que expresan sólo SSTR2. Además, las células que expresan SSTR1-de-GH y PRL-adenomas secretores de cáncer medular de tiroides y exhibió la inhibición de la secreción de la hormona, además de la reducción de la viabilidad celular en respuesta a SSTR1-agonistas específicos [31, 32].

SSTR2 ARNm sobre regulación y por tanto Tam E2 está de acuerdo con estudios previos en células T47D pero difiere de lo que se ha demostrado previamente en ZR-75-1 y MDA-MB-231 células [14, 15]. Xu et al [14] observaron ningún efecto de E2 en MDA-MB-231 células, mientras que encontramos que estas células respondieron a nanomolar concentraciones de Tam y E2 con upregulation de SSTR1 y SSTR2 ARNm. Esta discrepancia puede explicarse por los diferentes métodos utilizados: nucleasa protección de ensayo por Xu et al, y RT-PCR por nosotros, siendo este último más sensible a pequeños cambios. Por otra parte, Xu et al mostraron en ZR-75-1 que las células sólo E2 causado SSTR2 upregulation Tam mientras que se opusieron a este efecto. Se ha demostrado que la exposición a E2 puede aumentar ER β expresión mRNA en células de cáncer de mama [39], por el contrario, E2 privación prolongada puede inducir a la pérdida de expresión de ER en algunas líneas celulares de cáncer de mama [40]. Por lo tanto, especular que las diferencias en el E2 período libre de tratamiento previo (48 h en Xu et al vs 24 h en nuestros experimentos) podría haber alterado ER expresión en el momento del tratamiento. Además, el uso de Tam en nuestros experimentos vs el metabolito activo OH-tamoxifeno (un producto del metabolismo hepático de Tam en vivo) en el experimento de Xu et al pueden ser responsables de estas diferencias.

Dado el hecho de que en el ER-negativos células α, E2 y Tam muestran efectos similares, nuestros datos demuestran que el upregulation de SSTR2 mRNA por ER-agonistas es, al menos en parte, independiente de ER α. Contrariamente a las creencias anteriores, la clásica ER-negativo línea celular de cáncer de mama MDA-MB-231 expresa bajos niveles de ER β, pero no ER α [39]. Kimura et al [41] han demostrado recientemente estrógeno secuencias sensibles en la región promotora del gen SSTR2. Se requieren estudios adicionales para delimitar la exacta mecanismos moleculares involucrados. Habida cuenta de que la afinidad de Tam de la ER es menor que la de su metabolito OH-tamoxifeno o E2 [42], no es de extrañar que el tratamiento simultáneo con equimolar concentraciones de E2 y Tam dado lugar a baja regulación de SSTR1 como se ha visto cuando E2 Es administrado solo. Es notable, sin embargo, que el efecto fue mayor con el tratamiento combinado y que, en el caso de SSTR2, la combinación de E2 y Tam tratamiento como resultado la pérdida de la upregulatory efecto de los compuestos, ya sea por sí solo. Estos efectos probablemente por la interacción entre las exigencias ambientales y sus coregulators, y puede incluir E2 upregulation ER β de expresión y de la inducción de la formación de α ER / ER β heterodimers con disminución de la actividad transcripcional [43, 44].

De interés, que hemos detectado sorprendentes cambios en el patrón de distribución subcelular de los receptores como consecuencia de los tratamientos utilizados. En el fondo, Tam cambiado el patrón de expresión de SSTR1 y SSTR2 en ZR-75-1 irregular de las células a una más homogénea la distribución de la superficie celular. Por el contrario, tanto Tam E2 y alterado la distribución homogénea de los receptores en las células T47D a una más desigual distribución irregular. Estos cambios en la inmunoreactividad SSTR1 y SSTR2 puede implicar receptor homo-o heterodimerization, compleja disociación del receptor y / o internalización [45, 46]. Estos podrían ser un efecto específico de ER activación o el resultado de los cambios en la fluidez y / o composición de la membrana celular. La capacidad de Tam afectar a la estabilidad de la membrana por la disminución de su fluidez se ha mostrado anteriormente. Hay informes de la disminución de la síntesis de Tam glycosphingolipids mediante el bloqueo de la síntesis de sus precursores, glycosylceramide, causando acumulación intracelular de ceramida y la perturbación de membrana [47].

En resumen, nuestros datos muestran que la expresión SSTR1 y SSTR2 en células de cáncer de mama es modulada por Tam y E2 en una celda de manera específica. SSTR1 expresión es upregulated por Tam mientras E2 y tratamiento combinado preferentemente downregulate este receptor en las células ER-positivo. ER-α en las células negativas, tanto ligandos causado upregulation de SSTR1. Los cambios en la distribución subcelular de SSTR1 y SSTR2 fueron favorables, en sólo uno de los ER-positivos líneas celulares investigadas (ZR-75-1). Estas células también mostraron un fuerte crecimiento inhibitoria respuesta a SSTR1-agonista siguientes pretratamiento con Tam. Por lo tanto, SSTR1 activación parece ser un mecanismo potencialmente importante para el control del crecimiento de células tumorales. Por esta razón, el aumento de SSTR expresión en las células tumorales puede hacerlos más susceptibles a la inhibición del crecimiento por SSTR agonistas, en particular SSTR1 agonistas, como el tratamiento anti-neoplásicas. Nuestro estudio sugiere que los SERMs como Tam pueden tener tales efectos. Estos resultados tienen importantes implicaciones en nuestra comprensión de la función de SSTRs ER en la capacidad de respuesta del cáncer de mama. Por otra parte, tal vez no sea prematuro anticipar que, en base a nuestros resultados, algunos pacientes con cáncer de mama pueden beneficiarse de SSTR1-agonista selectivo de la terapia en combinación con Tam, en un medio de estrógeno-agotado.

Abreviaturas

E2, estradiol; ER, receptor de estrógeno; FBS, suero bovino fetal; GH, la hormona de crecimiento, IGF-1, factor de crecimiento tipo insulina 1; IRS, la insulina sensible sustrato 1; ARNm, el ácido ribonucleico mensajero; MTT, 3 - (4 ,5-Dimethlthiazolyl-2) -2, 5-diphenyltetrazolium bromuro; RT-PCR, la transcriptasa inversa de la reacción en cadena de polimerasa; SERM, modulador selectivo del receptor de estrógenos; TSM, la somatostatina; SSTR, TSM receptor; Tam, el tamoxifeno; TGF, factor de crecimiento transformante ; OD, densidad óptica.

Agradecimientos

Este trabajo fue apoyado por becas de los Institutos Canadienses de Investigación en Salud # RP-6196 y RP-10411 (Reino Unido). Damos las gracias al Dr SP Rohrer y el doctor JM Schaeffer (Merck Research Laboratories, Rahway, NJ) para el tipo de regalo SSTR1 agonista selectivo, Maria Correia de secretaría para ayudar a Heather y Watt para la lectura crítica de este manuscrito. JA Rivera fue apoyado por una beca postdoctoral CIHR y McGill University Health Centre Instituto de Investigación.