PLoS Genetics, 2005; 1(4): (más artículos en esta revista)

Citoesqueleto reordenamientos en fibroblastos sinoviales como nuevo modelo fisiopatológico determinante de la artritis reumatoide

Biblioteca Pública de la Ciencia
Vassilis Aidinis [1], Piero Carninci [2], Maria Armaka [1], Walter Witke [3], Vaggelis Harokopos [1], Norman Pavelka [4], Dirk Koczan [5], Christos Argyropoulos [6], Maung - Maung Thwin [7], Steffen Möller [5], Waki Kazunori [2], Ponnampalam Gopalakrishnakone [7], Paola Ricciardi-Castagnoli [4], Hans-Jürgen Thiesen [5], Yoshihide Hayashizaki [2], de George Kollias [1 ]
[1] Instituto de Inmunología, Alexander Fleming Centro de Investigación en Ciencias Biomédicas, Atenas, Grecia
[2] RIKEN Genomic Sciences Center, Yokohama, Japón
[3] Programa de Biología Mouse, EMBL, Monterotondo, Italia
[4] Departamento de Biotecnología y Biociencia de la Universidad de Milano-Bicocca, Milán, Italia
[5] Instituto de Inmunología de la Universidad de Rostock, Rostock, Alemania
[6] Laboratorio de Física Médica de la Universidad de Patras, Patras, Grecia
[7] Departamento de Anatomía de la Universidad Nacional de Singapur, Singapur
Resumen

La artritis reumatoide es una enfermedad inflamatoria crónica con una alta prevalencia y de gran carga socioeconómica. A pesar de intensos esfuerzos de investigación, su etiología y patogenia siguen siendo poco conocidos. Para identificar nuevos genes y / o de las vías celulares implicados en la patogénesis de la enfermedad, se utilizó un bien reconocido factor de necrosis tumoral-impulsada modelo animal de esta enfermedad y se lleva a cabo de alto rendimiento de perfiles de expresión con las bibliotecas y sustractivo cDNA microarray oligonucleótido hibridaciones, junto Independiente con el análisis estadístico. Este doble enfoque fue validado por una serie de diferentes métodos en otros modelos animales de artritis, así como en muestras de pacientes humanos, por lo tanto, la creación de una única lista de los modificadores de la enfermedad potencial valor terapéutico. Es importante destacar que, a través de la integración y de análisis de ligamiento genético y Gene Ontología asistida funcional descubrimiento, identificamos las gelsolin impulsado por fibroblastos sinoviales citoesqueleto reordenamientos como nuevo determinante fisiopatológica de la enfermedad.

Introducción

La artritis reumatoide (AR) es una artropatía destructiva crónica con una prevalencia de 1-3% y sustancial de personal, social, y los costos económicos. Se caracteriza por la inflamación prolongada de las articulaciones, y llevarían a la destrucción del cartílago y el hueso. La inflamación es inicialmente localizado en el revestimiento sinovial, una monocapa de células sinoviales que diarthroidal líneas articulaciones. En la AR, el revestimiento sinovial se vuelve notablemente engrosada debido a la proliferación de las células sinoviales y la infiltración de células inflamatorias. Esta masa proliferativa, el pannus, invade y destruye el cartílago articular y del hueso, dando lugar a la destrucción irreversible de la estructura y función del conjunto [1]. Actualidad terapias de la AR se basan principalmente en el tratamiento sintomático con AINES y / o con el modificador de la enfermedad, los fármacos antirreumáticos. Sin embargo, incluso los mejores tratamientos disponibles (como la orientación factor de necrosis tumoral [TNF] TNF y señalización) no curan la enfermedad y ni siquiera lo suficientemente retardar la progresión en la mayoría de los pacientes, mientras que a menudo se presentan efectos secundarios adversos [2] .

A pesar de intensos esfuerzos, la etiología y la patogénesis de la AR siguen siendo poco conocidos. Paradigmas tradicionales de investigación para la AR han implicado una serie de mecanismos que contribuyen a la iniciación y perpetuación de la inflamación sinovial, incluidos los autoanticuerpos y complejos inmunes, mediada por células T antígeno-específicos respuestas, la persistencia de las redes de citoquinas y otras moléculas proinflamatorias, el sesgo y el sexo genético Predisposición, y tumorales-como comportamiento de la artritis sinovial [3]. Los modelos animales de la artritis reumatoide comparten muchas características clínicas con las enfermedades humanas y, por lo tanto, constituyen herramientas valiosas en descifrar los mecanismos patogénicos que rigen la activación de la enfermedad y la perpetuación [4]. Entre ellas, el TNF-transgénicos (TNF-Tg) ratón [5] ha sido fundamental para demostrar el papel del TNF en el desarrollo de la enfermedad y anunció la introducción y éxito de las terapias anti-TNF, que convirtió la gestión eficaz de la enfermedad [6]. En este modelo, crónica sobreexpresión de TNF humano resulta en una crónica, erosiva, poliartritis simétrica, con un 100% de penetrancia fenotípica, el tiempo de aparición de la enfermedad, y el progresivo histológico síntomas que se asemejan humanos RA [5 - 7].

Para adquirir más conocimientos sobre la fisiopatología de la enfermedad y para descubrir los genes y / o de los involucrados en su patogenia, hemos utilizado el TNF-Tg modelo animal de la AR en gran escala de perfiles de expresión con las dos bibliotecas y sustractivo oligonucleótido microarrays hibridaciones. Expresión diferencial fue validado por una serie de métodos, en ambos ratón y muestras de pacientes humanos, por lo tanto, la creación de una única base de datos de posibles modificadores de la enfermedad y dianas terapéuticas. Además, en un intento de descubrir desregulado funciones celulares basados en anotaciones funcional de los genes desregulados, identificamos las gelsolin impulsado por fibroblastos sinoviales reorganización del citoesqueleto como un factor determinante fisiopatológica de la enfermedad.

Resultados

Para descubrir los genes y las vías celulares que participan en la patogénesis de la AR en gran escala, hemos utilizado un doble enfoque de alto rendimiento, con dos metodologías totalmente diferentes se rige por diferentes limitaciones y analizados por diferentes estadísticas. Total RNA de muestras se extrajeron de todo el conjunto (WJ) y fibroblastos sinoviales (SF) ex vivo culturas aisladas del 6-Semana de edad, los ratones con AR (Tg197, hTNF + / -; índice de la gravedad de la enfermedad 3; [5]] y de sus Normales (wild type [WT]) littermates. Cada una de las muestras (de un total de cuatro: RA SF, SF WT, RA WJ, y WT WJ), que consiste en equimolar cantidades de ARN agrupados de cuatro (dos hombres y dos mujeres), ratones (16 ratones en total), en cierta medida, el logro de la igualdad de la diversidad biológica. Biológica repeticiones (de diferentes extracciones independientes ratones, que emplean protocolos de extracción de la misma y la puesta en común de estrategia) utilizadas tanto para la creación de bibliotecas de cDNA de sustracción y la hibridación de microarrays de oligonucleótidos.

Subtractive cDNA Bibliotecas y en gran escala de Secuenciación

Cuatro diferentes de longitud completa bibliotecas de cDNA (AR SF, SF WT, RA WJ, y WJ WT) se normalizaron y resta unos a otros, como se indica en la figura S1 A. Debido al diseño experimental, la consiguiente resta bibliotecas (L0, L1, L2, y L7), que figura ADNc de la biblioteca de cDNA de pruebas y, por lo tanto, sólo constituía hasta bibliotecas de genes regulados en las correspondientes pruebas de la biblioteca (o de abajo-genes regulados en el Controlador de la biblioteca). A partir de la sustracción bibliotecas, 27511 9176 racimos / genes, que se resumen en la figura S1 B. Cada gen fue anotado a través de búsquedas de homología de BLAST en Unigene, FANTOM, SWISSPROT y bases de datos.

En resumen, entre los genes que se encuentran 9176, 7977 corresponden a genes conocidos, mientras que las secuencias de 1199 no había informado previamente. Cada gen está representado por un número diferente de los clones en casi todas las bibliotecas, directamente proporcional a la resta eficiencia y transcripción abundancia. La distribución relativa de cada gen en cada biblioteca es la verdadera medida de la expresión diferencial, que puede ser oscurecida por errores de muestreo que surgen por casualidad cuando se seleccionan los clones. Por lo tanto, con el fin de identificar los genes expresados diferencialmente realmente, un valor de probabilidad (R) se asignó a cada gen de comparaciones pairwise de la relativa bibliotecas (SF/L0L1 y WJ/L2L7). La significación estadística, se calcularon luego los umbrales (Figura S2], y dos niveles de significación fueron seleccionados (que se resumen en la Tabla 1): un muy alto (99,99%, p ≤ 0,0001) que informe los resultados por separado, y uno más bajo (99% , P ≤ 0,01) para la comparación con los correspondientes resultados de los microarrays de ADN hibridaciones. Conocido (Unigene por un grupo ID) genes expresados diferencialmente en el 99,99% nivel de significación se presentan en la Tabla S1.

Oligonucleótido microarrays hibridaciones

Fluorescently etiquetados cRNA sondas hechos de similares (repeticiones biológica, véase más arriba) las muestras de RNA total (RA SF, SF WT, RA WJ, y WJ WT) se utilizaron en doble ejemplar en la hibridación de la Affymetrix Mu11K oligonucleótidos de ADN chipset (ocho chipsets, 16 fichas Total). Además, similares muestras (equimolar cantidades de ARN agrupados de cuatro-dos hombres y dos mujeres-6-Semana de edad, los ratones artríticos; índice de severidad 3) del total de ARN (de SF y WJ) de otro modelo animal de artritis (espontáneo, golpee - En, TNF Δ SON + / -) [8] se utilizaron para chip hibridaciones adicionales (cuatro chipsets, ocho chips total). El MIAME compatible [9] microarrays de datos (véase el ArrayExpress base de datos [10], el número de E-MEXP-255) se normalizaron y analizados como se indica en la Figura S3 y describen en detalle en Materiales y Métodos y Figura S4. Genes expresados diferencialmente (DEGs) fueron seleccionados, utilizando una muestra específica de tapa modelo de cambio (FCM) [11] en diferentes niveles de significación (90%, p ≤ 0,1, y el 95%, p ≤ 0.05), donde se han seleccionado DEGs siempre una - El cambio observado veces más alto que el esperado cambio de tapa. Los resultados de ambos modelos animales se resumen en la Tabla 2. Ejemplo de DEGs específicos comunes a los dos modelos animales (importancia: 95%, p ≤ 0,05) se presentan en la Tabla S2.

Cruz-Plataforma Comparación y Validación

Ambos análisis de la expresión diferencial de los métodos presentados anteriormente elaborado listas de desregulación de los genes de alta significación estadística. Para validar los resultados por separado, y para evitar la realización de numerosas RT-PCR, la expresión diferencial de ambas plataformas resultados de los análisis fueron comparados entre sí por el mismo modelo animal (Tg197, hTNF + / -), el tipo de muestra (WJ, SF), y Desregulado expresión de la dirección (arriba o abajo). La comparación, en los niveles de significación del 99% para las bibliotecas y el 90% de los microarrays (seleccionados en base a la producción de genes similares números), se realizó a través de la base de datos NetAffx ( Http://www.affymetrix.com ). Aunque algunos ejemplos de perfiles de expresión de múltiples plataformas superposiciones se han comunicado [12, 13], en este estudio de 46 genes (15 de SF, 31 para WJ) son comúnmente predecirse como hasta-o abajo-regulada por ambos métodos (p combinado -- Valor de 0,001) (Tabla 3].

Para verificar la validez de la doble enfoque de alto rendimiento y para demostrar que informó de la lista de genes es libre validado, varios de los genes que predijo desregulado se confirmaron con diferentes métodos. De perfiles de expresión en el knock-en el modelo de enfermedad (TNF Δ SON + / -) confirmó el 40 de genes (Tabla 3]. Automatizado de la literatura minera texto (Biolab Experimento Auxiliar, BIOVISTA, Grecia) identificó 20 de los genes previamente asociados con la AR (Figura S5; resumen en la Tabla 3]. Además, el 11 de representante genes (SF: Gsn, Aqp1, mglap, cdc42 hom, y Hp; WJ: Marco, Hp, CD14, Mb, Bsg, Ptgis) fueron confirmados por semi-cuantitativos (SQ) RT-PCR (Figura S6 A-S6 C; resumen en la Tabla 3]. Todos SQ-RT-PCR se realizaron en el rango lineal de la reacción (en tres diferentes concentraciones normalizado de limpieza contra los genes) en repeticiones biológica (diferentes extracciones independientes de ratones, que emplean protocolos de extracción de la misma estrategia y la puesta en común) de las muestras utilizadas para ambos Las bibliotecas y la sustracción microarrays hibridaciones. Representante genes fueron seleccionados sobre la base de (1) muestra las diferentes fuentes (seis de WJs y cinco de FE), (2) y dirección diferente grado de expresión desregulado (seis hasta reguladas y cinco abajo-regulados), y (3) Interés biológico y potencial de seguimiento. Además, dos de ellos (SF: Gsn, Aqp1) también fueron confirmados por tiempo real de RT-PCR (Figura S6 D; resumen en la Tabla 3].

En un intento de combinar el análisis de la expresión génica con el análisis de ligamiento genético, todos los genes expresados diferencialmente fueron asignadas a los cromosomas, junto con el conocido rasgo cuantitativo loci (QTL, regiones cromosómicas / segregar a los genes con un rasgo cuantitativo) inducida por un modelo animal de artritis, La artritis inducida por colágeno (CIA) [14]. Representada gráficamente en la Figura 1 (y que se resumen en la Tabla 3], ocho genes asignada a la CIA QTL (WJ: Ctss, Pitpnm, Ncf1, Psmb8, y Siat8e, SF: Rab14, Aqp1, y Gsn).

La expresión nivel de siete de los genes que se encuentran en el liberalizado ratones artríticos y confirmada por RT-PCR en muestras de ratón, fue examinado también en humanos de los pacientes con RNA de muestras en tiempo real el análisis RT-PCR. Debido a la falta de normalidad (WT) sinovial muestras humanos, comparamos la expresión RA, de 19 muestras con ocho muestras de los controles de la osteoartritis, una estrategia de consenso para el análisis de la expresión diferencial en la artritis [15, 16]. Como se muestra en la Figura 2 y que se resumen en la Tabla 3, la expresión desregulada de seis (de un total de siete ensayados), de los genes en los seres humanos fue confirmado como así, cuatro de ellas con alta significación estadística (Gsn, Aqp1, Bsg, y Mb), por lo tanto, Se prorroga la vigencia y utilidad del modelo de ratón generados desregulado gen a la lista de las enfermedades humanas.

Artríticas fibroblastos sinoviales tienen una reordenará citoesqueleto

El doble de alto rendimiento de perfiles de expresión enfoque descrito anteriormente dado un gran número de enfermedades implicados, desregulado genes de alta significación estadística. Además, a (1) demostrar la validez y la utilidad de ampliar el análisis de datos de expresión aún más, (2) desregulado inferir las funciones biológicas de los datos de expresión génica, y (3) definir criterios funcionales para la selección de genes más, el seleccionado genes fueron Anotado en la forma de la Ontología de Genes (GO) [17] término "proceso biológico". GO plazo frecuencias de la lista de genes seleccionados se calculó entonces, y su significación estadística se estimó. Como se muestra en la Tabla S3, predijo desregulado en funciones FE incluyen, como se esperaba, colágeno catabolismo, la activación de complemento, y la respuesta inmune y el estrés. Curiosamente, cinco de los 26 significativamente (p <0,01) desregulado GO funciones afectadas (directa o indirectamente) citoesqueleto de actina, lo que sugiere que tiene una FE de artritis reordenará citoesqueleto de actina. Con el fin de confirmar la predicción, F-actina se visualizan in vitro sobre artríticos, así como WT FE (primaria y inmortalizada) en ratones. Como se desprende de la Figura 3 A, artríticos FE exposición pronunciada fibras de estrés, por lo tanto, la validación de la in silico, de expresión basada en hipótesis.

El estrés dentro de las fibras fibroblastos les permiten ejercer tensión en la matriz extracelular (ECM) en torno a ellos-un proceso esencial en la cicatrización de heridas. Es bien entendido que las diferencias en el citoesqueleto de actina reflejar alterado ECM embargo propiedades y / o viceversa. De hecho, se han mostrado los artríticos FE a que se adhieran a las diferentes proteínas de la ECM (fibronectina, vitronectin, laminina, y colágeno) con una mayor afinidad in vitro (Figura 3 B).

El apego a la ECM (citoesqueleto y de los correspondientes cambios), mediado principalmente a través de la participación y la agrupación de las moléculas de la integrina transmembrana, en gran definir la forma y la morfología de las células, así como su comportamiento y destino. El aumento de la adherencia a la ECM se espera que lleve a una forma más alargada. Con el fin de confirmar el aumento de la adherencia de la artritis fibroblastos in vivo, hemos examinado el tobillo articulaciones artríticas o de WT littermate ratones en un nivel ultraestructural con microscopía electrónica de transmisión (Figura 3 C). En ratones WT, FE figura prominente núcleos, abundante retículo endoplasmático rugoso (r-ER), y las mitocondrias de diferentes formas y tamaños. En cambio, la modificación notable de los FE se observó en las articulaciones de los artríticos ratones, donde la mayoría de las células aplanadas azar tenía una forma alargada se caracteriza por la dilatación de la r-ER y por las mitocondrias hinchadas con cristae distorsionada.

Por lo tanto, parece que uno de los mecanismos patogénicos de la AR es la promoción de la polimerización de la actina y la reorganización del citoesqueleto de actina. Gelsolin (Gsn) es un gen que los mapas en uno de la CIA QTL (véase la figura 1], y su expresión es Encuentra regulado en el artríticos FE sustractivo por ambas bibliotecas y microarrays hibridaciones (véase el cuadro 3]. Desregulado su expresión fue confirmada por tiempo real de RT-PCR en ambos ratón (vea la Figura D S6] y humanos de las muestras (Figura 2], así como por Western blot en inmortalizado FE (véase la figura S6 E). El gen codifica una proteína de unión actina-con filamento de la ruptura de propiedades [18], y Gsn - / - fibroblastos han excesivo estrés fibras de actina [18], muy similares a los observados en la artritis FE (véase la figura 3 A). Con el fin de demostrar la participación del citoesqueleto organización en la patogénesis de la AR y poner de relieve el papel de gelsolin en ella, la artritis ratones (Tg197, hTNF + / -) acoplado con el gsn ratones knockout (gsn - / -) [18 ]. Llaman a cabo gsn de expresión debe promover FE RA patogénesis de la ruptura de la inhibición de la actividad de gelsolin. De hecho, y tal y como se muestra en la figura 4, la supresión de gsn expresión dio lugar a la hiperplasia de la membrana sinovial y la exacerbación de la enfermedad.

Discusión
Twin Expresión perfiles, análisis estadístico, y de validación

De perfiles de expresión, la cuantificación relativa de los niveles de expresión de miles de genes simultáneamente, es uno de los enfoques más prometedores para la comprensión de los mecanismos de diferenciación, el desarrollo, y la enfermedad. Sin embargo, el reducido número de muestras habitualmente empleadas sustancialmente los límites de análisis estadístico y se opone a la aplicación de los métodos multivariantes complejo, que sería más apropiado para poligénico enfermedades como la AR. En consecuencia, los resultados deben ser confirmados por un método biológico, que reduce en gran medida la naturaleza de alto rendimiento y tasa de descubrimiento de un enfoque.

Para superar estos problemas y aumentar la tasa de descubrimiento, hemos utilizado un doble de alto rendimiento enfoque integrado de las bibliotecas y de sustracción cDNA microarray de oligonucleótidos de ADN hibridaciones. Ambas metodologías se rigen por diferentes limitaciones: aleatoria oportunidad para que las bibliotecas' clon robótico de la selección y el diseño de chips para los microarrays. En consecuencia, ambas metodologías no son completamente hacia la propagación del error. Por lo tanto, la intersección de sus estadísticamente significativa desregulado listas de genes que se espera contar con una muy baja tasa de falsos descubrimiento. Para ilustrar esta exposición y para la validez de la doble enfoque de alto rendimiento, un número de genes representante de la lista seleccionada comúnmente se vio confirmada por una serie de diferentes métodos, como la búsqueda bibliográfica automatizada y SQ y RT-PCR cuantitativa en ambos ratón Humanos y muestras. Por lo tanto, hemos demostrado que el acoplamiento de dos diferentes enfoques de alto rendimiento disminuye en gran medida la necesidad de confirmación independiente y, en consecuencia, aumenta el número probable de genes desregulados.

Todos los genes expresados diferencialmente fueron asignadas a los cromosomas, junto con el conocido QTL para un modelo animal de artritis, la CIA [14]. Ocho genes desregulados asignadas a la CIA QTL (WJ: Ctss, Pitpnm, Ncf1, Psmb8, y Siat8e; SF: Rab14, Aqp1, y Gsn; véase la figura 1], lo que sugiere que estos genes pueden tener una influencia dominante en los procesos de artritis, con independencia de La incitación de estímulo (autoinmune o inflamatoria). A tal fin, se informó recientemente de que un polimorfismo natural de Ncf1 (NADPH oxidasa subunidad; QTL Cia 14) regula la artritis gravedad [19] y en la actualidad está siendo explotado comercialmente en un programa de descubrimiento de medicamentos. Del mismo modo, llaman a cabo Aqp1 (que codifica una proteína canal de aguas; QTL Cia 6) reveló expresión de su papel fundamental en la migración celular, fundamental para la cicatrización de heridas y la propagación del tumor [20]. Curiosamente, varios de los genes adyacentes juntos en el grupo de regiones de los cromosomas (4, 7, 10, 11 y 13). Estos loci podría definir nuevas QTL o implica un control reglamentario común en el nivel de la cromatina.

Citoesqueleto de actina y patogénesis RA

Poligénico para enfermedades como la AR, los conocimientos sobre las funciones concertadas de genes o procesos celulares podrían proporcionar valiosas pistas y ayudar a priorizar las metas. En este contexto, se realizaron búsquedas en los procesos de desregulación en lugar de los genes, sobre la base de las anotaciones funcionales de los genes desregulados, ya que estos se formalizó a través del vocabulario controlado de la Ontología de Genes Consortium [17]. GO término se calcularon las frecuencias seleccionadas en la lista de genes y su significación estadística se estimó. La lista resultante (Tabla S3] incluye una serie de funciones que se espera abarcar el conocimiento acumulado acerca de la patogénesis de la enfermedad, como el colágeno catabolismo, la activación de complemento, y la respuesta inmune y el estrés. Que es más importante, cinco de los 26 predijo desregulado GO funciones afectadas (directa o indirectamente) citoesqueleto de actina, formando así una hipótesis válida que se han de estudiar. En consecuencia, F-actina estrés fibras se visualizaron in vitro, en artríticas y WT FE, primaria y inmortalizados. Como resulta evidente en la Figura 3 A, existe una notable diferencia, con la exhibición de artritis FE pronunciado estrés fibras. En particular, el estrés aparece en fibras diferenciadas fibroblastos llamado miofibroblastos, fibroblastos especializados contráctil con un papel importante en el establecimiento de la tensión durante la cicatrización de heridas y patológicas contractura [21, 22]. Esta es la primera indicación directa de la posible presencia de miofibroblastos en la sinovial de artritis, aunque se ha informado anteriormente que el factor de crecimiento transformante-b1 y la interleucina-4 puede inducir un fenotipo myofibroblastic a FE in vitro [23]. De acuerdo con este concepto, se observó que los Fondos Estructurales han artríticos más pronunciada-quinasa de adhesión focal positivo islas (datos no publicados), una característica destacada de miofibroblastos [22]. Citoesqueleto de actina bidirectionally interactúa con los receptores a través de ECM (integrinas principalmente), que poseen sitios de unión para extracelular laminina, colágeno, fibronectina, y otros componentes de ECM. La formación de pareja, amplia adhesivo contactos entre las células y ECM resultados de la cooperación entre los sistemas adhesivos y citoesqueleto de actina y la generación de la fuerza en todas las regiones de la célula [24]. En este contexto, miofibroblastos se cree que ejercen el aumento de la tensión al sustrato adhesivo a través de una mayor capacidad, lo que resulta en una más aplanado, la forma alargada de células [22]. En consecuencia, hemos observado que artríticos FE adherirse a los diversos componentes de ECM con una mayor afinidad in vitro (véase la figura 3 B), que permiten una mayor forma alargada in vivo (véase la figura 3 C), además corroborar la posible existencia de miofibroblastos en la artritis Sinovial. De acuerdo con este resultado, la posible presencia de miofibroblastos humanos en la sinovial de artritis fue recientemente implícita, por análisis inmunohistoquímico [25].

Si bien la existencia de miofibroblastos y su papel en la patogénesis de la AR aún deben estudiarse con mayor detalle, el hecho es que la reorganización del citoesqueleto de actina y la desregulación de los asociados ECM adherencia parece ser una propiedad intrínseca de los Fondos Estructurales de artritis. Con este fin, se informó recientemente de que la prevalencia de determinados autoanticuerpos contra antígenos del citoesqueleto es elevado en los pacientes con AR [26]. Autoanticuerpos servir como importantes marcadores serológicos en el diagnóstico de diversas autoinmunes y enfermedades del tejido conectivo, incluyendo RA [27, 28]. Un gran número de la AR-autoanticuerpos específicos de alto valor diagnóstico se dirigen contra los componentes del citoesqueleto: anti-vimentina, anti-queratina, y la lucha contra la filaggrin [28]. Filaggrin queratina es una cruzada enlazador, un filamentos intermedios de agregación de la proteína, que puede afectar a otros elementos citoesqueleto, incluyendo microfilamentos de actina, por un mecanismo similar a la ruptura de filamentos de actina por gelsolin [29]. La mayor parte de la mencionada autoanticuerpos citrullinated reconocer la forma de proteínas de citoesqueleto [30]. Desde citrullination de proteínas no es específica para la AR, los resultados pueden proporcionar las bases moleculares, por un mecanismo aún desconocido, de la presencia de anticuerpos anti-citoesqueleto en la AR.

Recientes experimentos han demostrado que el citoesqueleto desempeña un papel fundamental en la regulación de los diversos procesos celulares de células vinculadas a la transformación y tumorigénesis, como el contacto y la inhibición de anclaje independiente crecimiento de las células [31]. La evidencia sugiere que artríticos FE también exhiben características de las células transformadas condujo a la hipótesis de trabajo de que la artritis sinovial es un tumor localmente invasivo [32]. El citoesqueleto reorganizado en artríticas FE, por lo tanto, refuerza el concepto de una transformado-como el carácter de la SF y abre nuevas direcciones en el tratamiento farmacológico de la AR.

Gelsolin-actina es una proteína de unión [33] que se ha implicado, entre otros, en la transducción de señales dinámicas reordenamientos en el citoesqueleto de la arquitectura. En presencia de calcio, gelsolin preexistentes rompe los filamentos de actina y topes de ellos, lo que impide a monómero además de su rápido crecimiento fines. La tapa de púa es muy estable, incluso en ausencia de calcio, a no ser desplazados por la interacción con fosfolípidos de reglamentación como fosfatidilinositol-4 ,5-bisphosphate. En presencia de un gran número de profilin (otro actina-proteína de unión), o bajo condiciones depolymerizing, estos gelsolin-tope termina permitir el desmontaje de las poblaciones de los filamentos de actina por la pérdida de la subunidad extremos puntiagudos [34]. Gsn - / -- Fibroblastos tenían exceso de estrés fibras in vitro [18], similares a los observados en la artritis FE, en donde se encontró gelsolin abajo-que se rige por una variedad de métodos. Llaman a cabo Gsn expresión de la artritis en ratones como resultado la exacerbación de la enfermedad (Figura 4], por lo tanto, probar la participación de la reorganización del citoesqueleto de actina en la fisiopatología de la enfermedad. La extensión de las similitudes de la sinovial de artritis con tumores, gelsolin resultó ser uno de los más sorprendentemente abajo regulado marcadores a la transformación maligna de fibroblastos de Ras [35], mientras que la sobreexpresión de un mutante gelsolin se mostró a reprimir Ras inducida por transformación [ 36]. Su expresión es indetectable o reducido en la mayoría de los humanos gástrica, vejiga, pulmón, colon, mama y tumores [37 - 39].

Conclusión

Hemos demostrado que la combinación de la secuencia de las bibliotecas de sustracción cDNA microarray y análisis de la expresión es muy fiable y los rendimientos libre objetivos validados y, cuando se integra con otros enfoques de la genómica funcional como la genética y la vinculación funcional asistida GO-descubrimiento, puede proporcionar nuevos conocimientos sobre La fisiopatología de la AR. Como ejemplo, hemos investigado uno de los procesos celulares predijo desregulado, citoesqueleto organización, y predijo uno de los genes implicados en la liberalización de estos procesos, gelsolin, para demostrar que gelsolin impulsada reorganización del citoesqueleto de actina es una novela fisiopatológicos determinante de la AR.

Materiales y Métodos
Animales.

Todos los animales fueron criados en las instalaciones animales de Alexander Fleming, el Centro de Investigación en Ciencias Biomédicas en determinadas condiciones libre de agentes patógenos, en el cumplimiento de la Declaración de principios de Helsinki. Los animales fueron alojados en 20-22 ° C, 55 ± 5% de humedad, y de 12 horas el ciclo luz-oscuridad, se le dio agua ad libitum. "Arthritic" ratones transgénicos (Tg197, hTNF + / - llevan de mixtos CBA × C57BL / 6 antecedentes genéticos de más de 20 generaciones), a cargo del gen TNF humano donde el 3 'UTR fue sustituido por el correspondiente de b-globina [ 5]. "Arthritic" ratones knockin (TNF Δ SE / + 129/C57BL6 mantenerse en un segundo plano durante más de 20 generaciones) expresa el gen endógeno mTNF, donde abarca el 69 pb TNF SON (UA ricos en elementos) en el 3 'UTR se han eliminado, Mensaje que resulta en una mayor estabilidad y eficiencia de la traducción [8].

Célula de aislamiento y de la cultura.

FE (VCAM +) fueron aisladas de 6 - 8-Semana de edad, los ratones esencialmente a lo descrito previamente [7]. Los fibroblastos fueron seleccionados por el cultivo continuo de al menos 21 d y un mínimo de cuatro pasajes. No hay marcadores de los macrófagos puede ser detectado por el análisis FACS. Las células fueron cultivadas a 37 ° C, 5% de CO 2 en total MEDM medio (Gibco-BRL, San Diego, California, Estados Unidos) suplementado con 10% de SFB y 100 U / ml de penicilina-estreptomicina. La creación y condiciones de cultivo (33 ° C, 10 U / ml de murino rIFN-γ), de forma condicional inmortalizado SF líneas celulares se ha descrito anteriormente [7].

Extracción de RNA.

ARN total fue extraído de subconfluent (70-80%) cultivadas FE (primaria o condicional inmortalizada) RNAwiz con el reactivo (Ambion, Austin, Texas, Estados Unidos), seguido por el único paso a través de una columna RNeasy (QIAGEN, Hilden, Alemania) De acuerdo a las instrucciones de los fabricantes. ARN total fue extraído de WJs utilizando el guanidinium isothiocynate-ácido fenol protocolo [40], seguido de un único paso a través de una columna RNeasy. Se evaluó la integridad del ARN mediante electroforesis en desnaturalización 1,2% geles de agarosa-formaldehído. ARN cantidad y la calidad se calcularon en base a las lecturas de DO 260/280 nm.

Generación de cDNA de longitud completa bibliotecas.

Primer capítulo de la síntesis de ADNc se realizó a través SUPERSCRIPT II (tecnologías de la Vida / Invitrogen) a los 56 ° C en presencia de trehalosa y sorbitol. La estructura de la tapa en el 5 'finales de mRNAs se biotina, y de ADNc de longitud completa se seleccionaron, después de RNAse I tratamiento, el uso de streptavidina revestida de piedras [41]. - Segundo capítulo de síntesis fue preparado por el solo capítulo enlazador método de ligadura (SSLLM), donde un doble-stranded DNA enlazador (al azar con 6-bp, dN6 o dGN5, 3 'domina) ligated es a la única varados cDNA [42 ]. El segundo capítulo se hace por ejemplo extensión usando mezclas de largo alcance polimerasas termoestables, seguido de restricción de la digestión (BamHI y XhoI) y la ligadura de la λ-FLCI phagemid vector [42, 43]. Después de los envases, bibliotecas de cDNA se ampliaron en fase sólida, como ha sido descrito previamente [44].

CDNA biblioteca de la normalización y la resta.

El procedimiento se describe en la Figura S1 A. Amplified phagemid λ-FLCI bibliotecas de cDNA fueron utilizados para infectar los Cre-expresando línea celular bacteriana BNN-132 y la extirpados plásmidos fueron aislados [43]. Doble varados ADN plásmido se mellas por el sitio específico (f1 origen) endonucleasa GeneII y convertido a circular única forma varados por digestión con exonuclease III [44]. Circular, de un solo varados plásmido bibliotecas de cDNA (tester bibliotecas) luego fueron víctimas de un solo resta paso de la normalización, con PCR-derivados único capítulo de ADN antisentido conductores producidos a partir de estas bibliotecas [44]. La normalización se refiere a los bajos CoT (reassociation tasa) hibridación (CoT = 2) con los conductores producido a partir de la "libre" biblioteca, y que apunta a disminuir la representación de la altamente expresado mRNAs. La resta se refiere a la alta CoT hibridación (CoT = 100 ~ 200) con los conductores producido a partir de diferentes bibliotecas, y tiene como objetivo eliminar los mRNAs comunes en ambas poblaciones. Hibridizada doble varados ADNc se retiraron con dos pases a través de una columna de hidroxiapatita. Nonhybridized, solo varados ADNc se convirtieron a doble varados y fueron posteriormente electroporated en DH10b células bacterianas, en la que sólo probador ADNc pueden propagar (debido a la presencia de un origen de replicación y la resistencia a los antibióticos) [44].

Secuenciación de alto rendimiento y análisis de secuencias.

Colony picking, cDNA secuencia y análisis de secuencias se realizaron esencialmente a lo descrito previamente [45 - 47]. Secuencias fueron filtradas para primer vector y secuencias [47] y enmascarados específicos para roedores y mamíferos a escala repite con RepeatMasker ( Http://www.phrap.org ). EST agrupación se realizó con stackPACK y d2_cluster (palabra de tamaño 6, la similitud de corte 0,98, el tamaño mínimo de la secuencia 50, tamaño de la ventana 200) [48, 49]. Búsquedas de homología con genes conocidos se realizaron con BLAST [50, 51] en el Unigene ( Http://www.ncbi.nlm.nih.gov/UniGene ), FANTOM2 ( Http://fantom2.gsc.riken.go.jp ) [52], y SWISSPROT ( Http://www.ebi.ac.uk/swissprot/ ), Bases de datos. BLAST resultados se asociaron con GO términos ( Http://www.geneontology.org ) En Http://source.stanford.edu/cgi-bin/sourceSearch (Por Unigene), Ftp://ftp.ebi.ac.uk/pub/databases/GO/goa/ SPTR / gene_association.goa_sptr.gz (por SWISSPROT), y Http://fantom2.gsc.riken.go.jp (Por FANTOM2). Los resultados detallados (incluidos los números de clon, agrupaciones y los genes, los resultados y BLAST E valores, números de acceso, y las cesiones GO) puede consultarse en la correspondiente página Web del autor, en Http://www.fleming.gr/en/investigators/Aidinis/data.html . La mayor parte de la secuencia de datos, se han presentado ya a las bases de datos públicas [46], en el contexto de la actual FANTOM (anotación funcional del ratón) proyecto [52, 53].

Diferencial de la expresión génica análisis estadístico de las bibliotecas de sustracción.

El diferencial de la expresión génica / abundancia entre las distintas bibliotecas de cDNA resta se calculó con una sola prueba estadística diseñado especialmente para este fin [54]. En esencia, la fórmula es la entropía de un fraccionamiento de los genes entre las bibliotecas de cDNA y se describe por un valor de R, que es el logaritmo de verosimilitud relación estadística, que sigue (2R 2R j) una distribución asintótica χ 2 [54]. La fórmula de la estadística de I j de la j ª gen está dado por la expresión:

Donde

Donde m es el número de bibliotecas de cDNA, N i es el número total de clones secuenciados en la biblioteca i ª, χ i, j los condes (copias de la transcripción) de la j ª gen en la biblioteca ª i, y f i es el Frecuencia de las copias de genes transcripciones de la j ª gen en todas las bibliotecas.

La importancia de la R-estadística se estableció utilizando un método de remuestreo que intenta crear un "óptimo" de corte valor simulado utilizando conjuntos de datos de biblioteca basado en la cuenta observada. El método consiste de los siguientes pasos. (1) Para cada gen, la transcripción de genes comunes de frecuencia f j se calcula con la ayuda de la Ecuación 2. Este número corresponde a la frecuencia de la esperada en virtud de la transcripción de genes hipótesis nula de ninguna diferencia en la abundancia de genes j a través de todas las bibliotecas. (2) Los parámetros de la distribución de Poisson a la distribución de muestreo de la abundancia clon para cada gen y la biblioteca se calculan con arreglo a la hipótesis nula. Este parámetro es igual a N i × f gen para j j i en la biblioteca, donde N i es el número total de clones (teniendo en cuenta todos los genes), secuenciado en la biblioteca y f i j se calculó en el paso 1. Este valor es igual a la espera de la cifra absoluta de los clones j ª gen en la biblioteca i ª bajo la hipótesis nula. (3) Entonces, para cada comparación biblioteca, y cada gen, el número aleatorio se genera a partir de la distribución de Poisson de la etapa 2. Este número es un simulado contar compatible con la hipótesis nula, es decir, que la frecuencia de genes para un determinado gen es el mismo en todas las bibliotecas. Este paso utiliza el número aleatorio de generación de la función del ordenador para crear un conjunto de datos artificial correspondiente al experimento de creación de biblioteca y análisis para cada una de las bibliotecas en comparación con arreglo a la hipótesis nula. (4) Para j gen artificial en el conjunto de datos de la etapa 3, la prueba estadística R se calcula mediante la sustitución de χ i, j el número aleatorio generado en el paso 3, de la frecuencia f j calculado en el paso 1, y para el N i Número total de clones secuenciados. (5) Los valores de R calculado en el paso 4 se clasifican en orden descendente, y para una serie de valores para la especificidad (es decir, la verdadera tasa negativa), el correspondiente valor de R se encuentra. Estas son, por definición, un resultado negativo, ya que se obtuvieron a partir de las bibliotecas bajo la hipótesis nula. (6) Los pasos 3-5 se repiten 1.000 veces. Los datos resultantes nos permitió construir el histograma se muestra en la Figura S2 A. Estos histogramas muestran la distribución del valor de R en función de la necesaria verdadera tasa negativa de corte. La media de esta distribución (empírica) se utiliza como valor de R de corte para el análisis de los datos experimentales. (7) El conjunto de datos experimentales valores de R se calculan para todas las bibliotecas comparativo utilizando el clon observó que cuenta. R-genes con valores superiores a los establecidos anteriormente de corte se consideran regulados diferencialmente entre las bibliotecas. Los cálculos fueron realizados en el Sistema de álgebra para computación Mathematica 4.2 ( Http://www.wri.com ) MathStatica con el add-on [55].

Oligonucleótido gama alta densidad de la hibridación.

CRNA sondas fueron generados a partir de 5 μ g de RNA total y hibridizada a la Mu11K (subunidades AyB) set de chips de acuerdo a las instrucciones del fabricante (Affymetrix, Santa Clara, California, Estados Unidos) y como ha sido descrito previamente [7]. El conjunto de chips está diseñado para reconocer colectivamente 13179 murino transcripciones distintas, en donde el nivel de expresión de un determinado gen es interrogado por 40 oligonucleótidos, 20 con una perfecta secuencia y 20 con un solo desajuste. Hibridizada fichas fueron lavados y teñidos en una estación de fluidos (Affymetrix) siguientes protocolos estándar; posteriormente, la intensidad de fluorescencia fueron leídos por un escáner Affymetrix. Todos MIAME compatible con microarrays de datos se puede descargar de la base de datos ArrayExpress (número E-MEXP-255), así como de la correspondiente página web del autor ( Http://www.fleming.gr/en/investigators/Aidinis/data.html ).

Microarray de preprocesamiento de datos y normalización.

El procedimiento se describe en la Figura S3. Bajo nivel de análisis de la imagen escaneada resultante (como los antecedentes y resta cálculo de intensidades de células individuales sonda) fue realizado automáticamente por MicroArray Suite 5.0 (MAS5) software (Affymetrix). En pocas palabras, el nivel cuantitativo de la expresión (señal de valor), así como una medida cualitativa de expresión (detección de la palabra), de un determinado gen es calculado por Affymetrix algoritmos de propiedad de la combinación, los antecedentes ajustados en función de las intensidades de hibridación, de 20 perfecta y 20 individuales Desajuste oligonucleótidos (sonda de juego). Todos los valores de la señal de todas las fichas en el experimento se ampliaron para llegar a meta intensidad (TGT), de 500 o 2500, Affymetrix siguientes recomendaciones para los distintos conjuntos de chips utilizado. Escalonada valores fueron sometidos a un paso de normalización que se destina a cada chip subunidad de la fuerza de la señal para tener una distribución general de forma idéntica a través de los chips de la misma subunidad. La expresión de genes valores se reorganizaron en dos matrices de datos, una para cada conjunto de chips subunidad (A, B), donde las filas y columnas representados los genes y chips, respectivamente. Las columnas de la matriz de datos se normalizaron a tener el mismo uso de cuantiles BioConductor [56]. Cada cuantil de cada columna se puso a la media de ese cuantil entre arreglos (véase la figura S4 A). Las filas de las dos matrices de datos se fusionarán, y las columnas de la matriz de datos resultante se dividieron de acuerdo con el correspondiente modelo animal de la AR (Tg197, TNF Δ SE) y el tipo de muestra (SF o WJ), con lo que la obtención de una Total de cuatro matrices de datos. Por último, los genes que no se llama "presente" (detección de la palabra), o que tenía una señal normalizada inferior a la quinta parte de la TGT en al menos una muestra no se considera más. Posterior análisis, se realizó en el resto de 8021 la sonda fija.

Microarray análisis de los datos.

Las comparaciones de los chips Affymetrix hibridaciones y PCR en tiempo real han indicado que los análisis de chips son precisos y confiables, y que subestimar las diferencias en la expresión de genes [57]. No obstante, con el fin de evaluar el rendimiento del sistema, la reproducibilidad de los (técnicos) duplicados de las muestras se examinó, en términos de coeficiente de correlación de Pearson normalizaron las señales, así como la detección de concordancia (expresada como el porcentaje de la sonda que se fija constantemente detectado con Un "presente" o "ausente" en los dos chips de la palabra). Como se puede observar en la figura B, S4, Affymetrix datos fueron altamente reproducible y fiable.

Como se ha informado anteriormente [58, 59], la importancia de los cambios de tapa, que con frecuencia son utilizadas como medida de la expresión diferencial, depende en gran medida del nivel de expresión de los genes correspondientes. Por lo tanto, con el fin de identificar genes que son significativamente diferencialmente expresado, hemos decidido no utilizar un determinado umbral de cambio de tapa, pero en vez de modelo veces dependen de la intensidad de los cambios replicados entre chips usando una variante de un enfoque descrito anteriormente [60]. En pocas palabras, primero calculado veces-los cambios en las comparaciones pairwise de reproducirse en representación de los chips transcriptome del mismo tipo de muestra (SF o WJ) medido (en las mismas condiciones experimentales utilizando la siguiente definición:

Donde x i es el nivel normalizado de expresión de un determinado gen en el i ª chip. Los genes se clasifican de acuerdo a la menor de sus dos valores de la expresión-es decir, min (x 1, x 2)-y la expresión general de la serie fue dividida en intervalos de diez, cada uno con un número igual de sonda fija. En cada partición de la mediana de todas min (x 1, x 2) los valores, así como los 90 º y los 95 º percentil veces-el cambio se determinó, por lo tanto, la obtención de diez puntos de modelado distintos para cada tipo de muestra (SF o WJ) y para Cada uno de los dos niveles de significación (90% o 95%). Basado en la observación de que la medición de la variabilidad de alta densidad de oligonucleótidos microarrays depende de la intensidad de la señal después de un poder de la ley [11], un continuo FCM se deriva de los diez puntos de modelado utilizando un ajuste lineal de mínimos cuadrados en parcelas log-log. Modelado de los siguientes parámetros se han obtenido para los dos FCMs (véase la figura S4 C): una pendiente de -0,327 y 2,356 para interceptar de la FCM SF, y una pendiente de -0,346 y 2,678 para interceptar de la FCM WJ. Esto significa que WJs son, como era de esperarse, intrínsecamente más variables de lo que FE. El uso de pistas (o a90% a95%) y las intersecciones (b90% o b95%) como consecuencia de la regresión de las curvas, se podrían obtener para cada tipo de muestra (SF o WJ) y para cualquier nivel mínimo de expresión tanto un 90% y un Umbral de significación del 95%:

Para cada una de las cuatro matrices de datos (es decir, Tg197/SF, TNF Δ SE / SF, Tg197/WJ, y TNF Δ SE / WJ), una media de veces-observó el cambio entre las condiciones experimentales (enfermas o normal) se calcula para cada gen en el La siguiente manera:

Donde μ i es el nivel medio de expresión de un determinado gen en la condición experimental i ª. Si no se dispone de repeticiones, el único valor de la expresión de genes se da el utilizado en lugar del promedio. Para cada gen, este cambio observado veces-fue comparado a veces el cambio que se esperaba en un 90% (o 95%), nivel de significación utilizando el correspondiente "tipo de muestra"-FCM específicas, en vista de los valores observados de μ i de De genes que:

Por último, los genes con obs FC> FC 90% (o> FC 95%) fueron seleccionados como diferencialmente expresados en un nivel de significación del 90% (o 95%, respectivamente).

Visualización de QTL y genes de expresión de datos.

Esto se realizó con la opinión de Expresión [61], en Http://ensembl.pzr.uni-rostock.de/Mus_musculus/expressionview . QTL datos se obtuvieron a partir de Serrano-Fernández et al. [62].

Funcional de la agrupación y la determinación de la significación estadística.

Biológica anotación, en la forma de GO "proceso biológico" plazo [17], para cada uno de los genes (sonda fija) en el cuadro 3, se obtuvo de la NetAffx portal ( Http://www.affymetrix.com ). Luego se calculó el plazo GO frecuencias observadas, como medio para descubrir desregulado funciones (Tabla S3]. La significación estadística de las frecuencias GO plazo fue determinado esencialmente como se ha descrito previamente [63]. En pocas palabras, la distribución hipergeométrica se utilizó para obtener la oportunidad probabilidad de observar un número determinado de genes anotado en NetAffx con un particular GO plazo adecuado y, a continuación, calcular los valores de p. Más concretamente, la probabilidad de observar al menos k sonda fija con una anotada GO plazo dentro de una lista de los seleccionados sonda conjuntos de tamaño n se calculó como [63]:

Donde f es el número total de los genes dentro de una categoría funcional, y g es el número total de la sonda fija en el conjunto de chips (13179).

Ensayos de adherencia.

Estos ensayos se realizaron sobre tiras de adhesión Cytometrix (Chemicon, Temecula, California, Estados Unidos) recubierto con humanos fibronectina, vitronectin, laminina, y colágeno I, de acuerdo a las instrucciones del fabricante. En pocas palabras, las células (por triplicado) se permite que se adhieran a la mencionada sustratos, y sin unir células eliminadas con secuencial lavados con PBS que contenía Ca + + y Mg + +. Adheridos células fueron teñidas con cristal violeta, solubilizados, y determinó su absorbancia a 570 nm.

Inmunofluorescencia.

Las células fueron fijadas mediante paraformaldehído al 4% en PBS y teñidas por métodos estándar. Para visualizar F-actina de las células se tiñeron con Alexa 594-phalloidin (Molecular Probes, Eugene, Oregon, Estados Unidos). P-tirosina se detectó utilizando el anticuerpo 4G10 (Upstate Biotecnología, en Waltham, Massachusetts, Estados Unidos), la quinasa de adhesión focal fue con un anticuerpo monoclonal (clon 77, BD Transduction Laboratories, Lexington, Kentucky, Estados Unidos). Los anticuerpos contra gelsolin fueron planteadas por la inmunización de conejos con el ratón recombinante gelsolin; suero inmune fue utilizado en la dilución 1:500. Por Western blot, 10 μ g de proteína total fue de células separadas por SDS-PAGE, transferidos a la membrana Immobilon-P, para gelsolin probaron, y re-probaron de actina como control interno de carga.

RT-PCR.

ARN total fue extraído de SF y WJ tejido utilizando reactivo TRIzol (Life Technologies, Rockville, Maryland, Estados Unidos), de conformidad con las instrucciones del fabricante. El rendimiento y la pureza del RNA se determinó espectrofotométricamente a 260/280 nm. Primer capítulo de la síntesis de ADNc se realizó a través de la transcriptasa inversa MMLV y oligo-dT 15 (Promega, Madison, Wisconsin, Estados Unidos).

SQ PCR se realizó por 20-25 ciclos de desnaturalización a 95 ° C durante 30 s, recocido en 57-62 ° C (dependiendo de la T m de cada conjunto de los primers) durante 30 s, y extensión a 72 ° C por 1 min, en un volumen final de 20 μ l. Los productos se separaron por electroforesis en gel de agarosa al 1,5% y teñidos con bromuro de etidio. Producto intensidad se cuantificó con GelWorks 1D Avanzada (v. 4.01) y normalizado a la intensidad de B2m y / o L32. Los primers se seleccionaron a las dos exones, mientras que los dos de control de los cebos se han seleccionado de entre el Primer Banco de base de datos ( Http://pga.mgh.harvard.edu/primerbank/ ). Primer secuencias (enumerados en el 5 'a 3' dirección, y ha designado como s, sentido, y como, en antisentido) y los tamaños de los productos (en bp) es el siguiente: Aqp1 (s, TCACCCGCAACTTCTCAAAC; como, AGCTCTGAGACCAGGAAACA, 400), Bsg (S, ATGAGAAGAGGCGGAAGCCA; como, CCACTCCACAGGGCTGTAGT, 426), Cd14 (s, CAATCCTGAATTGGGCGAGA; como, CGAGTGGGATTCAGAGTCCA, 400), Cdc42 (s, AAGTGGCCCAGATCCTGGAA; como, AGCACTGCACTTTTGGGGTT, 380), Gsn (s, TGCAGGAAGACCTGGCTACT; como, ATGGCTTGGTCCTTACTCAG, 300) , Hp (s, GAAGCAATGGGTGAACACAG; como, GGGGTGGAGAACGACCTTCT, 331), Marco (s, CACAGGAATTCAAGGACAGA; como, ATTGTCCAGCCAGATGTTCC, 397), Mglap (s, CAGTCCCTTCATCAACAGGA; como, CTGCAGGAGATATAAAACGA, 274), Mb (s, TCACACGCCACCAAGCACAA; como, TGGGCTCCAGGGTAACACTG, 354), Ptgis (s, TCACAGATGACCACACTCCC; como, GCAGTAGGACGACAAATTGT, 403), B2M (s, TTCTGGTGCTTGTCTCACTGA; como, CAGTATGTTCGGCTTCCCATTC, 104), y L32 (s, TTAAGCGAAACTGGCGGAAAC; como, TTGTTGCTCCCATAACCGATG, 100).

Cuantitativo PCR en tiempo real se ha realizado mediante el iCycler iQ en tiempo real y sistema de detección de la IQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, California, Estados Unidos), de acuerdo con las instrucciones del fabricante, durante un ciclo de 94 ° C durante 4 min, y 40 ciclos de desnaturalización a 95 ° C durante 50 s y recocido a 57-62 ° C durante 50 s. Primers se han seleccionado de entre los exones separados por grandes intrones, y la calidad y especificidad de PCR se verificó mediante fusión y análisis de la curva de la electroforesis en gel. Los valores se normalizan a B2m y / o L32 (utilizando el mismo como cebadores para la PCR SQ). Mouse (m) y humanos (h) primer secuencias y espera longitudes fueron los siguientes (enumerados en el 5 'a 3' dirección, y ha designado como s, sentido, y como, en antisentido): mAqp 1 (s, TCACCCGCAACTTCTCAAAC; como, TCATGCGGTCTGTGAAGTCG, 123), mGsn (s, TGCAGGAAGACCTGGCTACT; como, TCGATGTACCGCTTAGCAGA, 130), hAqp 1 (s, CTCCCTGACTGGGAACTCG; como, GGGCTACAGAGAGGCCGAT, 182), hBsg (s, TTCCTGGGCATCGTGGCTGA; como, GCGGACGTTCTTGCCTTTGT, 159), hCd14 (s, CGGCGGTCTCAACCTAGAG ; Como, GCCTACCAGTAGCTGAGCAG, 142), hCdc42 (s, AATTGATCTCAGAGATGACC; como, TTTAGGCCTTTCTGTGTAAG, 150), hGsn (s, GGTGTGGCATCAGGATTCAAG; como, TTTCATACCGATTGCTGTTGGA, 199), hMarco (s, TGGGACGAGATGGAGCAAC; como, CCCTTAGTTCCAGTTTCCCCTT, 193), hMb (s , TTGGTGCTGAACGTCTGGG; como, CTGTGCCAGGGGCTTAATCTC, 249), hB2M (s, CTGAAAAAGATGAGTATGCC; como, ACCCTACATTTTGTGCATAA, 202) y hL32 (s, TTAAGCGTAACTGGCGGAAAC; como, GAGCGATCTCGGCACAGTAA, 210).

Ciclo de umbral (Ct; el primer ciclo de amplificación en la que se puede detectar) los valores fueron obtenidos de la iCycler iQ software para cada gen de interés (GOI) y el control del hogar genes (HKG; L32 y / o b2m), junto con la eficiencia de amplificación ( Η; 80-120%). Para el ratón muestras, se calculó la expresión relativa de las muestras para los controles de WT como muestras de referencia utilizando la expresión de genes de la cuantificación relativa Microsoft Excel add-on macro (Bio-Rad) que utiliza las siguientes fórmulas: relativo expresión = 2 - (S Δ Δ Ct-R Ct), donde Δ Ct = Ct GOI - HKG Ct. Para los humanos de las muestras, Ct valores se convirtieron a valores de concentración (ng / ml), mediante la utilización de la curva de calibración realizados por diluciones seriadas (en copias) de una muestra de referencia. Los valores se normalizan a los correspondientes valores de la referencia (limpieza) gen (s) y presentado (en escala logarítmica para fines de visualización) como expresión índice.

Resultado de artritis y histopatología.

Parafina-incrustados conjunta muestras de tejidos fueron seccionadas y teñidas con hematoxilina y eosina. Artríticas histopatología se evaluó (en un ciego de moda) por separado para la hiperplasia sinovial, la existencia de sitios inflamatoria, la destrucción del cartílago y erosión del hueso mediante un semicuantitativo (0-5) se calificaron como hemos descrito anteriormente [64].

La microscopía electrónica de transmisión.

Articulaciones del tobillo (disecado de la pata trasera derecha de cada ratón y tres Tg197 y tres WT) se dividieron abierta longitudinalmente a través de la línea media entre la tibia y el astrágalo, y se pre-fijado con glutaraldehido al 2,5% en PBS (pH 7.4) durante la noche. Después de post-fijación con tetróxido de osmio 1% en PBS durante 2 h, las muestras se deshidrataron en una serie de etanol clasificado y transformada en Araldite. Semithin secciones (1,0 μ) fueron cortadas y teñidas con azul de metileno para observar la orientación bajo el microscopio de luz. Ultrathin secciones (80-90 nm) fueron cortadas con un ultramicrótomo (Riechert-Jung Ultracut E, Leica, Wetzlar, Alemania), montada sobre redes de cobre, counterstained con acetato de uranilo y citrato de plomo, y evaluados por microscopio electrónico (CM120 Biotwin, FEI Company, Hillsoro, Oregon, Estados Unidos).

Apoyo a la Información
Subtractive cDNA Bibliotecas y en gran escala de Secuenciación
(A) Esquema de la estrategia experimental para la preparación de cDNA resta bibliotecas y el análisis de la expresión diferencial.
Cálculo de los umbrales estadísticamente significativos de la
(A) Distribución de los
R
- Para la estadística indica peculiaridades y comparaciones pairwise biblioteca.
Microarray normalización de datos y análisis de esbozo
(775 KB PDF)
Microarray la normalización de datos, la evaluación, selección y Estadística
(A) Cuantiles en la normalización separados oligonucleótido chip subunidades.
Desregulado genes que se había informado anteriormente asociados con la AR
Las asociaciones se han identificado a través de la Biolab Experimento Auxiliar texto de minas software.
La validación de los resultados de perfiles de expresión
(A-C) SQ RT-PCR de los genes indicados cDNA de diferentes cantidades de artríticas o WT WJs, primaria FE (pSF) y inmortalizada FE (iSF). Bromuro de etidio de los productos manchados PCR se cuantificó con GelWorks 1D Avanzada (v. 4.01) y el software se normalizaron en contra de la expresión de B2M.
Los resultados de Expresión diferencial Sustractiva Bibliotecas en el 99,99% Especificidad
(32 KB XLS)
Los genes expresados diferencialmente en común de dos modelos animales de la AR Oligonucleotide de ADN Microarray Hybridizations al 95% Especificidad
(59 KB XLS)
GO "Proceso Biológica" Término de frecuencias para la Differentially genes expresados en Arthritic FE y WJs, seleccionados de ambos Sustractiva Bibliotecas y Microarrays
(24 KB XLS)

Este trabajo fue apoyado por: Comisión Europea subvención (QLG1-CT-2001-01407) para GK, VA, y HJT; subvención para la Investigación Avanzada y Innovational Programa de Investigación en ciencias de la vida al albergue; Evolutional de investigación principal de la Ciencia y la Tecnología concesión de Japón Corporación de Ciencia y Tecnología al albergue, y Ministerio griego de Desarrollo / Secretaría General de Investigación de subvención (GGET / IAP 041) a VA. Clínica muestras (muestras de tejido sinovial) fueron proporcionados por el BMBF-Leitprojekt "Proteom-Analyse des Menschen" (FKZ01GG9831-44). Los pacientes se obtuvo el consentimiento de acuerdo con las normas éticas nacionales, ya que éstos fueron ejecutados por la correspondiente comisión de ética locales.