PLoS Genetics, 2005; 1(4): (más artículos en esta revista)

El axón orientación gen receptor ROBO1 es un gen candidato para el desarrollo de la dislexia

Biblioteca Pública de la Ciencia
Katariina Hannula-Jouppi [1], Nina Kaminen-Ahola [1], Mikko Taipale [1], Ranja Eklund [1], Jaana Nopola Hemmi-[1], Helena [4] Kääriäinen, Juha Kere [1]
[1] Departamento de Genética Médica, Universidad de Helsinki, Finlandia
[2] Laboratorio Europeo de Biología Molecular, Programa de Expresión Génica, Heidelberg, Alemania
[3] Departamento de Pediatría, Hospital Jorvi, Espoo, Finlandia
[4] Departamento de Genética Médica, La Federación de la Familia de Finlandia, Helsinki, Finlandia
[5] Departamento de Genética Médica, Universidad de Turku, Turku, Finlandia
[6] Departamento de Biociencias Novum y en el Centro de Investigación Clínica, Instituto Karolinska, Estocolmo, Suecia
Resumen

La dislexia, o discapacidad específica lectura, es la forma más común de aprendizaje con un trastorno complejo, parcialmente base genética, pero sus mecanismos bioquímicos siguen siendo poco conocidos. Un locus en cromosomas 3, DYX5, se ha vinculado a la dislexia en una gran familia y sonido trastorno del habla-en un subconjunto de las pequeñas familias. Se encontró que el gen receptor de orientación axón ROBO1, ortólogos de los genes de Drosophila rotonda, se ve perturbado por una translocación cromosómica en una persona disléxica. En un gran pedigrí con 21 disléxicos individuos genéticamente vinculado a un determinado haplotipo de ROBO1 (no encontrados en ninguna otra cromosomas en nuestras muestras), la expresión de ROBO1 de este haplotipo se ausente o atenuados en los individuos afectados. Secuencia de ROBO1 en simios revelaron diferencias de codificación múltiples, y la presión de selección fue significativamente diferente entre los humanos, chimpancés, gorilas y rama en comparación con el orangután. También se identificaron nuevas exones y empalme de ROBO1 variantes que puede explicar la aparente diferencias fenotípicas entre humanos y ratones heterocigotos en la pérdida de ROBO1. Llegamos a la conclusión de que la dislexia puede ser causada por parciales haplo-insuficiencia de ROBO1 en raras familias. Por lo tanto, nuestros datos sugieren que una ligera perturbación en el axón neuronal cruce a través de la línea media entre los hemisferios cerebrales, dendrita orientación, u otra función de ROBO1 puede manifestarse como una lectura de la discapacidad en los seres humanos.

Introducción

La dislexia se refiere a una dificultad en la lectura y la escritura, a pesar de una inteligencia normal, sentidos, y una educación adecuada. La principal dificultad radica en el procesamiento fonológico, el rápido nombres, y el reconocimiento de fonemas [1]. La dislexia es un trastorno frecuente, que afecta a un 3% a 10% de la población [2]. No se ha informado de gemelos y de la familia y los estudios indican un fuerte componente genético en su etiología [3]. Hasta ahora, las pantallas de todo el genoma han vinculado a la dislexia loci de cromosomas 1p34-36 (DYX8), 2p16-p15 (DYX3), 3p12-q13 (DYX5), 6p21.3 (DYX2), 11p15.5 (DYX7), 15q21 (DYX1), 18p11.2 (DYX6), Xq27.3 (DYX9), y 7q32 ( Http://www.ncbi.nlm.nih.gov/omim ) [4 - 12]. El primer candidato dislexia susceptibilidad genética, DYX1C1 en 15q21, fue recientemente identificado, y una región que corresponde a DYX2 se ha reducido a un pequeño número de genes candidatos [12 - 16].

Hemos comprobado antes, una gran generación de la familia de cuatro personas incluyendo 21dyslexic disponibles para el estudio con dislexia severa segregar en una moda dominante, y preparó un mapa de susceptibilidad genética por un genoma-a una amplia exploración sobre la región de cromosomas 3, que fue nombrado el DYX5 locus [17 ]. A 20-cM largo haplotipo es compartida entre el 19 y el 21 de los individuos disléxicos, dando estadísticamente significativo apoyo a la cartografía de los genes, pero no suficiente resolución para identificar los genes [17]. Recientemente, el sonido del habla-trastorno se estudió en un gran conjunto de 77 familias de los Estados Unidos, con resultados apoyan la asociación de este trastorno a la DYX5 lugar en la mayoría de las familias [18]. Procesamiento fonológico es el componente común fenotípica encontrado deficiente en ambos estudios [17 - 19].

Presentamos aquí la localización de una translocación en una persona con dislexia y una translocación t (3, 8) (p12; q11) DYX5 a la región y específicamente a la primer intron de ROBO1. ROBO1 es un axón neuronal orientación gen receptor involucrado en el desarrollo cerebral, y, por tanto, un atractivo candidato de genes de susceptibilidad para la dislexia [20 - 22]. Además, en la gran pedigree con 19 disléxicos individuos genéticamente relacionado con DYX5 y más específicamente, y un haplotipo raro de ROBO1, la expresión de ROBO1 de este haplotipo se ausente o atenuados en los individuos afectados. Llegamos a la conclusión de que la dislexia puede ser causada por parciales haplo-insuficiencia de ROBO1. Además, se realizaron búsquedas de novela exones y empalme de ROBO1 variantes que pueden ayudar en la comprensión de la aparente discrepancia entre fenotípica heterocigotos Dutt1and Dutt1and Robo1 ratones knockout que desarrollar cánceres de pulmón y los linfomas Y los seres humanos, cuyo desarrollo fenotípicas consecuencia parece ser la dislexia.

Resultados

Hemos identificado un paciente que fue diagnosticado con dislexia y una translocación t (3, 8) (p12; q11) que supongan la DYX5 región. Vino a nuestra atención inicialmente a causa de la infertilidad. Tenía tres hermanos, uno de los cuales también fue diagnosticada con dislexia, pero dos de ellos fueron de inteligencia subnormal y, por tanto, no definido para la dislexia fenotipo. Fenotípica detallada comparación no es posible, porque los miembros de la familia no estaban disponibles para nuevas comprobaciones. El índice del paciente es el único portador translocación entre los hermanos y la probabilidad de poseer una translocación de novo (ver Materiales y Métodos para obtener detalles de la familia). A pesar de la discrepancia entre el estado y translocación de la dislexia aparente concordancia entre dos hermanos, decidimos la translocación de corte de ruta, con la esperanza de conocer a un posible gen candidato para proseguir con su evaluación en el informativo genéticamente gran familia [17, 19] . Se utilizó fluorescencia de hibridación in situ para optimizar el corte hasta una sonda de cromosomas artificiales bacterianos (BAC) clon RP11-143B12 hibridizada der a los dos cromosomas (3), así como el normal de cromosomas 3 (Figura 1 A). La secuencia genómica de clon RP11-143B12 corresponde a una secuencia de cromosomas 3 andamio Celera en la base de datos pública ( Http://public.celera.com/cds/login.cfm ) Y BAC AC117479 (43316-43873 de pares de bases [pb]) y AC117461 (50209-50745 bp) en el Centro Nacional de Biotecnología de base de datos ( Http://www.ncbi.nlm.nih.gov ) (Figura 1 C). Además de la identificación de corte se realizó por el sur de la hibridación con la PCR-amplificación genómica no repetitivas las sondas de ADN de fragmentos de la clon. A 971-bp sonda reveló reordenamientos del DNA, el perfeccionamiento de la corte a un 4,7-kilobase (kb) en el intervalo de Celera andamio secuencia o un intervalo de 4.0-kb correspondientes a los nucleótidos 57269-61233 de BAC AC117479 (Figura 1 B, y 1 D). Sorprendentemente, la translocación de corte ortholog localizados dentro de la rotonda de la Drosophila (robo) de genes, ROBO1, alternativamente empalmados y también llamado DUTT1 (suprimido en U Veinte Veinte), que la impida, ROBO1 entre los exones 1 y 2.

Debido a su conocida función en la orientación axón neuronal en el cerebro en desarrollo, ROBO1 era un candidato plausible de genes de susceptibilidad para la dislexia [20 - 22]. Hemos secuenciado su exones, sitios de empalme, 1 kb ROBO1 promotor de la región aguas arriba del exón 1, y la ampliación de 3 'UTR ROBO1 región de la variante 2 del ADN genómico de los disléxicos inicialmente una persona y sus padres (padre disléxicos, la madre no afectado) de El gran vínculo familiar (Figura 2 A). Todos los exones eran también de la secuencia de cDNA disléxicos otra persona de la familia extensa. Comparación de las secuencias a ROBO1and ROBO1and ROBO1 variante 2 secuencias reveló secuencia de las variaciones en total siete, dos de ellos conocidos anteriormente [23]. Todos los cambios observados se han confirmado en otros tres miembros pedigrí (disléxicos padre, hijo, madre y no afectado) de la secuencia. Disléxicos tienen dos personas en silencio polimorfismos de nucleótido único (SNP) en ROBO1 exones 12 y 18 (1741G> A, 2794C> A; numeración según ROBO1), un exonic 3-bp supresión y polimorfismo de inserción (DIP6203-6205; de numeración para ROBO1 variante 2), cuatro SNPs en 3 'UTR (UTR, 6227C> A, 6483T> A, 6651T> A, 6923T> G; numeración para ROBO1 variante 2), y cuatro intronic SNPs (intrón 2: 59567 Y intrón 7: 1451; numeración para BAC RP11-588D3; intrón 25: 16181 y 16198; numeración para BAC RP11-26M20) (Figura 2 B).

Genotipado de SNPs en el exonic otros diez miembros de la familia y dos no vinculados individuos no disléxicos confirmó que un determinado haplotipo SNP segregados con dislexia, en consonancia con los observados anteriormente vinculación, pero puso de manifiesto que ninguno de los polimorfismos se observó sólo en forma exclusiva los individuos disléxicos. Por ejemplo, el DIP6203-6205 * GAT + alelo tenían un alelo frecuencia de 22% (94/434 saludable entre el control de los participantes cromosomas) y no mostró asociación significativa a la dislexia en nuestra muestra de replicación conjunto de 96 disléxicos personas de otras familias. Ninguno de los cuatro observó intronic SNPs empalme alternativo producido variantes. ROBO1 Debido a que el gen se extiende sobre 990 kb de DNA genómico, y contiene en total más de 2200 intronic SNPs (de acuerdo a la base de datos NCBI SNP), su lista exhaustiva miembros de la familia en nuestra era poco práctica. De acuerdo con nuestra anterior genoma de exploración sobre la dislexia en Finlandia, lo que sugiere que DYX5 locus no participa en la mayoría de las familias [9], el mismo haplotipo como en esta gran familia no se observó en otros, que no guardan relación familiar (datos no publicados).

El silencio y 3 'UTR SNPs proporcionado ensayos para estudiar la transcripción de ROBO1. Nuestra lógica es el de evaluar si los dos alelos de ROBO1 eran igualmente transcrito en la separación de los individuos disléxicos dominante haplotipo de susceptibilidad. Comparación de la genómica y de ADNc muestras de cuatro individuos disléxicos ROBO1 mRNA mostró que era sólo débilmente o no en todos los transcritos del alelo que segregados con la dislexia (Figura 2 C), mientras que en los no lectores linfocitos, así como el control del cerebro de ARN, Bialélicas expresión es constantemente observado. De la nota, hay una variación considerable entre los individuos, lo que sugiere que la regulación de la expresión es compleja. El SNP 2794C> A es heterocigoto en un paciente, 6483T> A en el cuatro, 6651T> A en el cuatro, y 6923T> G en uno, y la combinación de todos los resultados, la expresión fue significativamente atenuada para la dislexia-vinculada alelo Según la medición de alturas alélica pico (p = 0,017 por dos colas prueba de t). Para verificar este análisis inicial, se repitió el ensayo de los cuatro disléxicos y cuatro participantes de la secuencia de control de la SNP 6483T> Una vez más. Los resultados de cinco o seis ensayos de repetirse la secuencia de cada uno de los participantes se muestra en la figura 2 D. Por las repetidas mediciones, la media del nivel de la expresión asociada a la dislexia alelo disléxicos en los participantes fue del 66% del mismo alelo en los controles (p <0,0004 por dos colas prueba de t). Para excluir la posibilidad de que un individuo se comportaba aberrantly SNP en el análisis, también secuenciado el SNP 6651T> A, produciendo resultados similares, y ambos ensayos combinados SNP, la observación de los desequilibrios alélicos de los casos frente a los controles fue altamente significativa (p < 0,00005 por prueba de t). Como no se SNP específico para la ROBO1 o DUTT1 transcripción sólo, no podemos evaluar isoforma-específicos baja regulación en la gran familia. En la translocación del paciente, dos SNPs en heterocigosis, tanto en la región correspondiente a los exones comunes a los dos ROBO1 y DUTT1 transcripciones (6651T> A y 6923T> G). Estos SNPs reveló dos alelos presente en cDNA en la translocación de pacientes, lo que sugiere que podría ser DUTT1 expresó biallelically a pesar de que la estructura genómica de ROBO1 fue interrumpido por una translocación en el cromosoma.

Para estudiar la posibilidad de que la supresión de la expresión de otros genes implicados en la dislexia ROBO1 haplotipo de susceptibilidad, SNPs genotipo conocido en la cercana genes GBE1 (341C / G, 646A / G, 1597A / G, 1794C / T, 2349T / G, 2363A / G, 2761A / T) y HTR1F (528C / T, 783T / A) en los cuatro disléxicos personas de la gran familia (Figura 1 C). Heterozigosidad se detectó por GBE1 SNPs 2363A> G y 646A> G en tres pacientes. Por estos polimorfismos, normal bialélicas expresión se observó en las tres muestras de los pacientes, en contraste con el hallazgo con ROBO1, lo que sugiere que la transcripción de ROBO1 fue específicamente silenciada. Hereditarios variación alélica en los niveles de expresión ha sido documentado por varios genes, y podrían surgir concebible por una serie de diferentes mecanismos, como la variación de potenciador y supresor de elementos, de empalme de la eficiencia, la transcripción estabilidad, la epigenética o de las modificaciones [24]. Otros dos genes candidatos posicionales, DRD3 y 5HT1F, mapeado fuera del haplotipo compartido [17].

Exonic aparentemente silenciosa y intronic polimorfismos relacionados con la enfermedad puede inducir empalme variantes [25]. Así, se estudió la posibilidad de ROBO1 splicing alternativo por RT-PCR de todos los exones ROBO1 y DUTT1 disléxicos de un individuo en la vinculación familiar, un control sanos no relacionados, y el cerebro humano adulto cDNA. Siete novela empalme variantes se detectaron. Su clonación y secuenciación reveló la exclusión de los exones 2 (88 bp, 89-169 de ROBO1), 19 (27 bp, ROBO1 de 2813-2829), y 29 (196 pb 4745-4939 de ROBO1) enteramente y exclusivamente de DUTT1 exón 2 (346 bp DUTT1 de 1019-1345), la inicial de 165 pb del exón 22 (3037-3201 de ROBO1); 905 bp que van desde los exones 24 a 28 (3603-4508 de ROBO1), y 878 pb que van desde 25 a exones 28 (3641-4528 de ROBO1) (Figura 1 D). No empalme fueron singularmente diferentes variantes entre disléxicos y control de los individuos, sin embargo, diferencias cuantitativas no pueden ser evaluados con fiabilidad. La comparación de las secuencias genómicas y de cDNA para DUTT1 en varias personas sugirieron que el exón 7 de DUTT1 no es colinear con secuencia genómica. En lugar de ello, DUTT1 bases 1891-1900 (gttgggtct: valina, glicina y serina), en el comienzo de DUTT1 exón 7 (ROBO1 exón 8) pertenecen a un nuevo exón corto, marcó el exón 7 ter (Figura 1 D) correspondiente a 5987 bases -- 5995 de BAC RP11-588D3. Estas bases han sido previamente reportados como parte de la DUTT1 gen, pero no están incluidos en la ROBO1 cDNA secuencia [23]. En todos los individuos por etapas, la secuencia de cDNA incluido el nuevo exón 7 ter, lo que indica que se ha incluido en los principales empalme en la forma al menos cerebro y lymphoblast ARN.

Como el conocido ROBO1 secuencia AF040990 parte de la transcripción de iniciación sitio, hemos tratado de determinar el ROBO1 5 'UTR por una secuencia BLAST búsqueda de las etiquetas de secuencias expresadas homóloga para el 5' ROBO1 región. La etiqueta de secuencia expresada AW450262, ROBO1 homólogas a los exones 1 y 2, indica un nuevo sitio (denominado ROBO1 exón a) antes de BAC AC125624 (bases 28508-28470) (Figura 1 D). RT-PCR con un primer ejemplo en el exón una secuencia y de los cebos en ROBO1 exones 1 y 4 adicionales revelaron un 52 bp (34119-34168 bases de BAC AC125815) 5 'del inicio de transcripción ROBO sitio en el exón 1, y también confirmó la presencia De la novela a en el exón BAC AC125624. Adicional se diseñaron primers 5 'a la novela exón a, y RT-PCR realizadas de manera similar que el anterior mostró el a exón que se extienden por lo menos 129 pb (28593-28466 bases de BAC AC125624). 5 'rápida amplificación de cDNA extremos (RACE) reveló adicional 326 bps, que se extiende a la exón 28919-28466 en el BAC AC125624.

Una importante fracción de los genes humanos ha sido objeto de selección darwiniana positiva desde el ancestro común de los chimpancés y los seres humanos [26]. Por ejemplo, FOXP2, el gen implicado en el habla y el lenguaje, ha experimentado un barrido selectivo durante la evolución humana [27]. Por lo tanto, secuenciados ROBO1 de chimpancé, el chimpancé pigmeo, el gorila y el orangután, y se utiliza ROBO1 secuencia de la rata como la salida fuera del grupo. Se utilizó la prueba de razón verosimilitud para analizar la variación en la presión selectiva en ROBO1 secuencia de los diferentes linajes. No sinónimos y sinónimos (dN y dS) ratio fue menor que 1 en todos los linajes, que implican a la purificación de la selección darwiniana. Sin embargo, la prueba de razón verosimilitud rechazó la hipótesis nula de fijo dN / dS ratio en todos los linajes. Un modelo en el que omega valor fue más alto en los linajes principales de los seres humanos, chimpancés, gorilas y fue significativamente mejor que un modelo de libre ratio (p <0.001) (Figura 3 y cuadros S1 y S2]. Esto sugiere que la presión selectiva para ROBO1 gen ha cambiado 12 al 16 de millones de años, después de la divergencia de la rama orangután.

Discusión

Nuestros datos sugiere que dos copias funcionales de ROBO1 se requieren en el desarrollo cerebral normal para adquirir la capacidad de leer, y parcial haplo-insuficiencia de ROBO1 pueden predisponer a los seres humanos concretos dislexia. Robo fue inicialmente identificado en Drosophila en la búsqueda de genes que controlan el cruce de la línea media Axones; robo en embriones mutantes, los axones cruz y recross a través de la línea media demasiadas veces [20 - 22]. La humanos ortholog de robo, ROBO1 (también llamado DUTT1), fue identificado como un posible gen supresor de tumor en una pequeña celda de la línea de células de cáncer de pulmón [28]. ROBO1 y DUTT1 se supone que son alternativa de empalme con diferentes variantes iniciales y exones Codones de iniciación y pueden tener funciones distintas en la parte [23]. Homocigotos Robo1/Dutt1 ratones knockout se embryonically letal, pero se encontraron ratones heterocigotos para desarrollar linfomas y adenocarcinomas de pulmón en alta frecuencia [29]. El locus humanos ROBO1/DUTT1 suprimido se ha encontrado en un niño con retraso del desarrollo y anomalías congénitas, pero sin cáncer [30]. Estas observaciones parecen plantear un dilema para la comprensión de las funciones de ROBO1 en diferentes especies.

Robo codifica una receptor transmembrana que pertenece a la superfamilia de inmunoglobulinas. Consta de dominios inmunoglobulina, fibronectina tres dominios, un dominio transmembrana, y un largo región intracelular sin motivos reconocibles, pero cuatro prolina ricos repite, que se proponen de actuar con habilitado, abelson, SH3 vinculante proteínas, y otras moléculas de señalización corriente abajo [ 20, 31]. Como se muestra en nuestros datos, ROBO1 sufre splicing alternativo en una forma más compleja que antes y aprecia las funciones de estas variantes alternativas de empalme son desconocidos. Es posible que todavía los diferentes promotores y empalme variantes en diferentes tejidos causa alternativa fenotipos. La translocación en nuestra paciente se altera específicamente ROBO1, pero no DUTT1, y, por tanto, no está en contradicción con las observaciones anteriores de DUTT1 como un gen supresor tumoral. Por lo tanto, postula que el empalme de las dos variantes en los seres humanos están asociados con diferentes funciones clave en diferentes tejidos: ROBO1 podría corresponder más estrechamente a las funciones en el cerebro humano que se basan en funciones por neuronal en la mosca de la fruta, y DUTT1 funciones parecen corresponder a El ratón modelo de tumorigénesis pulmonar.

En la mosca de la fruta, es un robo para los receptores de las proteínas secretadas repelente de hendidura y actúa como un guardián de cruce axonal en el eje izquierda-derecha. La activación de los axones robo hace indiferente a la chemoattractant netrin, un ligando del receptor DCC [32]. Netrin dependiente de la activación de los receptores de la DCC aumentos transitorios de fosforilación de ERK1, ERK2, y el factor de transcripción ELK1. La activación de la vía ERK se ha señalado como necesarios para la experiencia que dependen de la plasticidad y de la potenciación a largo plazo de la transmisión sináptica en la corteza visual de desarrollo en la rata [33]. Curiosamente, un posible sitio de unión ELK1 fue alterado y asociado a la dislexia en DYX1C1, un gen candidato para la dislexia en la susceptibilidad de cromosomas 15q21, y ELK1 ha sido implicado en el aprendizaje en la rata [13, 34 - 36]. Un papel funcional para sugirió DYX1C1 continúa sin confirmarse, ya que sus asociaciones no han sido replicados sin ambigüedades, dejando a la pertinencia de la ELK1 sitio de unión abierta [37 - 42]. Colapso / Robo / DCC señalización también ha sido implicado en la cortical dendríticas orientación y desarrollo [43, 44]. Además, recientemente identificado dislexia locus de susceptibilidad en Xq27.3 incluye la SLITRK2 y SLITRK4 genes, que corresponden a la ITSL y NTRK-al igual que la familia de genes implicados en el ratón neurite resultado y mostrar a la alta homología de proteínas de Corte [10, 45, 46] . Así, la identificación de ROBO1 como un gen de susceptibilidad en la dislexia puede implicar un importante desarrollo en el que la vía leve puede conducir a alteraciones específicas de la discapacidad de lectura.

Genómica secuencias y transcripciones para predecir ROBO1 en cuatro monos revelaron un alto grado de variación entre las especies y los seres humanos (Figura 3]. Hemos detectado siete aminoácidos cambios entre humanos y chimpancés y el 20 entre los seres humanos y orangutanes. Un análisis de dN / dS sustituciones reveló que la presión selectiva sobre ROBO1 ha cambiado después de la divergencia de la rama orangután. Aunque de acuerdo a unos criterios estrictos, sólo dN / dS ratios por encima de 1 se consideran como signos positivos de la selección, se ha demostrado que los genes expresados en el cerebro se encuentran bajo fuerte presión selectiva que los genes expresados, por ejemplo, en el hígado [47] . Además, en el cerebro de los primates muchos genes expresados muestran significativamente mayor dN / dS ratios de limpieza de los genes en comparación con los homólogos de roedores, a pesar de que la dN / dS ratios en primates están todavía muy por debajo de 1. Curiosamente, se acaba de poner de manifiesto que la evolución de SLIT1, un ligando para ROBO1, ha sido significativamente más rápido en los primates que en roedores [48]. También otras proteínas implicadas en axonal camino de la búsqueda, como SEMA4F y EPHA6, se demostró que han sido objeto de evolución adaptativa [48]. Proponemos que ROBO1 podría haber experimentado rápidos cambios en la reciente evolución de primates que pueden estar relacionados con sus funciones en gran parte no en el cerebro humano.

En conjunto, estos resultados implican una conocida vía de desarrollo neuronal de manera muy específica la función cognitiva en los seres humanos. Esta función atribuida aquí a la transcripción ROBO1 variante particular de las recién descubiertas exones es distinta de la función que se ha sugerido en la tumorigénesis de pulmón de la transcripción empalmados alternativamente variante DUTT1. Esta visión puede abrir nuevas perspectivas para la comprensión de complejos procesos cerebrales y proporcionar un marco para la construcción Comprobables hipótesis de la biología de la lectura.

Materiales y Métodos
Pacientes.

Un múltiplex de cuatro generación de la familia con dislexia severa segregar en una moda dominante (Figura 2 A) ha sido estudiado previamente por vinculación genética y fenotipo [17, 19]. La dislexia se diagnosticó en 27 de los 74 miembros de la familia de profunda evaluación que incluye un test de inteligencia, un finlandés lectura y escritura para adultos y para los niños de acuerdo a su grado escolar, y una batería de pruebas neuropsicológicas [49 - 52]. Detallada evaluación psicológica de esta familia se ha informado en otras partes [19].

Disléxicos Un individuo con una translocación equilibrada recíproca t (3, 8) (p12; q11) llegaron a nuestra atención, a causa de la infertilidad y se le diagnosticó oligoteratozoospermia. Él tiene tres hermanos, y los cuatro niños han sido evaluados neuropsychologically un especialista en el hospital. Sin embargo, los miembros de la familia no se disponía de pruebas y, por tanto, nuestros datos se basan en las historias clínicas. La translocación transportista y su hermana fueron diagnosticados con dislexia grave mientras que los otros dos hermanos han de inteligencia subnormal, pero no la dislexia. La madre se informó como un buen lector, pero no hay información sobre el rendimiento de la lectura se dispone a que el difunto padre. Los otros tres hermanos tienen un cariotipo normal, mientras que los padres no estaban disponibles para cariotipo. Debido a que el caso índice presentó con la infertilidad, pero en ninguno de ellos o de la historia se registraron abortos involuntarios de su madre, es probable que la translocación ha surgido de nuevo. Así, la translocación y la dislexia no parecer cosegregate en dos hermanos, pero como la dislexia es un complejo fenotipo, la inferencia no es concluyente para rechazar o confirmar una posible asociación causal de la translocación con dislexia en el caso índice.

Para los estudios de asociación, disléxicos y no disléxicos se contrató a personas no relacionadas de 23 familias y 33 no vinculados disléxicos y no disléxicos parejas del Departamento de Neurología Pediátrica en el Hospital del Niño y el Adolescente de la Universidad de Helsinki, y el Centro de Investigación de Niños, Jyväskylä , De Finlandia. Controles adicionales de la población constaba de 100 donantes de sangre anónimas. El diagnóstico y el grado de dislexia se determinó a través de la lectura y la ortografía finlandés pruebas diseñadas para niños y adultos [49, 50]. De Inteligencia de Wechsler fue estimada por las pruebas para adultos (WAIS-R) o para niños (WISC-R) [51, 52]. El diagnóstico de la dislexia incluyen normal desempeño cociente de inteligencia (PIQ> 85) y la notable desviación (en función de la edad, por lo menos dos años) en habilidades de lectura. Este estudio ha sido aprobado por la junta de examen de la ética de la Helsinki University Central Hospital, y se obtuvo el consentimiento de los participantes.

Fluorescencia in situ y el sur de la hibridación.

A136E9 clones YAC (Universidad de Washington, St Louis, Missouri, Estados Unidos), 34FC9, 15AC10, 39F13, 2DG9, 25DH8, 35AH8 (ICI / Zeneca), 912A11, 934E8, 422A6, 959F5, 650C2, 938D4, y BAC RP11 - 143B12 se utilizaron como sondas en la hibridación in situ por fluorescencia experimentos. La secuencia genómica de clon RP11-143B12 fue obtenido por BLAST de búsqueda con el BAC 5 'y 3'ends (AQ373182, T7, y AQ373179 Sp6, respectivamente) a una secuencia de cromosomas 3 andamio Celera en la base de datos pública ( Http://public.celera.com/cds/login.cfm ) Y BAC en el Centro Nacional de Biotecnología CBI base de datos ( Http://www.ncbi.nlm.nih.gov/ ).

Sur de hibridación sondas fueron PCR-amplificación genómica fragmentos de las regiones no repetitivas en el BAC clon RP11-143B12. El clon se repite en la secuencia fueron detectados por RepeatMasker ( Http://repeatmasker.genome.washington.edu/cgi-bin/RepeatMasker ) Y PCR primers fueron diseñados por Primer3 ( Http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ) Para abarcar no repetitivas segmentos de 700-1000 bp (ejemplo secuencias de los autores disponibles bajo petición). PCR ensayos se realizaron bajo condiciones estándar y 10 ng de los productos de PCR purificado (PCR purification kit Qiagen) (Qiagen, Valencia, California, Estados Unidos) y 10 ng de las sondas fueron purificados con la etiqueta [a-32P] dCTP (ADN Rediprime Sistema de etiquetado, Amersham Biosciences, Little Chalfont, Reino Unido). Secante y el sur de hibridaciones se realizaron mediante protocolos estándar con siete μ g de ADN de la translocación del paciente y un sano control individual en distintas reacciones digerido con BamHI, BglII, EarI, EcoRI, HaeII, HindIII, NcoI, y PstI (New England Biolabs, Beverly , De Massachusetts, Estados Unidos).

Polimorfismo ROBO1 selección de los análisis y de expresión.

Todos ROBO1 y DUTT1 exones se PCR-amplificado y secuenciado del ADN genómico y el cDNA de determinadas personas de la gran vinculación de pedigrí (Figura 2 A). Además, la novela exonic secuencias se identificaron y 2 kb ROBO1 promotor de la región aguas arriba de la novela a y el exón 3 'UTR de ROBO1 variante 2 fueron secuenciados. BAC correspondiente a los exones se identificaron a través de búsquedas BLAST. Primado muestras de ADN se obtuvieron del Instituto Coriell (Camden, Nueva Jersey, Estados Unidos) (Primado Grupo PRP00001) y orthologs de ROBO1 fueron secuenciados directamente después de PCR con cebadores específicos humanos.

ARN fue extraído a partir de linfocitos VEB transformado líneas celulares de cuatro disléxicos y cuatro lectores normales por gradiente de Ficoll centrifugación (Qiagen Rneasy kit de purificación) y RT-PCR se utilizó para amplificar cDNA segmentos que contienen heterocigotos SNPs en el ADN genómico. Como control, se utilizó ADN genómico de las muestras de los mismos individuos, así como cerebro ARNm (Clontech, Palo Alto, California, Estados Unidos). Todas las secuencias se realizó con tinte terminador-química y secuenciadores automáticos (ABI, Columbia, Maryland, Estados Unidos).

Para evaluar el alelo-específicas de expresión, hemos seguido un método estándar [53]. El ensayo se basa en la comparación de las alturas de pico alélica (en unidades arbitrarias) en la secuencia de cDNA (después de RT-PCR) y la secuencia genómica de cada individuo. Un alélica ratio se calcula para cada secuencia (por ejemplo, la altura del alelo A por la altura del alelo C). Debido a que la proporción alélica en secuencia genómica es, por definición, 1 (cada alelo está presente como una copia por genoma diploide), pero el valor real puede diferir de 1 (debido a las propiedades químicas de la secuencia de reacciones), la ratio de cDNA alélica valores se normalizaron Dividiendo por el coeficiente de genómica alélica en cada experimento. Para evaluar si el cDNA normalizado alélica ratios diferentes en pacientes disléxicos, en comparación con los controles, los valores de reproducir los experimentos se compararon entre los grupos por dos colas t-test. Para estimar el grado de atenuación de un alelo en pacientes disléxicos, la ratio media de cDNA alélica en pacientes disléxicos fue dividido por la media de cDNA alélica ratio en los controles. La desviación estándar de las mediciones se calculó sobre repetirse experimentos.

5 'RACE.

5 'RACE se realizó en cerebro humano utilizando el ARN SMART RACE cDNA Amplification kit (Clontech). 5 'termina cDNA se amplificó con el Primer Universal A y un Robo 5' RACE-R1 (gcagacgcagccctgcaacttt) primero, seguido de PCR anidada con el Primer A. Nested Universal productos PCR fueron purificados y secuenciados directamente (ABI).

Análisis evolutivo de ROBO1 secuencia.

Riesgo ratio de prueba se realizó con el programa Codeml de la PAML paquete [26].

Apoyo a la Información
Comparación de la
Ácido nucleico (según AF040990 exones del 1 al 29, NM_133631 exón 30) y de aminoácidos cambios se muestran para cada una de exón
ROBO1
En comparación con la correspondiente secuencia humana BAC; + indica la presencia de un cambio en una especie no humana. Aminoácidos cambios son sombreado. No se observaron diferencias para
DUTT1
Exón 1.
Análisis de la Evolución ROBO1 con PAML
Riesgo valores y parámetros de las estimaciones según los distintos modelos

Este estudio fue apoyado por Sigrid Jusélius Fundación, la Academia de Finlandia, y la Agencia de Desarrollo de Tecnología de Finlandia (Tekes). JK es miembro de Biocentrum Helsinki y en el Centro de Excelencia para las Enfermedades Genética en la Universidad de Helsinki.