BMC Infectious Diseases, 2005; 5: 82-82 (más artículos en esta revista)

Válvula protésica endocarditis causada por Pseudomonas luteola

BioMed Central
Jean-Paul Casalta (jean-paul.casalta @ wanadoo.fr) [1], Pierre-Edouard Fournier (Pierre-Edouard.Fournier @ medecine.univ-mrs.fr) [1], Gilbert Habib (gilbert.habib @ ap - Hm.fr) [2], Alberto Riberi (alberto.riberi @ pa-hm.fr) [3], Didier Raoult (didier.raoult @ medecine.univ-mrs.fr) [1]
[1] Laboratoire de Microbiologie, IFR 48, Centro Hospitalario-Universitario de La Timone, 264 rue Saint Pierre, Marsella, Francia
[2] Servicio de Cardiologie, Centre Hospitalier Universitaire de La Timone, Marsella, Francia
[3] Servicio de Chirurgie Cardiaque, Centro Hospitalario Universitario de La Timone, Marsella, Francia

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Pseudomonas luteola ha sido reconocido como una causa rara de bacteriemia y de las infecciones en pacientes con trastornos médicos subyacentes

Asunto presentación

Estamos aislados p. Luteola de cutures sangre en un paciente con endocarditis de válvula protésica desarrollado 16 meses después de la cirugía cardíaca.

Conclusión

P. luteola es una rara agente oportunista, con una propensión de infectar a las prótesis valvulares.

Antecedentes

Pseudomonas luteola (p. luteola) es un aerobios, Gram-negativos varilla con un distintivo amarillo a naranja pigmento. Después de 48 horas de incubación, las colonias suelen ser ásperas o arrugada. El organismo es no fermentativas, oxidasa-negativo, catalasa-positivo, y crece en agar MacConkey [1]. El organismo originalmente denominada p. Luteola. Sobre la base de los bajos niveles de ADN-DNA, que fue posteriormente reclasificado como Chryseomonas luteola [1]. Anzai et al. [2], en un análisis de las secuencias de 16S rDNA de estos organismos, ha indicado que nombres de género Chryseomonas, Flavimonas y Pseudomonas son sinónimos. En consecuencia, se llegó a la conclusión de que los nombres p. Luteola y Pseudomonas oryzihabitans debe utilizarse. El hábitat normal de p. Luteola no está clara, a pesar de que pertenece a un grupo de bacterias que normalmente se encuentran en el agua, el suelo, la humedad y otros entornos [3, 4]. Informó de infecciones humanas son poco frecuentes.

Asunto presentación

En julio de 2003, a 53 años de edad, el hombre fue admitido en el hospital de Timone en Marsella, Francia, que presentan signos clínicos de endocarditis aguda. Tenía una fiebre de 39 ° C que se prolongó durante dos semanas, anorexia, pérdida de peso de 7 kg desde diciembre de 2002, un derrame cerebral con hemorragia intracraneal, y la embolia arterial femoral. Él había tenido un reemplazo de aorta por una bioprosthesis en marzo de 2002 por insuficiencia aórtica. En febrero de 2003, el paciente fue hospitalizado por fiebre ondulante (38,5 ° C) que ha durado los últimos 3 meses. La ecocardiografía mostró transeosophageal ni disfunción valvular ni vegetación. Seis hemocultivos fueron negativos. El paciente fue tratado con amoxicilina (1 g dos veces al día por vía oral) durante 8 días. La fiebre persistía, pero se redujo a un nivel de 37,8 ° C. En julio de 2003, después de su admisión, la ecocardiografía (ecocardiografía transesofágica multiplano) mostró una vegetación en la válvula aórtica bioprótesis medición de 30 mm en su máximo, y una regurgitación valvular de grado IV. Los glóbulos blancos fue de 14,36 × 10 9 / L (92,7% polimorfonucleares, linfocitos 5,0%, monocitos 2,3%), el nivel de hemoglobina fue de 90 g / L, la velocidad de sedimentación globular (VSG) fue de 50 mm / h (Primera hora), el nivel de proteína C reactiva fue de 208 mg / l. No se detectó factor reumatoide. Los tres hemocultivos aerobios, así como los retirados arrojó un trombo arterial femoral Pseudomonas luteola (p. luteola) dentro de las 48 h de la cultura. El microorganismo fue identificado utilizando tanto la API 20 E (Biomerieux, Marcy l'Etoile, Francia) y el API 20 NE galerías (Biomerieux). La identificación fue confirmada por su secuencia 16S rDNA usando el fD1 (AGAGTTTGATCCTGGCTCAG) y rP2 (ACGGCTACCTTGTTACGACTT) primers a lo descrito previamente [2, 5 - 7]. La secuencia de nucleótidos (GenBank número AY574976 ) Se comparó con secuencias disponibles en el GenBank utilizando la versión 2.2.9 del software BLAST (Centro Nacional de Información de la Biotecnología) y mostró 99,7% de similitud con la secuencia de ADNr 16S p. Luteola (GenBank número D84002 ). El paciente fue aislado susceptibles a la ampicilina, ureidopenicillin, las cefalosporinas de tercera generación, fluoroquinolonas y aminoglucósidos. El paciente fue tratado por vía intravenosa con ticarcillin + ácido clavulánico (3 g de cinco veces por día) durante 60 días, y gentamicina (210 mg una vez al día) durante 15 días. La alta dosis de ticarcillin + ácido clavulánico se justifica por la participación cerebral. En el curso del tratamiento antibiótico, la fiebre y la reanudación de la condición del paciente mejoró. Sin embargo, el empeoramiento de la insuficiencia aórtica llevado a la sustitución de la válvula aórtica bioprothetic día 76 después de su ingreso. Examen macroscópico de la válvula aórtica mostró extensa vegetación. Examen microscópico mostró características típicas de endocarditis infecciosa [8]. El cultivo bacteriano de la válvula fue negativo. El 16S rDNA PCR realizadas en el tejido valvular fue negativo. Después de la cirugía cardíaca bajo circulación extracorpórea, la paciente desarrolló inestabilidad hemodinámica e insuficiencia renal que requiere una hospitalización prolongada. El paciente fue liberado de hospital, en febrero de 2004, 7 meses después de la admisión.

Informó humanos p. Luteola infecciones son poco frecuentes. Estas han incluido una septicemia en un paciente con lupus eritematoso sistémico bajo tratamiento con corticosteroides que desarrollaron pancreatitis hemorrágica complicada por un absceso pancreático [5]; uno de los casos de bacteriemia en pacientes previamente sanos con hepatitis granulomatosa [9], una bacteriemia en un paciente con Peritonitis [10], y no bacteriémica casos de peritonitis asociada con gangrenous appendititis [10] y la diálisis peritoneal ambulatoria continua [11]. La bacteriemia se ha observado también en pacientes con catéteres vasculares inhabitación [10 - 12]. Otros aislados clínicos se han recuperado del hueso de un paciente con un absceso fémur [10]; de un paciente con un absceso subphrenic [10]; de las heridas y el líquido cefalorraquídeo de pacientes neuroquirúrgicos dural con injertos de hueso o colgajos [13]; De un paciente con VIH / SIDA con infección cutánea invasoras [3], y de un paciente con celulitis facial [11]. Sobre la base de nuestros conocimientos, sólo dos casos de endocarditis causada por P. Luteola han sido reportados en pacientes con prótesis de válvulas cardiacas [13, 14]. Estos pacientes habían desarrollado fiebre y hemocultivos creció p. Luteola 15 días [13] y 45 días [14], respectivamente, después de la cirugía cardíaca. Además, uno de los casos de P. Luteola septicemia que se ha descrito en el 5 meses de edad infantil después de la cirugía a corazón abierto para la enfermedad cardíaca congénita [3]. Septicemia fue diagnosticado 8 días después de la cirugía, pero no se encontró endocarditis. En el presente caso, ya que el paciente no someterse a cualquier procedimiento invasivo entre el 2002 la sustitución valvular y de la aparición de fiebre, creemos que fue infectada durante el período inicial de la cirugía cardíaca.

Conclusión

Utilizando el servicio de los criterios de Duke endocarditis, nuestra paciente fue clasificado como un una clara endocarditis (valvular examen histológico confirmó el diagnóstico de endocarditis infecciosa). El aislamiento de P. Luteola en 3 hemocultivos y en el trombo arterial demostrado su papel como agente etiológico. La inclusión de nuestro paciente, con endocarditis p. Luteola se ha producido en tres pacientes que se habían sometido a la sustitución valvular. Esto sugiere que este organismo es un agente oportunista poco frecuente, con una propensión de infectar a las prótesis valvulares.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

JPC aislado el microorganismo, que se inició el tratamiento con antibióticos, y redactó el manuscrito; PEF identificado el microorganismo y redactó el manuscrito; GH realizó la echocardiograms y redactó el manuscrito; AR realizó cirugía valvular y redactó el manuscrito; DR ayudó a redactar el manuscrito.

Historia previa a la publicación

La historia previa a la publicación de este documento puede accederse en:

Agradecimientos

Se obtuvo el consentimiento de la paciente