Plant Methods, 2005; 1: 7-7 (más artículos en esta revista)

Tipo de células específicas de caracterización de contenido de ADN nuclear dentro de complejos tejidos y órganos

BioMed Central
Changqing Zhang (cqzhang@ag.arizona.edu) [1], Fang Cheng Gong (Fangcheng.Gong @ operon.com) [1], Georgina M Lambert (georgina@ag.arizona.edu) [1], David W Galbraith (Galbraith@arizona.edu) [1]
[1] Department of Plant Sciences, The University of Arizona, Tucson, Arizona, 85721, USA
[2] Operon Biotechnologies, Inc, 2705 Artie Street Bldg. 400, Ste. 27 35805, EE.UU.

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Organismos eucariotas se definen por la presencia de un núcleo, que encierra el ADN cromosómico, y se caracteriza por su contenido de ADN (C-valor). Complejo organismos eucariotas contienen órganos y tejidos que componen interspersions de diferentes tipos de células, en el que polysomaty, endorreduplicación, y la detención del ciclo celular es frecuentemente observada. Poco se sabe acerca de la distribución de C-valores a través de los diferentes tipos de células dentro de estos órganos y tejidos.

Resultados

Hemos desarrollado, y describir aquí, un método para definir con precisión el estatuto de C-valor dentro de cualquier tipo específico de células complejas dentro de los órganos y tejidos de las plantas. Nos ilustran la aplicación de este método a la Arabidopsis thaliana, centrándose concretamente en los diferentes tipos de células encontradas dentro de la raíz.

Conclusión

El método con precisión y convenientemente cartas C-valor dentro de tipos de células específicas, y proporciona nuevos conocimientos en los procesos de desarrollo. El método es, en principio, aplicable a cualquier organismo transformables, incluidos los mamíferos, en el que tipo de células especificidad de la regulación de endorreduplicación, de polysomaty, y de la detención del ciclo celular se sospecha.

Antecedentes

La cantidad de ADN contenida en un núcleo de los eucariotas haploides organismos que se denomina C (constante) de valor [1]. Para muchos eucariotas, el núcleo de las células somáticas contienen una cantidad de ADN 2C, y la creciente participación de las células en un simple ciclo celular mitótico en la que cuatro fases vinculadas temporalmente-, G1, S, y G2 M, servirá para separar los procesos de duplicación del ADN (Fase S) de la segregación cromosómica (M-fase). Monosomatic tejidos que contienen células mitotically activa, por lo tanto, se caracterizan por tener células contenido de ADN nuclear que van desde 2C a 4C, dependiendo de la posición de las células en el ciclo celular. Las proporciones de las células dentro de estas fases es una función de las proporciones de las células que están activamente en bicicleta y el grado de sincronía ciclo, y, evidentemente, también refleja si las células están detenidos en determinados puntos dentro del ciclo celular, más comúnmente G0/G1 (2C) o G2 (4C). En polysomatic tejidos, la situación se complica por la aparición de una alternativa del ciclo celular, denominado endorreduplicación, en la que sucesivas fases S-no son seguidas por fases-M. Esto produce células uninucleate haber multiplicativo contenido de ADN (2 C n, donde n = 1,2,3 ..., en la mayoría de las fuentes de células somáticas, y 3 × 2 n-1 para el C endoreduplicated endospermo triploide derivados de células progenitoras) . Polysomaty es particularmente común en plantas superiores [2]; para algunas especies, como el A. Thaliana, que se encuentra en toda la madurez de los tejidos del organismo [3], mientras que en otros se limita a los tejidos específicos [4].

La importancia funcional de la situación nuclear de la C-valor en el que la síntesis de ADN detenciones sigue siendo oscuro, en parte debido a la falta de métodos fáciles y precisos para determinar su incidencia en función de determinados tipos de células. Es evidente que, en el análisis de la expresión de genes de desarrollo y de la biología celular en que su regulación, el valor de C-nuclear representa un importante parámetro que refleja tanto el estado del ciclo celular de la célula en el que se encuentra el núcleo, así como la participación De las células de los tejidos polysomatic dentro de los ciclos de endorreduplicación. Por el contrario, la detención regulado de la celda en concreto nuclear C-valores refleja las actividades de los mecanismos de regulación sobre las que sabemos muy poco.

Nos pregunta si nuestros métodos de citometría de flujo para el análisis de los valores de C-nuclear [5] puede ser combinado con transgénicos expresión de una versión orientada nuclear de la Proteína Verde Fluorescente (GFP) bajo la regulación de las células de tipos específicos de los promotores, lo que permite a Análisis de la C-valor situación de tipos de células específicos. Estamos motivado que el etiquetado de los núcleos de determinados tipos de células con las buenas prácticas agrarias que permitan su detección mediante citometría de flujo y, simultánea a través de análisis de ADN biparametric contenido, llevar a su cesión a diversas clases C-valor. En este informe, que validar este enfoque experimental, la descripción de recombinación del ADN que codifican las construcciones Fluorescent Protein (FP)-fusiones que estén debidamente orientados al núcleo, y que son cuantitativamente mantenerse dentro de los núcleos de células después de la homogeneización. Pasamos a describir las condiciones para confocal examen de las plantas transgénicas que muestran una serie de diferentes tipos de células específicas de los patrones de expresión, y para el análisis de citometría de flujo homogeneizado preparado a partir de estas plantas. Por fin podemos emplear el método para descubrir pruebas de tipo de células específicas de la detención de determinados tipos de células en diferentes estados C-valor. La importancia de estas observaciones se discute.

Resultados

El proyecto experimental concepto requiere que sea posible objetivo de las buenas prácticas agrarias, o de otras proteínas fluorescentes, a los núcleos de plantas transgénicas bajo el control del tipo de células específicas de los promotores, que los núcleos pantalla fluorescente señal suficiente para ser detectables por microscopía y citometría de flujo, Que la señal de las buenas prácticas agrarias basadas en no interferir con el flujo counterstaining y análisis de contenido de ADN nuclear, y que las buenas prácticas agrarias basadas en la fluorescencia se mantenga dentro de los siguientes núcleos de la homogeneización y en el análisis de la corriente. Para ser útil al máximo, el concepto y los procedimientos deben ser aplicables a las plantas que tengan los pequeños (cf. A. thaliana), así como de los genomas más grandes.

Para poner a prueba este concepto, se emplearon A. Thaliana, una planta modelo de las especies para los que una única suma global de la información molecular disponible. A. Thaliana también comprende uno de los más pequeños genomas nucleares dentro de las plantas con flores [6], por lo cual constituye una excelente prueba del límite inferior de la resolución de los métodos. Por nuclear de etiquetado, que evaluó el desempeño de una serie de fusiones de traducción de las proteínas nucleares con las buenas prácticas agrarias. Óptima para nuestro propósito era una fusión de las buenas prácticas agrarias con la región de codificación de un gen histona 2A (HTA6; At5g59870). En el marco del control transcripcional del virus del mosaico de la coliflor (CaMV) 35S promotor, transgénicos A. Thaliana plantas expresando HTA6-GFP eran fenotípicamente normal, y se muestran brillantes fluorescentes núcleos dentro de todas las partes de la planta (Figura 1]. Los núcleos de brillo similar se observó para las plantas transgénicas que expresan HTA6-YFP. No efectos de los transgénicos GFP expresión se detectaron en la planta fresca pesos o las tasas de crecimiento de las raíces (Figura 2], o mediante el uso de todo el genoma largo oligonucleótido microarrays para vigilar las alteraciones en la expresión de genes (datos no publicados).

Estamos concomitantemente optó por centrarse en las raíces de la planta: las raíces de muchos cultivos importantes y modelo de las especies son polysomatic o bien forman una gran parte de las células detenidas en una 4C contenido de ADN nuclear (Figura 3]. Por ejemplo, el análisis de la corriente de uniparametric raíz homogeneizado preparado a partir de la 1 cm regiones apical de la raíz primaria de los diez días de edad A. Thaliana plantas identifica cuatro núcleos de población (Figura 3A], igualmente espaciados a lo largo del eje de contenido de ADN (escala logarítmica) correspondiente a los núcleos, respectivamente, de haber 2C, 4C, 8C, 16C y contenido de ADN. También se observó Polysomaty de puntas de raíces de pepino, guisante, y el tomate. Para las otras especies examinadas (tabaco, Vinca, maíz, arroz, y zanahoria), polysomaty estaba ausente, pero para el maíz, el tabaco, petunia y Vinca, una gran minoría de la población representada nuclear haber 4C núcleos de las células (ver también [5] ). Nuestras observaciones son consistentes con otras compilaciones [4].

El examen de las raíces de tipo silvestre y transgénico A. Thaliana plantas expresando HTA6-GFP se realiza mediante microscopía confocal. El confocal de las imágenes y los correspondientes análisis de citometría de flujo biparametric de las buenas prácticas agrarias y ADN contenido de sus núcleos se presentan en la Figura 4. Wild-mostrar ningún tipo de plantas nucleares GFP fluorescencia y, en el análisis de flujo (Figura 4A], los cuatro núcleos de población, correspondiente a la 2C, 4C, 8C, 16C y núcleos, están ubicados cerca de la abscisa. En comparación, las raíces de las plantas que expresan constitutivamente HTA6-GFP bajo el control del promotor CaMV 35S figura verde fluorescente-núcleos, y el flujo histogramas mostrar agrupaciones de núcleos correspondiente en el contenido de ADN a 2C, 4C, 8C, y 16C, sino también la producción de Una señal de las buenas prácticas agrarias que se incrementa con el contenido de ADN (Figura 4B]. El intranuclear GFP fluorescencia fue estable durante el período de tiempo después de la homogeneización necesarios para el análisis de flujo (Figura 5A], y los importes de intranuclear GFP fluorescencia escala linealmente con el contenido de ADN nuclear (Figura 5B]. Por último, las proporciones de los núcleos dentro de las diferentes clases de C-valor no fueron significativamente diferentes cuando de tipo salvaje y las plantas transgénicas fueron comparados (Figura 6]. Dentro de los 10 mm apical de la A. Thaliana primaria de raíz, por lo tanto, existen 2C, 4C, 8C, 16C y células, y el núcleo de estas células parecen igualmente capaces de acumular las buenas prácticas agrarias que llevan la etiqueta de histonas H2A.

Seguidamente se pregunta si la presencia de núcleos de las diferentes clases de C-valor podría estar asociado con determinados tipos de células raíz o sub-regiones. Para abordar esta cuestión, hemos producido plantas transgénicas que expresan HTA6-GFP bajo el control de ambos tipo de células específicas y específicos de la región secuencias reguladoras. Las plantas transgénicas que expresan HTA6-GFP bajo el control de la Sultr2 Sultr2-1 promotor [7] exhibido GFP fluorescencia nuclear limitada a los floema compañero de células (PCC; Figura 4F]. Reglamento de HTA6-GFP expresión de los promotores de la SCARECROW (SCR), y SHORTROOT genes (SHR) dio lugar a una restricción de la GFP fluorescencia (Figuras 4D y 4E], respectivamente, a los núcleos de la endodermis, la corteza / endodermales iniciales, y la Quiescente centro, y para los núcleos de la estela (la pericycle internos y tejido vascular) [8, 9]. Reglamento de expresión por parte del promotor de un gen que codifica la proteína 16B de la subunidad ribosómica gran resultado en fluorescencia nuclear más en general, localizadas en la región meristemáticas (Figura 4C]. Análisis de citometría de flujo indicó que homogeneizado PCC y la estela que figura exclusivamente 2C y 4C núcleos, al igual que las células en el meristemo. En contraste, las células endodermales predominantemente figura 4C y 8C núcleos (Figura 7].

Para explorar si la ocurrencia de 4C y 8C núcleos está directamente correlacionado con SCR expresión, examinamos la distribución de los valores de la C-GFP-positivas núcleos dentro de la producción de plantas transgénicas supernumerarios endodermales capas de células, como consecuencia de la expresión ectópica de SHR bajo el control Promotor de la SCR [10]. Estas plantas transgénicas que figuran diversas proporciones de tales células supernumerarios, claramente identificados por la presencia nuclear de las buenas prácticas agrarias (Figura 8A]. La proporción de GFP-4C núcleos positivos se elevó de manera espectacular en comparación con el control de tipo salvaje y en comparación con el total de la distribución de los núcleos dentro de las plantas transgénicas (Figura 8B, 8C]. En cambio, no se observaron diferencias en las proporciones de todos los núcleos dentro de las diversas clases de C-valor cuando transgénicas y plantas silvestres-tipo se compararon.

Discusión

El método descrito se basa en la orientación de buenas prácticas agrarias para el núcleo, y su retención en el núcleo celular durante la homogeneización y análisis de citometría de flujo. En trabajos anteriores, hemos descrito el uso de una señal de localización nuclear del tabaco para obtener un quimérico proteína que comprende la región de codificación completa de β-glucuronidase fusionado a GFP [11, 12]. Aunque esta molécula se dirija efectivamente a la nucleoplasm in vivo, parece que poco a poco fuera de los núcleos de fugas después de la homogeneización. Esta no es una cuestión para el análisis de citometría de flujo de los núcleos que tengan gran contenido de ADN, como el tabaco, ya que la señal de las buenas prácticas agrarias nuclear sigue siendo muy por encima del nivel de detección de antecedentes de la corriente cytometer para períodos de tiempo razonable después de la homogeneización [12]. En cambio, para las plantas que tengan el genoma nuclear pequeño tamaño, como el A. Thaliana, el pequeño tamaño de los núcleos y la escasa amplitud de la señal de las buenas prácticas agrarias, unida a las fugas de estas moléculas, nucleoplasmic significa que la orientación no es apto para el análisis de citometría de flujo de núcleos aislados. Este problema se puede evitar mediante el empleo de la orientación como la señal de una proteína nuclear que representa un componente estructural del núcleo, en este caso HTA6 histonas. Constitutiva transgénicos HTA6 expresión de la proteína de fusión GFP-no tiene ningún efecto detectable sobre el crecimiento de las plantas o de desarrollo. Curiosamente, la expresión constitutiva de la GFP-HTA6 (es decir, a la inversa de orientación) proteína de fusión también no tiene efectos notables sobre el crecimiento y el desarrollo (datos no presentados). Esto es coherente con nuestra comprensión de las estructuras tridimensionales de las histonas [13]. Por HTA6, tanto la N-y C-termini están expuestos en la superficie nucleosomal y, de los 13 predijo A. Thaliana H2A proteínas (HTA; http://www.chromdb.org], HTA6 tiene el segundo más largo de la N-terminal (14 bis), y el más largo C-terminal (21 bis).

Las pautas que se observan dentro de las dos dimensiones distribución de frecuencias producidas por citometría de flujo indican que una mayoría de las células de la raíz de las plantas transgénicas contienen núcleos verde fluorescente, lo que confirma que el promotor CaMV 35S es activo en el desarrollo de los distintos tipos de células presentes en el Analizaron región [14]. El hecho de que HTA6-GFP fluorescencia escalas lineal y muy precisamente con el ADN contenido implica la acumulación de las histonas nucleares 2A está estrechamente correlacionada con el contenido de ADN. Esta observación, unida a la falta de filtración de HTA6-GFP de los núcleos en homogeneizado, es coherente con la hipótesis de que la mayoría de los HTA6-GFP es complejo dentro de la cromatina en lugar de ser libre dentro de la nucleoplasm.

Aunque las dos dimensiones distribuciones de frecuencias de proporcionar una identificación inequívoca de los valores de contenido de ADN de las buenas prácticas agrarias que llevan la etiqueta núcleos, de estos, para que sea significativo, es fundamental que la expresión de GFP-HTA6 no perturbar la gestión del sistema en estudio. En la medida de lo que podemos decir, este parece ser el caso: no se observaron diferencias fenotípicas entre transgénicos y plantas de tipo salvaje, ni visto diferencias en las proporciones de los núcleos dentro de las diversas categorías C-valor. Cabe señalar que la misma estrategia de citometría de flujo deben ser técnicamente aplicable a las plantas transgénicas que expresan cualquier GFP (u otros FP) de que la fusión responde a la necesidad de mantenerse y en el núcleo, con la misma salvedad de que tal expresión no perturbar la gestión del sistema en estudio.

La observación del tipo de células específicas de los patrones de valor de la C-sugiere que el aumento de contenido de ADN nuclear representa una estrategia de evolución de organismos multicelulares para especificar tipos de células. En la medida de lo sabemos, esta es la más precisa evidencia experimental se basa esta idea bastante simple en plantas superiores, y la aplicación de este método a otras situaciones en las que el aumento de contenido de ADN se asocia con el tipo de diferenciación de células deberían proporcionar rápidamente un valioso conjunto de datos . Por ejemplo, en otros trabajos, se ha planteado la hipótesis de que las células basales en el xilema pericycle celdas de detención en el G2, lo que se convierten en susceptibles a la auxina mediada por señales que activan el primer divisiones formativas conducentes a raíz lateral iniciación [15 - 18]. De acuerdo con esta hipótesis, los genes característicos de la G2 / M frontera son inducidos en forma coordinada A. Thaliana poco después de la imposición de condiciones que conducen a la inducción de la sincronizada lateral raíces [18].

En estas dos situaciones, el tipo de células especificación aparece asociada con un aumento en la proporción de células que contienen los núcleos 4C. En el nivel de análisis citológico, esta situación puede surgir a través de G2 detención de las células en un monosomatic diploide del ciclo celular, o, por igual-así, a través de G1 detención de las células que han entrado en la primera endoreduplicative ciclo celular (es decir, que se ha convertido tetraploide). Que complica el análisis citológico es el potencial de formación de politenizadas cromosomas. Más experimentos que, evidentemente, la obligación de aclarar la situación, y los métodos de hibridación in situ utilizando endógeno [19 - 22] y marcadores cromosómicos transgénico [23] debe demostrar un valor incalculable.

A nivel molecular, muchos candidatos para los reguladores del ciclo celular responsables de la acumulación de células 4C se pueden identificar de acuerdo con el actual cuerpo de conocimientos para otros organismos eucarióticos [24, 25], y para que las nuevas plantas, sobre todo A. Thaliana. Estos incluyen las ciclinas, que estén específicamente activo durante el G2 / M transición [26], dependientes de ciclina mitótica quinasa y sus activadores e inhibidores [27 - 34], la promoción de complejos anafase (APC) y componentes que interactúan con la APC [24, 35, 36], y de moléculas asociadas a los puestos de control en relación con el tamaño de la célula [37, 38], la radiación daño [36, 39], y husillo asamblea [36].

Los mecanismos que regulan el ciclo celular y el contenido de ADN nuclear en el endodermales células corticales y también puede reflejar la naturaleza de la SCR y SHR genes, que codifican miembros de la familia STAT-GRAS de factores de transcripción [40, 41]. Otros miembros de esta familia han demostrado interactuar con los reguladores del ciclo celular [42 - 44]. Una de las funciones de SHR y / o SCR puede ser la de detener el ciclo celular diploide dentro de las células endodermales en el G2 / M frontera, y quizás también para regular una endoreduplicative caso de la conversión de estos núcleos de una G2 a G1 estado sin un intervalo de la fase M . De los 30 genes que se encuentran más fuertemente-o hacia abajo hasta reguladas dentro de la endodermis [45], uno de los candidatos para una función reguladora es At5g26900, ya que presenta homología a fizzy1 de X. Laevis, que es necesaria para la activación de APC en ese sistema [46].

Curiosamente, los últimos informes adicionales implican expresión de los miembros de la familia STAT GRAS-en el establecimiento de nodulación en Medicago truncatula [47, 48]. Tomamos nota de que la citometría de flujo método descrito aquí debe ser apropiado para la determinación inequívoca de la C-la categoría de valor de la raíz de las iniciales responden a las señales de nodulación, y de los diferentes tipos de células que posteriormente se desarrollan durante la formación de nódulos de la raíz. Si el desarrollo de nódulos puede demostrar específicamente a la participación de las células G2-detenido dentro de la corteza de raíz, esto implicaría la co-opción de los mecanismos celulares que normalmente regulan la formación de raíces laterales.

En general, el método descrito en el presente informe debería ser aplicable a cualquier transformable dentro de las especies de plantas que regula la expresión de GFP-HTA6 resultados en núcleos fluorescentes. Para los promotores de baja actividad, de acoplamiento de las buenas prácticas agrarias expresión nuclear de los sistemas de amplificación (por ejemplo proporcionado por GAL4/VP16 [49]] pueden ser requeridos. Orthologues de histonas 2A debe ser de fácil acceso para la mayoría de las especies, y hemos establecido que una fusión GFP al arroz HTA6 orthologue se dirige al núcleo de las plantas de arroz transgénico (CQZ, C. Santhosh Kumar, V. Sundaresan, y DWG, inédito Resultados). Planta de tipos de células para que la determinación del contenido de ADN nuclear debería ser de particular interés son los que se someten a los ciclos de endoreduplicative regulados, como el encontrado en el desarrollo de los tejidos de almacenamiento de las semillas [50], en el marco de tricomas en desarrollo [51], y en el establecimiento de la simbiosis [52 ], Ya que el método no se limita a las células que operan dentro de un ciclo convencional de células diploides. El método también debería ser útil para aclarar informes de la inesperada aparición de la mitosis de reducción dentro de las células endoreplicated [27]. También debería ser posible desarrollar métodos de citometría de flujo multiparamétrico de la combinación de la identificación de la C-valores de los núcleos de determinados tipos de células con una determinación de la ocurrencia de la fase S-(basándose en la detección de anticuerpos basados en la incorporación de bromodeoxyuridine [53]]. Esto permitiría determinación directa de la aparición de la replicación del ADN en particular dentro de las células endoreduplicating en diversos niveles de C-valor, y así ofrecer un mayor grado de sofisticación en el análisis de los procesos de este tipo. El método debe ser también aplicable a las plantas inferiores, y puede ser fácilmente probado usando Physcomitrella, que se pueden transformar y para que los G2-arresto en el chloronema recientemente se ha descrito [54].

Por último, cabe señalar también el método de citometría de flujo deben ser igualmente aplicables a los transformables no especies de plantas, incluyendo los mamíferos. La pertinencia de endoreplication para el desarrollo de mamíferos, tanto en condiciones normales y anormales circunstancias, es cada vez más evidente [55, 56], y la habilidad de trazar con exactitud su aparición en determinados tipos de células pueden ser importantes para el análisis del desarrollo, así como de determinadas enfermedades Estados.

Métodos
Recombinante construcciones

Todas las manipulaciones moleculares general se realiza de acuerdo con los procedimientos normales [57]. PfuUltra ™ de alta fidelidad de ADN polimerasa (Stratagene, La Jolla, CA, EE.UU.) se utiliza para la PCR basada en la amplificación de fragmentos de la clonación.

Para construir un T-ADN vector binario para expresar GFP en las plantas, un fragmento de 2445 pb correspondiente al sGFP expresión casete fue puesto en libertad con HincII y SspI de pGFP-JS (Jen Sheen, Massachusetts General Hospital, Boston, MA), y se incorporan entre pCAMBIA1302 La SmaI (9755) y PmlI sitios (752). Por conveniencia de la discusión, pedimos montarlo de este vector pCsGFPB. La A. Thaliana núcleo de histonas HTA6 secuencia de codificación (450 bp) fue PCR cDNA amplificado de una primera área de preparación, utilizando adelante primer 5'-CATGCCATGGAATCCACCGGAAAAGTG-3 'y revertir 5'-primer CATGCCATGGCAGCTTTCTTTGGAGACTTGACTG-3'. El cDNA primer capítulo se prepara usando la transcriptasa inversa SuperScript II, según las recomendaciones del fabricante (Invitrogen, Carlsbad, CA, EE.UU.). La amplificación de fragmentos fue insertado en el sitio NcoI de pCsGFPB. Esto dio lugar a la fusión en el marco de HTA6 a la N-terminal de las buenas prácticas agrarias, que está aguas abajo de un mejor promotor CaMV 35S. En la región de codificación de HTA6, un solo cambio de nucleótido en la posición 118 (G A) fue confirmado por el análisis de la secuencia. Este cambio de nucleótido único conduce a un punto de mutación (I39V), y esta mutación se mantiene en todas las construcciones de derivados.

Vector pCsGFPB llevar la secuencia de codificación de HTA6 fue modificado mediante la eliminación de la del codón (TAA), de las buenas prácticas agrarias abierta marco de lectura, así como los siguientes 14 bp. Esta modificación turnos de la contigua BamHI y XbaI sitios a la sGFP marco de lectura abierta, y da lugar a tres aminoácidos (Gly-Ile-Leu) que se añade a la original sGFP, con el "TAG" en el sitio XbaI convertirse en la nueva parada Codón. Luego de 70 pb secuencia aleatoria generada por ordenador (CGAATGTAGTACGTATTCTCCGAACTGAAGCACCTGAGACGTGTAATGTCGGGCCATCTCATACGTACGG) se inserta inmediatamente después de que el nuevo codón de parada, para que sirva de transcripcional etiqueta de control de la sGFP mRNA nivel utilizando microarrays impresos con la secuencia complementaria. Por último, el CaMV 35S promotor (780 bp) aguas arriba de sGFP fue extirpada mediante EcoRI, y un cassette attR (Frame C, Invitrogen, Carlsbad, CA, EE.UU.) se ha instalado. Este Portal adaptado fue nombrado pCGTAG vector, y se utilizaron para hacer el resto de las construcciones en este estudio.

Genómica secuencias inmediatamente aguas arriba de los codones de inicio de la SCARECROW (SCR), Sulfato Transporter 2-1 (Sultr2-1), SHORTROOT (SHR), y RPL16B de codificación de secuencias de PCR se amplifica. Un fragmento de 2131 pb fue amplificado con SCR adelante primer 5 'CACCGGATAAGGGATAGAGGAAGAGG 3' y revertir primer 5 'GGAGATTGAAGGGTTGTTGGTCG 3'. Un fragmento de 2048 bp Sultr2-1 se amplificó con avanzar primer 5 'CACCGCTGACAACTAACACTCCTC-3' y revertir primer 5 'CTTCTTCTCGAGTTTTGACGTTGTG 3'. Un fragmento de 2495 pb fue amplificado con SHR adelante primer 5 'CACCGGACAAAGAAGCAGAGCGTGG 3' y revertir primer 5 'TTAATGAATAAGAAAATGAATAGAAGAAAGGGAGACCCAC 3'. Un fragmento de 1074 pb fue amplificado con RPL16B adelante primer 5 'CACCTTTCCCACCTCTCTTCAACTTC 3' y revertir primer 5 'CGTAAATAGTAAGTTAAATCCCCAAAACGAGGAACG 3'. Los cinco fragmentos fueron clonados en el vector de entrada Gateway pENTR / D-TOPO (Invitrogen, Carlsbad, CA, EE.UU.). Los plásmidos secuencias reguladoras de la SCR, Sultr2-1, REH, y se RPL16B linealizadas con enzimas de restricción EcoRV, EcoRV, EcoNI, DrdI, y EcoRV respectivamente. Estos plásmidos linealizadas estaban empleadas en el Portal LR reacción, para insertar las secuencias de regulación individual en el Portal de adaptarse T-ADN vector binario pCGTAG.

Planta de transformación

Plásmidos por encima de las construcciones se introdujeron en Agrobacterium tumefaciens cepa GV3101. A. Thaliana 'Columbia' (Col-0) se transformó floral utilizando el método de inmersión [58]. Semillas (T1) fueron cosechadas y seleccionadas en placas de agar MS suplementado con 40 mg L -1 hygromycin y 75 mg L -1 carbenicilina. Las raíces de las plantas de semillero hygromycin-resistentes fueron examinados para GFP fluorescencia utilizando microscopía confocal. Confirmado transformantes fueron trasladados a tierra.

Introducción de pSCR-HTA6-GFP en las plantas desempeño supernumerarios capas de células endodermales

Transgénicos A. Thaliana semillas desempeño SCRpro:: SHR fueron amablemente proporcionados por Philip Benfey (Departamento de Biología, Universidad de Duke). Las raíces de esta línea transgénica tiene un mayor número de capas de células que muestran características de la endodermis [10]. Atravesamos esta línea transgénica con plantas transgénicas desempeño pSCR-HTA6-GFP. F1 semillas fueron germinadas en placas de EM que carecen de los antibióticos. Raíces de tres semanas de edad son víctimas de las plantas de semillero y confocal biparametric flujo de los análisis.

La microscopía confocal

Las raíces de las plantas de semillero T1 o T2 se counterstained con 1 μ g ml -1 yoduro de propidio, PI (Sigma, St Louis, MO, EE.UU.) de 1 a 2 minutos, y se colocaron en diapositivas con una gota de agua para la observación. GFP fluorescencia se visualiza por microscopía confocal MRC 1024 mediante un MP (Bio-Rad, Hercules CA) confocal escáner conectado a una Olympus BX-50 en posición vertical microscopio, equipado con UPlanFl 4X/0.13, UPlanFl 10X/0.30, y UPlanApo 20X/0.70 objetivo Lentes. LaserSharp2000 (Bio-Rad) fue empleado para adquisición de imágenes y Photoshop 5.0 (Adobe Systems Inc, San Jose, CA) para el procesamiento de imágenes.

Crecimiento comparaciones

Semillas de Col-0 y de una línea homocigótica transgénicos desempeño CaMV35S-HTA6-GFP eran esterilizados y plantados en MS placas de agar (2% sacarosa, 1,2% de agar). Las placas se mantuvieron a 4 ° C durante tres días antes de la transferencia a un Conviron cámara de crecimiento de menos de 16 horas al día / 8 horas noches, con un flujo de luz incidente 150-175 μ mol m-2 s-1, y las temperaturas de 22 ° C (Día) y 20 ° C (la noche). Las placas fueron colocadas verticalmente durante 3 días. Plántulas de tamaños similares fueron luego transferir al fresco platos, cada plato con diez de tipo salvaje y diez plantas transgénicas. La posición de la punta de cada raíz de plántulas fue marcado en la parte inferior de la tapa de la placa utilizando un lápiz marcador. Raíz elongación se midió cinco días después de la transferencia, las plantas de semillero y luego fueron recogidos para la medición de los pesos frescos.

Citometría de flujo

Citometría de flujo se realizó utilizando un MoFlo flujo cytometer (Dako Cytomation, Fort Collins, CO) equipado con un láser coherente Empresa II separadas haz caminos en 50 mW a 365 nm y 200 mW a 488 nm. Homogeneizado de A. Thaliana raíces fueron preparados por cortar [5], y los núcleos se tiñeron por adición de 2 μ g / ml 4 ',6-diamidino-2-phenylindole (DAPI). Las muestras fueron analizadas en un acto tasa de 200 núcleos / s. GFP fluorescencia, entusiasmados por el haz de 488 nm, se detectó después de la reflexión por un divisor de haz dicroicos 555DCLP a través de un filtro de paso de banda 530/40. DAPI fluorescencia, entusiasmados por el haz de 365 nm, se desviará directamente a través de un filtro de paso de banda 450/65. Biparametric histogramas de registro diario de las buenas prácticas agrarias DAPI versus señales se desencadenó en el lado de dispersión y reunió a un total de por lo menos 100000.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

CZ producido las construcciones y las plantas transgénicas, que se caracteriza el uso de plantas transgénicas microscopía confocal, participó en la citometría de flujo experimentos, y contribuyó a la preparación del manuscrito. GL ayudó en la microscopía confocal, realizó mediciones de la citometría de flujo, y contribuyó a la preparación del manuscrito. FG participó en la citometría de flujo mediciones, y contribuyó a la preparación del manuscrito. DG concibe el estudio, participaron en su diseño y coordinación, y redactó el manuscrito. Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

Esta labor fue apoyada con una donación a DWG de la Planta Genoma Programa de la National Science Foundation (DBI conceder 0211857).