Plant Methods, 2005; 1: 8-8 (más artículos en esta revista)

Un método simplificado para sistemática, de alta resolución análisis in situ de mRNA de distribución en las plantas

BioMed Central
Sinéad Drea (sinead.drea @ yale.edu) [1], Julia Corsar (jacorsar@btinternet.com) [1], Brian Crawford (bccrawfo@biomail.ucsd.edu) [1], Peter Shaw (peter.shaw @ Bbsrc.ac.uk) [1], Liam Dolan (liam.dolan @ bbsrc.ac.uk) [1], John H Doonan (John.doonan @ bbsrc.ac.uk) [1]
[1] John Innes Centre, Norwich NR4 7UH, UK
[2] Departamento de Molecular, Biología Celular y del Desarrollo, PO Box 208104, la Universidad de Yale, 266 Whitney Ave., New Haven, CT 06520-8104, EE.UU.

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Hibridación in situ puede proporcionar celular, y en algunos casos sub-celular, la resolución de los niveles de mRNA organismos multicelulares y se utiliza ampliamente para proporcionar la información espacial y temporal de la expresión génica. Sin embargo, los protocolos son complejas y laboriosas de implementar, restringiendo el análisis de uno o pocos genes al mismo tiempo. Plenario de montaje y de la transcriptasa inversa-PCR (RT-PCR), con sede protocolos de aumentar el rendimiento, pero puede comprometer tanto la especificidad y la resolución. Con la llegada del genoma en todo el análisis de la expresión génica, es urgente la necesidad de desarrollar de alto rendimiento in situ que también proporcionan métodos de alta resolución.

Resultados

Aquí se describe el desarrollo de un método para el desempeño de alto rendimiento in situ hybridisations que conserva tanto la alta resolución y la especificidad de las mejores versiones manual. Este refinado semi-automatizado de protocolo tiene el potencial para la determinación de la expresión espacial y temporal de los patrones de cientos de genes en paralelo en una variedad de tejidos. Se muestra como las secciones de tejido se puede organizar en el microscopio, de manera que permitan la proyección de varias sondas en cada diapositiva. Deslice la manipulación, la transformación y la hibridación medidas se han racionalizado la aportación de una capacidad de al menos 200 sondas por semana (según el tipo de tejido). La técnica puede aplicarse fácilmente a las distintas especies y tipos de tejidos, y que ilustrar esto con semillas de trigo y Arabidopsis floral meristemas, silicuas y plántulas.

Conclusión

El enfoque tiene la alta especificidad y alta resolución de los anteriores métodos in situ al tiempo que se prevé el análisis de los patrones de expresión de varios genes en paralelo. Este método tiene el potencial de proporcionar un análisis de los patrones de expresión de genes en el genoma.

Antecedentes

Por hibridación in situ (ISH) es el método de elección para describir el patrón espacial de expresión de un determinado gen. Alta resolución proporcionar protocolos celulares y subcelulares aún de resolución. En los organismos multicelulares, ISH complementa el norte de secante, RT-PCR y microarrays, donde la extracción de RNA de los tejidos de todo invariablemente resulta en la pérdida de la información espacial. Microarrays permiten muchos genes que se estudian de forma paralela y en la actualidad una de las herramientas más poderosas para estudiar la expresión génica. Sin embargo, a menudo los microarrays productos deben ser verificados por métodos independientes, como ISH [1, 2], y, aguas abajo, porque estos métodos tienen una capacidad mucho menor, la verificación se limita por lo general a uno o unos pocos genes. ISH, por lo tanto, debe ser más eficiente y menos tiempo.

Un número de variaciones en el tradicional in situ se ha informado de los protocolos, incluyendo todo el montaje en ISH (WISH) [3], in situ PCR [4, 5], y el uso de tejidos vibratome seccionó [6]. El principal defecto de ISH es, sin duda, el bajo rendimiento de la técnica. In situ PCR (ISPCR) y RT-ISPCR elegante son las técnicas que pueden aumentar tanto la sensibilidad y rendimiento, pero son sólo en el mejor de semi-cuantitativos [5] y Es deseable en primer lugar a determinar el patrón de expresión por medios convencionales, a fin de establecer las condiciones adecuadas para cada sonda.

Los esfuerzos por hacer que el ISH en una técnica altamente paralelo, proceso sistemático han tenido éxito en las moscas y los cordados primitivos [7 - 9]. Se ha tratado de abordar esta cuestión en el uso de plantas de deseos y de las técnicas de PCR in situ [10, 11], si bien sigue siendo real el rendimiento indeterminado.

Protocolos de alto rendimiento de los animales, los embriones utilizados normalmente implican métodos de montaje en su conjunto [7, 8, 12], evitando así la necesidad de la sección de material. Los retos en la aplicación de técnicas similares a las plantas incluyen el gran tamaño de los tejidos y la naturaleza variable de la pared celular. Estos factores pueden comprometer la variable penetración de la sonda y hacer examen microscópico más difícil y larga. WISH es una posibilidad de raíces y plántulas de Arabidopsis [11], al menos para los de bajo y mediano rendimiento. Sin embargo, al realizarse en otros tejidos más grandes, como las semillas, de deseos podrá exigir la sección después de la inserción y la conservación in situ se ha realizado para evaluar los resultados [13]. Por lo tanto, el alto rendimiento obtenido ventajas en las primeras etapas de estos procedimientos son efectivamente anulados.

Promotor fusiones reportero con genes son otra opción para la localización celular de las transcripciones, pero este enfoque ha reconocido deficiencias [14]. Elementos de control de la expresión génica se sabe que se encuentra no sólo en la tradicional región promotora aguas arriba de la región de codificación, pero intergenically y, potencialmente, una distancia considerable de los genes [15, 16]. Los recursos necesarios para la transformación de masa y el hecho de que no todas las especies vegetales se prestan los límites de la aplicación de este sistema a bien estudiado modelo de las especies.

Así como proporcionar un medio independiente de la detección de genes de los perfiles de expresión (expresión diferencial, de dominio específico de expresión, etc) en actividades de descubrimiento de genes, prevemos que de alto rendimiento mRNA ISH es totalmente viable y servirá de complemento a la creciente microarrays de datos Recursos disponibles [2, 29] https: / / www.genevestigator.ethz.ch/; http://www.weigelworld.org/resources/microarray/AtGenExpress/. Recientemente tiempo real RT-PCR se ha adaptado para el procesamiento de alto rendimiento [30]. Si bien estos enfoques proporcionan una gran cantidad de datos de expresión de la genómica funcional, no están en condiciones de proporcionar a la resolución espacial, que a menudo refleja directamente funcional de la participación en los procesos de desarrollo. Este inconveniente inherente en la tecnología de microarrays ha sido elegantemente dirigido utilizando células de clasificación para aislar poblaciones puras de un determinado tipo de células a partir de la raíz de Arabidopsis. Sin embargo, este innovador enfoque se limita a las especies adecuadas y donde diversos línea celular se dispone de marcadores [31]. Además, se limita a los tejidos cuyas células pueden ser clasificados y separados: las raíces son susceptibles a protoplasting enzimas, pero muchos brotes y otros tejidos no están.

Con estas consideraciones en mente, hemos deconstruido el "tradicional" ISH protocolo y desarrollado un protocolo para que conserva ISH de alta resolución y la especificidad, pero integra un grado de automatización a un protocolo estandarizado y simplificado. Para ello se han utilizado granos de trigo y Arabidopsis floral como meristemas de las pruebas de este nuevo protocolo de alto rendimiento y demostrar que es capaz de muy procesamiento paralelo.

Resultados y discusión
Creación de un protocolo integrado

Uno de los principales retos en el ARNm ISH económico es el desarrollo de un protocolo que se aplica a los grandes lotes de diferentes sondas tiempo que se mantiene un alto nivel de especificidad, sensibilidad y resolución. El nivel de la economía se debe mantener durante todo el proceso de proporcionar una sistemática de alto rendimiento a nivel de trabajo. Figura 1 resume los ISH de protocolo, tal como se describe en los informes anteriores [17, 18] y describe los cinco componentes principales de todo el procedimiento. Hemos examinado cada uno de estos componentes por separado, pero en el contexto general de la técnica, con el fin de (i) la simplificación, automatización (ii) y (iii) la optimización. En la práctica el acompañamiento a la descripción siguiente hemos incluido un paso-a-paso de la versión de protocolo, tal como se utiliza en el banco (archivo Adicional 1].

Conclusión

Describimos el caso de un sistema semi-automático de procesamiento paralelo de muy ISH. Hemos introducido un importante grado de automatización para producir un sistema para el desempeño de alto rendimiento de ARN-ISH en cientos de secciones de tejidos vegetales al mismo tiempo, sin pérdida de resolución, la especificidad o sensibilidad. Esta diapositiva sistema de procesamiento tiene una capacidad de por lo menos 96 sondas por semana / por persona para varias etapas de desarrollo o experimentales y los tratamientos, con la excepción de las imágenes, es escalable. Por lo tanto, ahora es posible contemplar todo el genoma espacial análisis de la expresión génica en células de resolución en ambos cultivos y especies de plantas modelo.

Para conseguir el genoma de una amplia cobertura en toda especie, son necesarios ciertos requisitos previos. En primer lugar, en representación de las secuencias de genes expresados deberá ser el adecuado para hacer sondas y estará disponible en un formato organizado. En segundo lugar, el resto de pasos manuales deben ser aún más y, de ser posible, automatizados. Finalmente, automatizada la imagen recogida, el análisis y la cuantificación de los métodos tienen que ser desarrollados.

Varios proyectos están en marcha los colectivos cuyo objetivo es el de ofrecer el genoma de Arabidopsis como expresó organizó bibliotecas de clones. Así, una gran proporción de los genes de Arabidopsis se dispone actualmente como recortadas ORFs (marcos de lectura abierta) de SALK http://signal.salk.edu/cdnastatus.html y tecnologías ecológicamente racionales (etiquetas de secuencias expresadas) de ABRC (Arabidopsis Centro de Recursos Biológicos) http : / / Www.biosci.ohio-state.edu/ ~ plantbio / Servicios / abrc / abrchome.htm, o como 3 'UTRs (sin traducir las regiones) o como grupos de genes relacionados estructuralmente de proyectos especiales, como REGIA (Reglamento de Regulación de Genes Gene Iniciativa Iniciativa en Arabidopsis Arabidopsis) http://www.epsoweb.org/catalog/EU/fp5/REGIA.htm. Estos tienden a presentar las colecciones de genes en un formato que se presta a la automatización. En la mayoría de especies de cultivo, donde los genomas son aún incompleta, EST grandes colecciones están disponibles. Sin embargo, incluso estas pueden proporcionar información útil cuando se utiliza conjuntamente con microarrays, la expresión de genes, donde se puede confirmar los datos y resueltas a determinados tipos de células y tejidos capas [19].

El rendimiento es algo menor en Arabidopsis que en el trigo, en gran medida por el tiempo necesario para que la sección más pequeña y más heterogéneos los tejidos. La proporción de las secciones es menos usable y el tejido requiere una mayor complejidad de imágenes de los tiempos. No obstante, el menor tamaño de Arabidopsis facilita todo el montaje enfoques [3, 11] y, usado con microscopía confocal y de fluorescencia de imagen, este podría eliminar por completo la sección manual, sin comprometer ni la resolución ni el rendimiento.

Más de automatización, por lo tanto, es necesario. Los acontecimientos recientes en el procesamiento de diapositivas han proporcionado mejores y más rentables de los procesadores de diapositivas que automatizar todos los pasos de la de-encerado de montaje, incluida la hibridación (resultados no publicados), sino de imágenes y análisis de la tasa-siguen siendo importantes factores limitantes. Automatizado de imágenes y análisis de la participación de la máquina-aprendizaje, son esenciales para ampliar este enfoque para el análisis de todo el genoma. Estos planteamientos han sido desarrollados para el análisis de microarrays de tejidos en el análisis de la expresión de la proteína en distintos tipos de cáncer, aunque la participación de estas tecnologías todavía proteína immunohistochemisty más de mRNA hibridación in situ [26 - 28]. Sin embargo, ya que emplean el mismo color de base del sistema de detección, la tecnología debe ser transferible.

Métodos
Preparación de material vegetal

Plantas de trigo (variedad Sabana) se desarrollaron bajo condiciones de ambiente controlado (16 ° C, 16 h de luz) y los oídos a diario en la etiqueta antesis. Arabidopsis Col-0 fue cultivada en el marco de un invernadero de 16 horas de luz. Trigo granos cosechados a los 3, 6 y 9 DAA fueron recortados y Arabidopsis floral meristemas fueron retirados inmediatamente después de la floración. Todos los tejidos fueron fijados en el 4% paraformaldehído, luego fue trasladado a los centros de tejidos Tek VIP (Infiltración Procesador de vacío, Sakura) un sistema automatizado para la fijación / deshidratación / infiltración proceso de la siguiente manera: fijador 6 h 35 ° C, 70% de etanol 1 h 35 ° C , El 80% de etanol 1,5 horas a 35 ° C, y el 90% de etanol 2 h 35 ° C; 100% de etanol 1 h 35 ° C; 100% de etanol 1,5 horas a 35 ° C (repetir durante 2 h); xileno 0,5 horas a 35 ° C ( Repetir durante 1 h, y de nuevo por 1,5 h); cera 1 h 60 ° C (repetir una vez, luego otra vez dos veces por 2 h). Todas las medidas fueron realizadas en el marco de vacío. Las muestras fueron luego trasladados a los centros de tejidos Tek Embedding Consola incluído en parafina cera.

Sección de preparación

Secciones (14 μ m) de las muestras de trigo en las etapas y 8 μ m secciones de meristemas florales se redujeron en un Microtome Leica (RM2125RT) y ordenó polysine diapositivas sobre que contiene la silicona de aislamiento (Grace Biolabs). Después de secado hacia abajo en 42 ° C la noche a la mañana se seleccionaron secciones adecuadas para tratamiento previo.

Pretratamiento de las medidas se realizaron con el VP2000 Slide Processor (Vysis), utilizando el siguiente programa: xileno 20 minutos (dos veces), el 100% de etanol 10 minutos, y luego a través de un 95%, 85%, 50%, 30% etanol serie (2 min cada ), PBS (3 mM NaH 2 PO 4, 7 mM Na 2 HPO 4, 130 mM NaCl) 3-4 min; proteinasa K (2-3 μ g / ml en 100 mM Tris, 10 mM EDTA pH7.5) 30 min A 37 ° C; glicina (0,2%) 2 min; PBS 3-4 min; anhídrido acético (0,5% en 0,1 M triethanolamine pH 8) 10 min; PBS 3-4 min, y luego de vuelta a través de la serie de etanol. Las láminas fueron completamente seco en este momento y puede ser almacenada a 4 ° C hasta el momento de la hibridación.

Generación de plantillas y etiquetado sondas

Trigo ADNc de cribado son ofrecidos como se inserta en un vector derivado de pSPORT1. Primers fueron diseñados con el fin de adjuntar un T7 RNAP sitio para el extremo 3 'del fragmento de inserción con los demás primer anidado en el interior de la nativa de vectores T7 RNAP sitio; T7.2 5' GAATTGTAATACGACTCACTATAGGGCCAGTGAATTGAATTTAGG GAATTGTAATACGACTCACTATAGGGCCAGTGAATTGAATTTAGG GAATTGTAATACGACTCACTATAGGGCCAGTGAATTGAATTTAGG 3 'y R7.2 5'AGGGAAAGCTGGTACGCCTGC 3 '(T7 RNAP promotor sitio de unión subrayado). Arabidopsis histona H4 se amplificó de pBluescript y AP3, AG, de REM con vectores pGEM universal primers adelante y atrás para su posterior transcripción con T7 RNAP. Las reacciones de PCR se realizaron con el siguiente ciclo: 94 ° C 3 min, 30 ciclos de 94 ° C, 45 s, 63 s 45 ° C y 72 ° C 1,5 min, extensión final de 72 ° C durante 6 min. Para placas de 96 pozos PCR-producto de depuración se realiza a través de los Montage Kit de limpieza (Millipore).

Transcripción in vitro se realizó en 10 μ l reacciones durante 2 h a 37 ° C en presencia de digoxigenina-UTP (Dig-UTP) de nucleótidos (0,35 mM). La hidrólisis se llevó a cabo de inmediato en 100 mM carbonato de amortiguación pH10.2 a 60 ° C durante 30 min, y de los productos precipitó en 2,5 M de acetato de amonio y 3 vol etanol absoluto durante 1 h a 4 ° C. Las placas fueron centrifugadas a 4000 rpm durante 30 min y "pellets" resuspendido en 30 μ l TE (100 mM Tris, 10 mM EDTA) de amortiguación. Diluciones (100 x) se hicieron en el agua y 1 μ l de cada manchada de nitrocelulosa para dot-blot: 30 min en la solución de bloqueo (Sigma), 30 min en anti-DIG-fosfatasa alcalina (Roche); 5 min de lavado en TBS ( 10 mM Tris, 250 mM NaCl); 5 minutos en AP-buffer (100 mM Tris, 100 mM NaCl pH 9,5, 50 mM MgCl 2), y desarrollado como se ha descrito anteriormente, hasta la señal es suficiente. Todas las sondas fueron 100 veces diluido en solución de hibridación (300 mM NaCl, 10 mM Tris pH 6,8, 10 mM NaPO 4, 5 mM EDTA, 50% formamida, el 5% de sulfato de dextrano, 0,5 mg / ml tRNA, 1 × Denhardt's, 0,1 mg / ml de salmón testículo ADN) y mantenerse estable a -20 ° C hasta el momento de la hibridación.

Hibridación y lavado

Salas (Grace Biolabs) se aplican a las diapositivas con seguridad (después de un tratamiento previo) y sondas (diluido en la solución de hibridación) se aplica a un bien (2 secciones) para las 3 fases individualmente. Coverslips se colocaron en las cámaras para evitar la evaporación y la hibridación se realizó la noche a la mañana en una incubadora a 50 ° C.

Salas fueron retirados y diapositivas VP2000 dispuestos en el programa para el lavado: 15 min en 2 × SSC (0,3 M NaCl, 0,03 M citrato Na), 50% (v / v) formamida a 40 ° C, 40 m de la misma a 50 ° C, 20 min en 1 × CDC, el 50% (v / v) formamida a 50 ° C (todos los pasos con agitación constante); 5 min en 1 × SSC a temperatura ambiente; 5 min en TBS 1 × a temperatura ambiente. Luego diapositivas fueron trasladados en charolas para tinción: 1% solución de bloqueo (Roche) en TBS 1 h, 1 × TBS que contiene 1 / 3000 de lucha contra la dilución de DIG AP y 0,05% (v / v) de Tween-20 1 h, 4 × 10 min lavados en 1 × TBS; 5 min en la AP-Buffer (0,1 M Tris, 0,1 M NaCl, 50 mM MgCl 2); desarrollado en la AP-Buffer contiene NBT (0,1 mg / ml) y BCIP (0,075 mg / ml) Durante un máximo de 24 h. Diapositivas luego fueron lavados varias veces en el agua para detener la reacción secuencial seguido de lavados en el 70% y el 100% de etanol para eliminar el exceso de tinta (la duración de los lavados de etanol depende del nivel de desarrollo del color que se vigila por ojo). Diapositivas Luego se deja secar y montado en Entellan (Merck).

Captura de la imagen y el análisis

Una sección para cada etapa de selección para cada sonda fue fotografiado en un microscopio Nikon E800 usando una cámara digital brightfield en virtud de las condiciones para el trigo y secciones con filtro UV para el calcofluor-counterstained Arabidopsis secciones. Se tomaron imágenes de forma secuencial como ordenó en las diapositivas. Aumentos y ajustes de la cámara se mantuvo sin cambios para todas las imágenes a través de todas las etapas para el trigo y también la sección de meristemas florales.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

SD desarrollado el sistema descrito, realizan todos los trabajos para el trigo experimentos y escribió el manuscrito; JC BC y proporcionó asistencia técnica para la adaptación de la técnica a Arabidopsis; JHD, PS y LD son mixtas supervisores; JHD co-escribió el manuscrito.

Material suplementario
Archivo Adicional 1
Detallada de alto rendimiento
In situ
Hibridación de protocolo. Un texto ilustrado documento se adjunta con un protocolo escrito en el paso a paso los detalles de las personas que trabajan en el banco.
Agradecimientos

Los autores desean agradecer a Sarah y Mary Byrne Collier (John Innes Centre) de la experiencia de trabajo con Arabidopsis; Cathie Martin, Jan Traas, y Robert Sablowski para sondas; Steve Evans y Gawain Bennett (Syngenta) para ayudar con la preparación de la sonda de trigo; David Leader, Wolfgang Schuch y Simon Bright para facilitar la colaboración con Syngenta y el BBSRC, Syngenta y el Centro John Innes de financiación.