Journal of Autoimmune Diseases, 2005; 2: 8-8 (más artículos en esta revista)

La falta de correlación entre los niveles de soluble linfocitos T citotóxicos asociados antígeno-4 (CTLA-4) y el CT-60 genotipos

BioMed Central
Sharad Purohit (spurohit@mail.mcg.edu) [1], Robert Podolsky (rpodolsky@mail.mcg.edu) [1], Christin Collins (ccollins@mail.mcg.edu) [1], Weipeng Zheng (wzheng @ Mail.mcg.edu) [1], Desmond Schatz (Schatda@peds.ufl.edu) [2], Andy Muir (amuir@mail.mcg.edu) [1], Diane Hopkins (dhopkins@mail.mcg.edu ) [1], Yi-Hua Huang (yhuang@mail.mcg.edu) [1], Jin-Xiong Ella (jshe@mail.mcg.edu) [1]
[1] Center for Biotechnology and Genomic Medicine, Medical College of Georgia, CA4095 Augusta, GA 30912
[2] Department of Pediatrics, University of Florida, Gainesville FL 32607, USA

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Citotóxica de linfocitos T antígeno-asociados-4 (CTLA-4) desempeña un papel fundamental en downregulation de antígeno activados por la respuesta inmune y polimorfismos en el gen CTLA-4 se han demostrado estar asociados con varias enfermedades autoinmunes, incluyendo el tipo-1 diabetes (T1D ). La mutación etiológico fue asignada a la CT60-A / G polimorfismo de nucleótido único (SNP) que se cree que el control de la transformación y la producción de solubles CTLA-4 (sCTLA-4).

Métodos

Por lo tanto, determinó sCTLA-4 niveles de proteína en el suero de 82 pacientes T1D autoanticuerpos positivos y 19 (AbP) y 117 sujetos autoanticuerpos negativo (AbN) controles utilizando ELISA. El CT-60 fue SNP genotipo de las muestras mediante el uso de PCR y restricción de la digestión enzimática de un segmento de 268 bp de ADN que contiene el SNP. Genotipificación de SNP CT-60 fue confirmado por el tinte que terminará la secuencia de reacción.

Resultados

Los niveles más elevados de sCTLA-4 se observaron en T1D (2,24 ng / ml) y AbP (media = 2,17 ng / ml) en comparación con los sujetos controles AbN (media = 1,69 ng / ml) con las diferencias entre estos temas convirtiéndose en importantes con la edad ( P = 0,02). Sin embargo, no encontramos correlación entre los niveles sCTLA-4 y el CTLA-4 CT-60 genotipos SNP.

Conclusión

En consonancia con el mayor suero sCTLA-4 niveles observados en otras enfermedades autoinmunes, nuestros resultados sugieren que sCTLA-4 puede ser un factor de riesgo para T1D. Sin embargo, nuestros resultados no apoyan la conclusión de que la CT-60 SNP controla la expresión de sCTLA-4.

Antecedentes

Efectiva la activación de células T requiere de un 'costimulation' señal de que CD28 es mediado a través de la interacción con los miembros de la familia B7 células presentadoras de antígeno (APC) [1]. Los linfocitos T citotóxicos asociados antígeno-4 (CTLA-4) fue inicialmente descrita como una proteína de unión B7 y un receptor expresado en la superficie de las células T activadas [2]. Pertenece a la superfamilia de genes de inmunoglobulina y comparte homología con CD28. CTLA-4 se ha notificado a ser un importante regulador negativo de las enfermedades autoinmunes [3, 4]. CTLA-4 bloqueo mejora las respuestas de células T in vitro e in vivo [5, 6], aumenta la inmunidad antitumoral [7], y agrava las enfermedades autoinmunes [8]. Varios informes han indicado que CTLA-4 ratones deficientes muestran un grave trastorno linfoproliferativo autoinmune y enfermedades con principios de letalidad [9, 10]. El tratamiento con anti-CTLA-4 mAb de BDC2.5/NOD ratones provocó un rápido inicio de la diabetes, lo que indica que una mayor presencia de CTLA-4 se requiere para la represión del fenómeno autoinmune en estos ratones [11, 12]. Recientemente, una forma soluble de CTLA-4 (sCTLA-4) se encontró que se expresen constitutivamente por las células T no humanos [13]. Circulante sCTLA-4 de proteína se encontró a estar presente en el suero humano y está demostrado poseer un efecto inhibitorio sobre la respuesta leucocitaria mixta [14].

Varios estudios han demostrado una asociación entre los polimorfismos genéticos dentro o cerca del gen CTLA-4 y T1D [15 - 19], así como otras enfermedades autoinmunes [20 - 24]. Este locus de susceptibilidad ha sido reconocido como IDDM12. Nuestros estudios anteriores indicaban que CTLA-4 es el único que figura en el gen de susceptibilidad IDDM12 intervalo, lo que sugiere que CTLA-4 es, en efecto, la IDDM12 de genes [16]. En un informe reciente de Ueda et al [25], el intervalo de sensibilidad se redujo a un 6,1 kb en la región 3 'UTR del gen CTLA-4 y la A-CT60 / G polimorfismo de nucleótido único (SNP), se sugirió que se Etiológico de la mutación. El susceptibles CT60-G alelo se informó a producir una menor cantidad de solubles CTLA-4 mRNA en los linfocitos de sangre periférica de la enfermedad resistentes CT60-Un alelo. Estos resultados sugirieron que sCTLA-4 puede conferir protección frente a T1D. Si este efecto es cierto, uno podría predecir inferior sCTLA-4 en el suero en T1D pacientes en comparación con los controles. Sin embargo, la predicción está en conflicto directo con las observaciones en otras enfermedades autoinmunes incluyendo la enfermedad tiroidea autoinmune [26], lupus eritematoso sistémico [27] y de la miastenia gravis [28], en la que el suero sCTLA-4 niveles se incrementan en comparación con los pacientes Controles. La medición del suero sCTLA-4 proteínas en una muestra mayor conjunto es vital para evaluar el papel potencial de sCTLA-4 en T1D, y para comprender mejor la base molecular y funcional en que se basa la asociación genética entre el gen CTLA-4 y T1D.

Métodos
Los sueros de paciente

La población de estudio consta de 218 temas de la cooperación Sur-este de los Estados Unidos. Todos los sujetos de estudio fueron genotipados para HLA-DQB1 y evaluados por tres autoanticuerpos (IA-2A, GADA e IAA), utilizando métodos establecidos [29, 30] Los temas utilizados en este estudio son los posibles participantes en la evaluación de la diabetes en los recién nacidos de la autoinmunidad (PANDA) Programa. En pocas palabras, PANDA pantallas de los recién nacidos de la población general, así como los niños con un pariente en primer grado con utilización de T1D genotipo HLA. Los sujetos que poseen los genes de alto riesgo son supervisados por la aparición de autoanticuerpos islote y la diabetes clínica. Por lo tanto, la mayoría de los autoanticuerpos negativo (AbN) los sujetos de alto riesgo también tienen genes HLA y la AbN grupo no es seleccionado al azar de la población general. Los autoanticuerpos positivos (AbP) los sujetos han sido probados persistentemente positivos para dos o más islote autoanticuerpos. Sobre la base de nuestros resultados de PANDA y estudios previos, la AbP grupo tiene un 70-80% de posibilidades de progreso para T1D [31] y, de hecho, representan un grupo de riesgo muy alto. Dado que la producción de autoanticuerpos es uno de los sellos distintivos de la autoinmunidad, la AbP y T1D grupo se pueden combinar para evaluar el impacto de la autoinmunidad en el CTLA-4. Juntas de revisión institucional apropiado aprobado el diseño del estudio y se obtuvo el consentimiento de todos los temas.

Determinación de sCTLA-4

Un sandwich ELISA ensayo tal como se describe por Oaks et al [26] fue utilizado para medir los niveles séricos de sCTLA-4 niveles en un total de 218 temas, incluidos 117 autoanticuerpos negativo (AbN), el 19 de autoanticuerpos positivos (AbP) y 84 pacientes con T1D. El 96-así placas microtiter (Biotecnología Pierce, Rockford, IL) fueron revestidos con 1,0 ug / ml anti-CTLA-4 anticuerpo monoclonal (clon BNI3; Pharmingen, San Deigo, CA). Tras el bloqueo, 100 ul de 1:10 diluido muestras de suero se añadieron a cada pocillo y las placas se incubaron durante 2 h en una cámara húmeda a 37 ° C y luego se lavan para eliminar el material sin encuadernar. Después de lavar, 100 ul anti-biotina CTLA-4 mAb (1,0 ug / ml, clon AS-33, Antibody Solutions, Palo Alto, CA) fue agregado y las reacciones fueron incubadas por otro de 1 hora a 37 ° C en una cámara húmeda . Las reacciones fueron desarrollados utilizando streptavidina-peroxidasa (Biorad, Hercules, CA) y 3,3 ', 5,5'-tetramethy bencidina sustrato (Sigma, St Louis, MO) durante 10 minutos a temperatura ambiente, la reacción se dio por terminada con 2N H 2 SO 4 y la densidad óptica se leyó a 450 nm y 630 nm. Una curva estándar fue generada usando una serie de dilución de venta en el comercio CTLA-4-Ig proteína de fusión (0,125 ng / ml a 10 ng / ml Ancell, Bayport, MN). Este ensayo tiene una gama lineal entre 0,5 y 10 ng / ml y la gran mayoría de las muestras corresponden a esta variedad. Cada muestra fue analizada por duplicado.

Genotipificación de 3 'sin traducir región de CTLA-4 gen

Un fragmento de 268 pb que abarca el CTLA-4 C/T-60 polimorfismo de nucleótido único (SNP) en el 3 'sin traducir región fue amplificado utilizando el primer 5'GCTTCATGAGTCAGCTTTGC3 adelante' y revertir primer 5'ATAGGACCACAGGT3 '. Los productos de amplificación de PCR fueron digeridos usando las 10 unidades de HpyCH4IV (New England Biolabs) y separados en geles de agarosa al 3%. El alelo C-60 arrojó dos bandas de 151 y 103 pb y el alelo T-60 el rendimiento de una banda de 268 pb. La técnica para el genotipado C/T-60 SNP fue confirmado por secuenciación del ADN de un subconjunto de las muestras de ADN utilizando un secuenciador 300XL (ABI Sciex).

Análisis Estadístico

Obtuvieron valores de absorbancia a 450 nm se normalizaron con los valores de absorbancia a 630 nm. SCTLA-4 niveles de ingreso, se transformó antes del análisis. Dos de los temas T1D tenían altos niveles sCTLA4 con los niveles séricos de CTLA4 fueron> 12 ng / ml, o 3,5 desviaciones estándar de la media de 2,57 ng / ml. Además, los análisis iniciales de análisis de la varianza (ANOVA) indicó estos dos temas "valores atípicos. Como tales, los datos de estos dos temas se han retirado de todos los análisis posteriores. Se usó el modelo lineal mixto de ANOVA (procedimiento Proc Mixed de SAS) en la que la placa se incluyó como un efecto aleatorio para examinar las diferencias en los niveles sCTLA4. Inicialmente analizamos fenotípica grupo (AbN, AbP, y T1D) solo, pero posteriormente se realizaron análisis separados de añadir otros factores. Estos análisis fueron los siguientes: (1) ANOVA con fenotípica grupo de CTLA-4 y genotipo; (2) ANOVA con fenotípica grupo y de género; (3) ANOVA con fenotípica y grupo de edad como covariable y la interacción entre la edad y la Fenotípica grupo; (4) ANOVA con fenotípica grupo y la duración de T1D como covariable y la interacción entre la duración de T1D y fenotípicas grupo, y (5) ANOVA con fenotípica grupo y genotipo HLA.

Resultados

Clínicas y demográficas información se presenta en la Tabla 1. La mayoría de los temas en el estudio fueron por debajo de la edad de 20 años (73%) en los tres grupos. Los sujetos fueron puestos a prueba para IAA, GADA e IA-2A autoanticuerpos, así como HLA-DQB1 genotipos. Genotipo HLA-DQB1 se dispone de información de 96,58, 94,74 y 98,78 por ciento de los pacientes de la AbN, AbP y T1D grupos, respectivamente. Ochenta y ocho por ciento de T1D sujetos fueron diagnosticados con T1D antes de los 20 años, con una edad media de 8,8 (rango, 0,9-41,2). Cincuenta y siete de los ochenta y dos T1'1D temas T1D tienen una duración de cinco años y menos.

En primer lugar, la comparación de suero sCTLA-4 niveles fenotípicas entre los tres grupos (es decir, AbN, AbP y T1D). Los niveles de proteína para T1D (media = 2,24 ng / ml, rango = 0-10.1 ng / ml) y AbP (media = 2,17 ng / ml, rango = 0.2-7.7 ng / ml) fueron ligeramente superiores a los que en AbN (media = 1,69 ng / ml, rango = 0.0-11.5 ng / ml) (Tabla 2], aunque estas diferencias no fueron estadísticamente significativas.

El suero de CTLA-4 se analizaron los niveles después de la estratificación por grupos fenotípica (T1D, AbP y AbN) y el CTLA-4 CT-60 genotipos SNP (A / A, A / G y G / G) (Tabla 2]. Un modelo mixto usando ANOVA y fenotípica grupo CT-60 genotipos como factorial de efectos fijos no revelaron diferencias en los niveles sCTLA-4 entre el CTLA-4 genotipos (p = 0,46) o genotipo / fenotipo interacciones (p = 0,82). Un similar usando ANOVA CT-60 genotipos solos como de efectos fijos no revelaron diferencias significativas en los niveles sCTLA-4 entre el CTLA-4 genotipos (p = 0,64).

A continuación, analizó los datos después acondicionado en genética, fenotípica o parámetros demográficos. Tampoco se observaron diferencias de género en el suero CTLA-4 niveles fenotípicas entre los tres grupos (Cuadro 2]. La relación entre sCTLA-4 niveles y edades diferentes fenotípica entre los tres grupos (p = 0,022). El sCTLA-4 niveles disminuyó con la edad en los controles (p = 0,048; Fig. 1]. En cambio, sCTLA-4 niveles de aumento con la edad en ambos la T1D y AbP grupos (Fig. 1], aunque estas relaciones no fueron significativas (p> 0,1). Esta diferencia en la relación con la edad se traducirá en AbN controles con menores niveles sCTLA-4 a edades más tardía en comparación con las dos AbP y T1D temas. Suero sCTLA-4 niveles en T1D sujetos no mostraron una asociación con la duración de la enfermedad (p = 0.4) ni con la edad a la aparición de la enfermedad (p = 0,6; datos no presentados).

El suero de CTLA-4, fueron también analizados después acondicionado en el HLA-DQB1 genotipos utilizando fenotípica grupo, HLA-DQB1 * 201, y HLA-DQB1 * 302 como factorial de efectos fijos en un modelo mixto ANOVA. No se observaron diferencias en los niveles sCTLA-4 entre HLA-DQB1 * 0302 genotipos (p = 0,96), y los tres grupos fenotípica estratificado por genotipo HLA-DQB1 no mostró diferencias (Tabla 2, p = 0,51). AbN sujetos con el alelo DQB1 * 201 tendían a tener sCTLA los niveles más bajos (1,3 ng / ml frente a 2,2 ng / ml), aunque la diferencia no fue significativa, una tendencia similar se observó en AbP grupo (1,8 ng / ml frente a 3,3 ng / Ml). T1D El grupo de sujetos con y sin alelo DQB1 * 201 tienen un nivel muy similar de sCTLA-4 (2,2 ng / ml frente a 1,9 ng / ml). Las diferencias fenotípicas entre los tres grupos para los sujetos con el alelo DQB1 * 201 no fueron significativamente diferentes de las diferencias observadas para los que no tienen el alelo DQB1 * 201 (Cuadro 2, p = 0,13). El principal efecto del alelo DQB1 * 0201 en el modelo factorial mixto ANOVA fue marginalmente significativa (p = 0,08) con suero CTLA-4 niveles menor en los individuos con un alelo DQB1 * 0201 (media = 1,8 ng / ml) que en los individuos Sin un alelo DQB1 * 0201 (media = 2,4 ng / ml). Hemos decidido rehacer este análisis mediante la combinación de la AbP y T1D grupos por tres razones: (1) el tamaño de las muestras eran pequeños para algunos de los genotipo / fenotipo combinaciones; (2) temas que son positivos para anticuerpos múltiples y con un alto riesgo genotipo HLA Tienen muchas más probabilidades de desarrollar T1D, en el futuro, y (3) la autoinmunidad es el común denominador de la AbP y T1D grupos. Cuando los resultados fueron analizados con estos dos fenotípicas de los grupos considerados como un solo grupo (AbP + T1D vs AbN), el principal efecto del alelo DQB1 * 0201 se convirtió significativa (p = 0,02), con el resto de los efectos aún no son significativos. T1D y AbP sujetos mostraron una tendencia a tener mayor sCTLA-4 niveles (media = 2,2 ng / ml) en comparación con los sujetos AbN (media = 1,3 ng / ml), cuando sólo los sujetos con el DQB1 * 0201 se consideraron, sin embargo, el Diferencia no fue estadísticamente significativa (p = 0.15).

Discusión

La diabetes Tipo-1 se caracteriza por la producción de β islotes de células pancreáticas específicas auotantibodies y la destrucción de la producción de insulina por las células β autoreactive T células. Una función de CTLA-4 en la patogénesis T1D y en otras enfermedades autoinmunes ha sido bien documentado. En este estudio nos proporcionan algunas pruebas que sugieren que un alto riesgo autoanticuerpos positivos los temas y el T1D pacientes tienen un aumento de los niveles de sCTLA-4 en el suero de autoanticuerpos frente a temas negativos. Hemos observado que las diferencias más grandes en los niveles sCTLA4 entre T1D/AbP y AbN temas ocurren en el grupo de edad avanzada. Además, se observó una diferencia entre los sujetos AbP/T1D y AbN temas de los que llevan el alelo DQB1 * 0201.

Como un regulador negativo de la activación de células T, bloqueo de CTLA-4 por monoclonales anti-CTLA-4 anticuerpo provoca un rápido inicio de la diabetes en BDC2.5/NOD modelo de ratón [11]. El tratamiento de los animales con recombinante CTLA-4Ig molécula retarda el desarrollo del T1D y otras enfermedades autoinmunes [11, 12, 32 - 36]. Sin embargo, la función y el papel potencial de sCTLA-4 no han sido bien estudiados. SCTLA-4 es generado por splicing alternativo de CTLA-4 mRNA, que induce un cambio de marco de la supresión de una región transmembrana de CTLA-4 resultando en una proteína soluble nativa [13]. SCTLA-4 es constitutivamente expresado en células T nonstimulated y su expresión es downregulated después de la activación de células T [14]. La forma soluble de las proteínas de superficie se cree, en la mayoría de los casos, a desempeñar un papel inhibitorio debido a la competencia por los ligandos con sus homólogos de superficie. La conclusión de que la expresión sCTLA-4 se mantiene en el nivel sostenido niveles sugiere que sCTLA-4 bloques de la B7-mCTLA-4 interacción, aumentando con ello la activación de células T y autoreactivity mediante la inhibición de la inducción de anergia [37, 38]. Alternativamente, sostenido sCTLA-4 puede jugar un papel protector a través de la inhibición de la B7-CD28 interacciones. Por lo tanto, el papel de sCTLA-4 en la autoinmunidad puede depender de la afinidad relativa de sCTLA-4 y B7.2 a B7.1. Esta cuestión se abordó indirectamente en varias enfermedades autoinmunes mediante la comparación de la sCTLA-4 niveles en el suero de pacientes y controles. Elevados sCTLA-4 ha informado de órgano específico en la enfermedad tiroidea autoinmune [26], lupus eritematoso sistémico [27] y de la miastenia gravis [28]. Estas observaciones sugieren que sCTLA-4 puede contribuir al desarrollo de enfermedades autoinmunes, probablemente a través de la inhibición de la B7-mCTLA a 4 de la interacción y la baja regulación de la activación de linfocitos.

Nosotros no tienen conocimiento de ningún estudio que ha examinado sCTLA-4 niveles en el suero de pacientes T1D. Un estudio reciente realizado por Ueda et al. [25], sugiere que un SNP (CT60-A / G) en el 3 'UTR de la CTLA-4 gen puede determinar la eficiencia de la producción y el empalme de sCTLA-4 mRNA. Sobre la base de un pequeño número de sujetos, los susceptibles alelo G se sugirió a producir cantidades inferiores de sCTLA-4 mRNA. Sobre la base de estas observaciones, los autores concluyeron que sCTLA-4 expresión es la base funcional para la asociación observada entre T1D genéticos y el gen CTLA-4. Si esta conclusión fuera correcta, T1D pacientes que se espera que tengan menor suero CTLA-4. Nuestros resultados no encontró pruebas de que sCTLA-4 niveles se redujo en los pacientes en comparación con los controles. Por el contrario, nuestros datos sugiere que el suero sCTLA-4 niveles fueron ligeramente más alto en pacientes T1D. Nuestros resultados también indicaron que el aumento de los niveles sCTLA-4 en T1D pacientes no se debe a la situaciones hiperglucémicas porque el autoanticuerpos positivos también ha aumentado el suero sCTLA-4. También directamente a prueba la correlación entre los niveles sCTLA-4 y la CT-60 SNP fenotípica en los tres grupos (AbN, AbP y T1D) y no encontró ninguna correlación significativa en ninguno de estos grupos. Las discrepancias entre nuestro estudio y el informe anterior [25] se puede explicar por una serie de factores. En primer lugar, se estudió ARNm en el informe anterior, mientras que la proteína de suero se analizaron en este estudio. Como la función biológica de sCTLA-4 se lleva a cabo a nivel de proteínas, nuestros datos es más aplicable a la función de sCTLA-4 en T1D patogénesis. En segundo lugar, el tamaño de la muestra en el informe anterior [25] era extremadamente pequeña variación aleatoria y es bastante probable. Aunque el tamaño de la muestra en nuestro estudio no es muy grande, es varias veces más grande que el anterior informe, y es el poder suficiente para detectar grandes diferencias. Como no hay indicios de una correlación entre los niveles sCTLA-4 y la CT-60 genotipo, es poco probable que el SNP C/T-60 desempeña un papel importante en el control de la expresión de sCTLA-4.

Conclusión

De acuerdo con las observaciones en otras enfermedades autoinmunes en los seres humanos, así como los datos en los ratones NOD, nuestros datos sugieren que sCTLA-4 es potencialmente un factor de riesgo para el desarrollo de T1D. Nuestros datos también plantea una seria duda sobre la conclusión de que la expresión de sCTLA-4 es controlado por el CT60 SNP en el extremo 3 'del gen CTLA-4. Por lo tanto, la base funcional de la asociación genética entre el CTLA-4 y enfermedades autoinmunes, así como la mutación causal en la región de CTLA-4 se debería volver a considerarse.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

SP y JXS diseñado los estudios, ayudado en la interpretación y la redacción del manuscrito. SP, CC y WZ son los principales implicados en la realización de la evaluación clínica y la adquisición de datos. RP realizó el análisis estadístico y participó en la preparación del manuscrito. AM y DS son responsables de recoger muestras clínicas de pacientes y la evaluación. DH y YH participan en la muestra y la recopilación de datos.

Agradecimientos

Este trabajo recibió el apoyo de subvenciones del Instituto Nacional de Salud Infantil y Desarrollo (2RO1HD37800 y 1R21HD050196) a JXS. SP fue apoyado por una beca postdoctoral JDRF (JDRF # 3-2004-195).