Journal of Inflammation (London, England), 2005; 2: 14-14 (más artículos en esta revista)

Diferencial de señalización de los mecanismos de regulación de la expresión de receptores de quimioquinas CC-2 durante la maduración de los monocitos

BioMed Central
Roderick J Phillips (rphillips@intermune.com) [1], Marin Lutz (mlutz@agre.org) [1], Brett Premack (bpremack@chemocentryx.com) [1]
[1] Department of Physiology David Geffen School of Medicine at University of California, Los Angeles, Los Angeles, California, 90095 USA
[2] Jonsson Comprehensive Cancer Center, David Geffen School of Medicine at University of California, Los Angeles, Los Angeles, California, 90095 USA
[3] Descubrimiento del Departamento de Investigación, Intermune, 3280 Bayshore Blvd, Brisbane, California, 94005 EE.UU.
[4] Department of Technology Development, ChemoCentryx Inc., 1539 Industrial Road, San Carlos, California USA

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Monocitos de sangre periférica y monocitos-macrófagos derivados son componentes clave de reglamentación en muchas patologías inflamatorias crónicas de la vasculatura incluida la formación de lesiones ateroscleróticas. Sin embargo, la bioquímica y molecular de los eventos en que los monocitos de maduración no se comprenden totalmente.

Métodos

Hemos utilizado recién aisladas monocitos humanos y el modelo de los monocitos humanos línea celular, THP-1, para investigar los cambios en la expresión de un grupo de los monocitos y macrófagos marcadores de la diferenciación de los monocitos durante. Hemos examinado estos cambios mediante RT-PCR y análisis FACS. Además, hemos clonado el promotor y CCR2 analizaron cambios específicos en la activación transcripcional de CCR2 monocitos durante la maduración.

Resultados

El receptor de quimioquinas CC 2 (CCR2) es rápidamente downregulated monocitos como avanzar por la vía de la diferenciación de los macrófagos mientras que otros no son receptores de quimioquinas. A través de una serie de análisis bioquímicos y transcripcional en el humano HTP-1 monocitos modelo de sistema, nos muestran que tanto los monocitos y HTP-1 células expresan niveles elevados de CCR2, mientras HTP-1 macrófagos derivados de dejar de expresar detectables CCR2 mRNA o proteína. Además, demuestran que múltiples vías de señalización activadas por IFN-γ y M-CSF, o por la proteína quinasa C y calcio citoplásmico puede mediar la downregulation de CCR2 pero no CCR1.

Conclusión

Durante los monocitos-macrófagos CCR2 diferenciación, pero no CCR1, es downregulated y este Reglamento se produce a nivel de río arriba a través de la transcripción 5 'elementos de regulación.

Antecedentes

Quimiocinas son una superfamilia de los pequeños (8-10 kDa) proteínas, que coordinan las respuestas celulares a la inflamación, el insulto o lesiones [1 - 4]. También desempeñan un papel fundamental en la regulación del tráfico y la extravasación de leucocitos a través de la superficie luminal de las células endoteliales en sitios de la inflamación de los tejidos. Las quimioquinas superfamilia incluye al menos 20 receptores y ligandos más de 50 [1 - 5]. Las quimioquinas ligandos se pueden dividir en dos grandes categorías dependiendo de si CC o expresar una CEC aminoácidos motivo en su N-termini. Esta dicotomía parece ser funcionalmente importante ya que muchos CC quimiocinas preferentemente objetivo monocitos y linfocitos T, mientras que CEC quimiocinas como la IL-8 (CXCL8) tienden a atraer a los neutrófilos. El CC quimiocinas se unen a una familia de la proteína G unida serpentina (siete transmembrana que abarcan) receptores, que se denominan CC receptores de quimioquinas (CCRs; [1, 3, 6]]. Actualmente, diez de la CC de receptores se han identificado predominantemente monocitos y expresar tres de ellos: CCR1, CCR2 y CCR5 [2, 7, 8]. Estos receptores de la señal y puede obligar a las diferentes CC quimiocinas incluyendo MCP-1 (CCL2), MIP-1 α (CCL3) y RANTES (CCL3) [3, 4, 9], y estas mismas quimiocinas son secretados por las células endoteliales cuando activado por LDL o Citoquinas inflamatorias [10 - 13] o cuando se daña el endotelio [14, 15].

En efecto, el reclutamiento de monocitos de sangre periférica al sitio de endotelio lesionado por pro-inflamatorias quimiocinas es un componente clave de regulación en la formación de una lesión aterosclerótica [16, 17]. Los monocitos posteriormente se adhieran al endotelio y, finalmente, pasar a la sub-íntima [18, 19]. En este sentido, que reciben una serie de señales de diferenciación de los macrófagos-incluyendo factor estimulante de colonias (M-CSF) y con un mínimo de LDL oxidadas que les permita madurar en macrófagos. Estos macrófagos luego hundir grandes cantidades de colesterol para convertirse en lípidos cargados de células espumosas. Y es la acumulación de estas células espumosas que a la larga conduce a la formación de las estrías grasas característica, intermedio placas fibrosas y lesiones [20, 21].

Hasta la fecha, sin embargo, el verdadero papel de las quimiocinas y sus receptores en la aterosclerosis no ha sido claramente establecido. Sin embargo, estudios recientes utilizando modelos de ratones transgénicos de la aterosclerosis han proporcionado pruebas convincentes de que CCR2 se requiere para la progresión de la enfermedad en la apolipoproteína E-null ratones [22, 23]. En estos animales, la perturbación de la CCR2 genes disminuye en gran medida la formación de la lesión sin afectar a los lípidos o lipoproteínas de plasma de las concentraciones. Utilizando un enfoque ligeramente diferente Rollins y colegas han demostrado que CCL2, el ligando de CCR2, desempeña un papel igualmente importante en el desarrollo de la aterosclerosis en las lipoproteínas de baja densidad de receptores ratones deficientes [24, 25]. En este sentido, la supresión de CCL2 conduce a una importante reducción de la deposición de lípidos dentro de la aorta.

A pesar de los prometedores resultados experimentales de estos sistemas, se conoce relativamente poco acerca de la manera en que la expresión de los genes del receptor de quimioquinas se regula en normal o enfermas tejidos humanos. Un reciente documento de Yamamoto y colegas [26] examinó los mecanismos de regulación basal subyacente de la expresión de genes CCR2 en la línea celular de monocitos humanos, HTP-1. De hecho, este grupo se caracteriza dos elementos clave que parece ser necesaria y suficiente para la regulación de CCR2 basal expresión: Octubre-1 vinculante secuencia de 36 pb situado aguas arriba de la caja TATA y un tándem CAAT / potenciador de la proteína de unión (C / EBP ) Vinculante secuencia situado, excepcionalmente, en el 5 'UTR (a +50 a +77 pb). Sin embargo, los estudios no han examinado directamente los mecanismos moleculares por los que la expresión basal de CCR2 es downregulated rápidamente durante la diferenciación de los monocitos en macrófagos.

En un esfuerzo por abordar esta cuestión, hemos desarrollado un modelo de diferenciación de los monocitos THP-1 utilizando células, que pueden ser inducidas a madurar en los macrófagos, ya sea utilizando ésteres de forbol y ionomycin fisiológica o una combinación de interferón-γ (IFN-γ) Y M-CSF. Al igual que otros estudios, que aquí nos informe HTP-1 maduración de las células mediada por cualquiera de las altas concentraciones de PMA (50 nM) por sí sola, o muy bajas concentraciones de AMP (1 nM) más ionomycin (1 μ M) se caracteriza por un aumento de la Tamaño, el desarrollo de un fenotipo adherente y la sobre regulación de la diferenciación de un panel de marcadores [27 - 30]; además, CCR2, pero no CCR1, se establecen específicamente regulado en la diferenciación. Modulación de CCR2 por PMA (50 nM), pero no PMA (1 nM) más ionomycin (1 μ M), se encontró que ser sensible a la inhibición por el amplio espectro inhibidor de la proteína quinasa staurosporine. Además, la transfección transitoria de células THP-1 con un reportero CCR2 específicos de la construcción indica que la PMA (50 nM) y PMA (1 nM) más ionomycin (1 μ M) mediada la downregulation de CCR2 de CCR2 a través de la inhibición de genes específicos de la transcripción. Además, fisiológicos tratamiento de la HTP monocitos-1 con dos conocidos factores de diferenciación, IFN-γ y M-CSF, también promovió una diferenciación fenotipo esencialmente idéntica a la que se observó el uso farmacológico estímulos. Estos datos indican que la activación de varias vías de señalización intracelular selectivamente la expresión de CCR2 en maduración durante los monocitos macrófagos.

Materiales y métodos
Líneas celulares

La HTP-1 monocitos humanos línea celular (ATCC) fue cultivada en medio RPMI 1640 (GibcoBRL), que contiene 10% de suero de ternera fetal (FCS; GibcoBRL), 100 U / ml penicilina y 100 μ g / ml estreptomicina (GibcoBRL). Las células se mantuvieron en cultivo a 37 ° Cy 5% de C0 2. Normalmente, las células (7 × 10 6 por punto) fueron estimuladas con 50 nM myristate acetato de forbol (PMA, Sigma) o 1 nM PMA más 1 μ M ionomycin (Calbiochem) en la presencia o ausencia de inhibidores de la PKC staurosporine (Calbiochem).

El aislamiento y la cultura de los monocitos de sangre periférica humana

Células mononucleares de sangre periférica (PBMCs) fueron aisladas de recién preparada leukopacks (buffy abrigos) que son entre 2-4 horas de edad. En resumen, 20 ml de sangre diluida fueron de leukopacks utilizando PBS (1:1) y en capas de más de 15 ml de Ficoll-Paque PLUS (Amersham Pharmacia Biotech). Las células fueron centrifugadas a 400 × g durante 20 minutos a temperatura ambiente. Después de este tiempo, PBMCs se obtuvieron de la interfase y lavado (× 2) con PBS y se centrifuga a 150 × g durante 10 minutos. Monocitos fueron más aisladas de PBMCs utilizando Percoll (Amersham Pharmacia Biotech) gradiente de centrifugación como ha sido descrito previamente [31]. Lipídico tinción de los monocitos reveló que su pureza es superior al 90%. Por último, las células fueron cultivadas y resuspendido en 10 6 / ml en RPMI 1640 complementado con 10% de suero autólogo, la penicilina y la estreptomicina (GibcoBRL).

Clonación el promotor CCR2

Un fragmento de 1335 pb del promotor de la hCCR2 gen fue clonado en el vector pGL3 (Promega) usando secuencias determinadas por Yamamoto y colegas [26]. Esta construcción, denominada pGL3-1335, figura el tándem C / EBP sitios más 1220 pb de la secuencia promotora 5 'del sitio de inicio transcripcional. El 5 'cartilla contiene un sitio de restricción para kpnI, mientras que el 3' cartilla contiene una HindIII sitio. Cada cartilla empezó con un 2 bp GC-clamp ricos. El primer pleno secuencias utilizadas son las siguientes:

PGL3-1335 5 'CGGGTACCGCTGCTTTAGGTCCATTTACCCTC

PGL3-1335 3 'GCAAGCTTATTGTACATTGGGTTGAGGTCTCC.

La genómica de PCR se realizó utilizando una temperatura de 55 ° C (30 segundos) y una ampliación de temperatura de 72 ° C (2 minutos), 30 ciclos de PCR se realizaron.

ARN aislamiento y RT-PCR

Total RNA fue aislado usando TRIzol (Life Technologies) y siguiendo las instrucciones del fabricante. Brevemente, las células fueron lyzed en TRIzol y luego mezclado con cloroformo. El lisado fue centrifugada para separar ARN, el ADN y las proteínas. Total RNA, que figura en la parte superior fase acuosa se recuperó y mezclado con isopropanol para precipitar el ARN. El ARN finalmente se lavaron en el 75% de etanol para eliminar las impurezas y se disuelven en el agua.

5 μ g de ARN preparado de esta manera fue llevado DNasa y tratados para separar aún más la contaminación enzimática, antes de ser transcritas a invertir cDNA utilizando un ProSTAR Primera Strand RT-PCR kit de Stratagene y siguiendo las instrucciones del fabricante.

Posteriormente, la RT-PCR se realizó bajo condiciones estándar usando primers específicos para CCR1, CCR2 y GAPDH. El primer secuencias se utiliza aquí:

CCR1 sentido 5'GAAACTCCAAACACCACAGAGGAC

CCR1 antisentido 5'TTCGTGAGGAAAGTGAAGGCTG

CCR2 sentido 5'CCACATCTCGTTCTCGGTTTATCAG

CCR2 antisentido 5'CGTGGAAAATAAGGGCCACAG

CCR3 sentido 5'CACTAGATACAGTTGAGACCTTTGG

CCR3 antisentido 5'GGTAAAGAGCACTGCAAAGAGTC

CCR4 sentido 5'ACCCCACGGATATAGCAGATACC

CCR4 antisentido 5'CGTCGTGGAGTTGAGAGAGTACTTG

CCR5 sentido 5'GGAGCCCTGCCAAAAAATC

CCR5 antisentido 5'CTGTATGGAAAATGAGAGCTGC

CCR6 sentido 5'TGGCAAGGGGTATAATTTGGG

CCR6 antisentido 5'GACAGTCTGGTACTTGGGTTCACAG

CCR7 sentido 5'AGACAGGGGTAGTGCGAGGC

CCR7 antisentido 5'GGATGGAGAGCACTGTGGCTAG

CCR8 sentido 5'ACCTCAGTGTGACAACAGTGACCG

CCR8 antisentido 5'ACCATCTTCAGAGGCCACTTGG

CCR9 sentido 5'CACTGAGGATGCCGATTCTGAG

CCR9 antisentido 5'CGAAATCTGCGTGGCAGTTC

CXCR1 sentido 5'CAGATCCACAGATGTGGGA

CXCR1 antisentido 5'GTTTGGATGGTAAGCCTGG

CXCR2 sentido 5'AACATGGAGAGTGACAGC

CXCR2 antisentido 5'GATGAGTAGACGGTCCTTC

CXCR3 sentido 5'TCCTTGAGGTGAGTGACCA

CXCR3 antisentido 5'GTATTGGCAGTGGGTGGCG

CXCR4 sentido 5'AGTATATACACTTCAGATAAC

CXCR4 antisentido 5'CCACCTTTTCAGCCAACAG

CXCR5 sentido 5'CTGGACAGATTGGACAACTA

CXCR5 antisentido 5'CATCACAACAACTCCCTGA

GAPDH sentido 5'TCCATGACAACTTTGGTATCG

GAPDH antisentido 5'GTCGCTGTTGAAGTCAGAGGA

La temperatura de hibridación utilizado para RT-PCR fue de 55 ° C durante 30 segundos y la extensión de temperatura es de 72 ° C durante 1 minuto; general, de 30 ciclos de PCR se realizaron. En estas condiciones el producto por tamaños CCR1, CCR2 y GAPDH fueron 567 pb, 580 pb y 420 pb, respectivamente.

La tinción con anticuerpos y análisis FACS

HTP-1 o células PBMCs se resuspendió en helado tinción de amortiguación (PBS + 2% FCS + 0,1% de azida sódica) y se incubaron con Fc bloque (Miltenyi Biotec) durante 5 minutos a 4 ° C. Posteriormente, se añadieron anticuerpos primarios (anti-CCR1, CCR2, CCR5, CCR7, CXCR2 y CXCR4; R & D Systems) a una concentración final de 0,5 μ g / μ l. Las células fueron incubadas a 4 ° C durante 25 minutos, después de las cuales fueron lavadas dos veces en la tinción de amortiguación. La secundaria de anticuerpos utilizados para estos experimentos se Alexa 488 (Molecular Probes) a una concentración final de 1 μ g / μ l. Esta vez, las células fueron incubadas a 4 ° C durante 25 minutos en la oscuridad. Tras la incubación con el anticuerpo secundario, las células fueron lavadas dos veces de nuevo, y luego resuspendido en 500 μ l de buffer de tinción. Las muestras fueron analizadas en un cytometer flujo FACScan (Becton Dickinson), utilizando el software Cellquest 3.2.1f1. Monocitos de sangre periférica, derivados de los monocitos y macrófagos THP-1 células fueron también teñidas de CD36, CD68 y CD11b (todos adquiridos de BD Biosciences).

Transfección transitoria mediante DEAE / Dextran

HTP-1 células, cultivadas a una densidad de 5-8 × 10 5 / ml, fueron resuspendidos en solución salina tamponada de Tris (TBS; Tris.Cl 25 mM, pH7.4, 137 mM NaCl, 5 mM KCl, 0,6 mM Na 2 HPO4, 0,7 mM CaCl 2 y 0,5 mM MgCl 2). HTP-1 células (7 × 10 6 por cada punto) se añade a 1 ml de TBS que contiene 5 μ g CCR2 promotor de la construcción-luciferase, 2 μ g de la renilla control de la construcción (pRL-SV40; Promega) y 500 μ g / ml DEAE / Dextran (concentración final). Esta mezcla se dejó a temperatura ambiente por una hora. A continuación, DMSO se añadió a la caída de las células sabia a una concentración final de 10% y se incubaron durante 2 minutos a temperatura ambiente. Posteriormente, las células fueron lavadas dos veces en TBS, una vez en medio RPMI 1640 carece de FCS y antibióticos y una vez en medio RPMI 1640 completo. Las células fueron entonces resuspendido en el medio RPMI 1640 completo, y estimulado con PMA ionomycin (a las concentraciones que se indique lo contrario) y, por último, se incuba a 37 ° Cy 5% de CO 2 durante 48 horas.

Después de las 48 horas de periodo de incubación, las células extractos se presentaron con el reportero luciferase buffer de lisis (Promega). Cada lisado posteriormente se analizaron por el doble luciferase reportero de ensayo (Promega) siguiendo las instrucciones del fabricante. Luciferase actividad se determinó utilizando un Monolight serie 2010 luminometer (Laboratorio Analítico Luminescence) y luego normalizó a la renilla control.

Resultados
Recién aisladas monocitos selectivamente downregulate CCR2, pero no CCR1, en la cultura

Monocitos humanos fueron aisladas de la sangre leukopacks y se coloca en la cultura para un máximo de 5 días (Figura 1]. Durante este tiempo, estas células sufrió cambios, tanto en la morfología y la expresión de los genes. Monocitos recién aislados inicialmente parecía pequeño y redondo, pero después de 5 días de la cultura se convirtieron en adherentes, y el aumento en el tamaño y la granularidad (Figura 1A]. A continuación, analizamos los cambios en la expresión de marcadores de diferenciación de los macrófagos CD11b, CD36 y CD68 (Figura 1B]. Se encontró que los monocitos cultivados durante 5 días upregulated expresión de la integrina CD11b receptores scavenger y el CD36 y CD68, en consonancia con un cambio en el fenotipo de los monocitos a macrófagos (Figura 1B]. A continuación, hemos querido examinar los cambios en la expresión de receptores de quimioquinas como monocitos diferenciados en macrófagos. El uso de los primers específicos para CXCR1-5 y CCR1-CCR9, se realizó el semi-análisis cuantitativo de la expresión del receptor mRNA (Figura 1C]. Inicialmente, sin embargo, se determinó la eficacia y especificidad de los primers mediante el análisis de muestras de ADN genómico preparado a partir de monocitos recién aislados (Figura 1C, grupo I). En todos los casos, una sola banda de que se prevé tamaño se observó que indica que fueron los primers específicos para los receptores de quimioquinas. Este dato sugiere además que la falta de la expresión del receptor de quimioquinas observado en recién aisladas monocitos y monocitos cultivadas de hasta cinco días era un verdadero resultado, y no como un reflejo del primer diseño inadecuado. Posteriormente, se realizó un semi-cuantitativos de análisis de expresión de mRNA del receptor de recién aisladas monocitos y monocitos cultivadas por un máximo de cinco días (Figura 1 C, grupo II). En estas condiciones, recién aisladas monocitos mostró firme expresión de CCR1, CCR2, CCR5, CXCR2 y CXCR4 mRNAs, y rastrear los niveles de mRNA CCR4 y CCR7. Expresión de CCR1, CCR2, CCR5 y CXCR4 mRNAs sigue siendo elevada después de dos días en la cultura, mientras que la de CXCR2 disminuido, y que el aumento temporal de CCR7. Sin embargo, después de cinco días en la cultura CCR2 mRNA expresión, pero no la de CCR1, CCR5 o CXCR4, se dramáticamente downregulated (Figura 1C, grupo II). De hecho, los niveles de ARNm de CCR5 y CCR1 aumentado en la práctica más de los que se observan en recién aisladas monocitos. Para confirmar la especificidad de este efecto que posteriormente comparación superficie celular expresión de estos receptores de quimioquinas cultivadas en monocitos y monocitos recién aislados por citometría de flujo (Figura 1D]. De acuerdo con nuestros datos mRNA, expresión de CCR2 proteína, pero no CCR1, CCR5 y CXCR4, fue rápidamente downregulated monocitos durante la maduración. Insignificante superficie celular CCR7 expresión de la proteína se observó en ninguno de los puntos explorados, en tanto que expresión CXCR2 superficie celular, curiosamente, sigue siendo elevada a pesar de CXCR2 mRNA downregulation, lo que sugiere que la vida media de esta proteína es, en realidad, bastante largo (Figura 1D].

Estos resultados indican que una consecuencia de la maduración de los monocitos es la downregulation selectiva de la expresión de genes CCR2 seguida de una pérdida de CCR2 en proteínas de la superficie de la célula. Si bien la función fisiológica de este proceso es desconocida, es probable que CCR2 baja regulación pueda participar en la restricción "de revertir la migración de los monocitos diferenciados de nuevo en el torrente sanguíneo, y facilitar así la captura dentro de los tejidos.

PMA tratos de los monocitos induce selectivo downregulation de CCR2

Con base en los resultados de arriba hemos decidido seguir examinando la regulación de la expresión de CCR2 monocitos maduración utilizando la línea celular de monocitos humanos, HTP-1 y CCR1 como control. El tratamiento de estas células con la activación de la PKC-éster de forbol PMA durante 48 horas es un procedimiento ampliamente aceptado para la maduración de los monocitos [27, 28]. Las células tratadas de esta manera se someten a los cambios fenotípicos en consonancia con su maduración en los macrófagos [27 - 30] (también comparar las figuras 1 y 6].

A continuación, hemos querido determinar la forma en el tratamiento de la línea celular de monocitos, THP-1, con PMA afectado a la expresión de CCR2 en estas células. Así, monocitos fueron estimulados con PMA (a las concentraciones que se indica) durante 48 horas y ARN preparado como se ha descrito anteriormente. Nuestros resultados (Figura 2A] muestran que se CCR2 selectivamente las reguladas en una forma dependiente de dosis, en tanto que expresión de CCR1 (la otra principal receptor de CC en monocitos) y de mantenimiento de la casa gen GAPDH quedado incólume. PMA (50 nM) fue suficiente para abrogar completamente CCR2 expresión (Figura 2A, carril 8), mientras que 10 nM PMA redujo la expresión de este receptor de quimioquinas por aproximadamente el 75% (Figura 2A, carril 7). Tratamiento de la HTP-1 células con 1 nM PMA no afectó la expresión de CCR2 (Figura 2A, carril 6).

Posteriormente, se examinó si PMA modula la expresión de la superficie celular CCR1 y CCR2 análisis por FACS. HTP-1 fueron de nuevo las células estimuladas con PMA (50 nM) para el momento indicado, antes de ser teñidas con los anticuerpos y luego analizadas por citometría de flujo (Figura 2B]. Considerando que los niveles de CCR1 mantuvo alto durante toda la duración del experimento, CCR2 la expresión de la proteína disminuyó drásticamente. La mayor parte de la expresión se perdió por 24 horas y de 48 horas prácticamente no CCR2 se encontró en la superficie cultivada de la HTP-1 células (comparar Figura 2B, paneles izquierdo y derecho). Así, las células THP-1 tratados con PMA (50 nM) imita el proceso de diferenciación observado en monocitos cultivados.

Dos diferentes vías de transducción de señales CCR2 expresión regular durante la maduración monocitos

Nuestras observaciones iniciales sugirieron que, si bien la PMA (50 nM) totalmente derogado CCR2 expresión, sub-óptimo de las concentraciones de este éster de forbol (1 nM) no tuvo ningún efecto (Figura 2A]. Nos pregunta, por lo tanto, si la adición de una señal de calcio (como ionomycin) junto con el nivel óptimo de concentración de PMA podría proporcionar un fuerte estímulo suficiente para afectar a la expresión de CCR2. Por lo tanto, incubadas con monocitos PMA (1 nM) y ionomycin a las concentraciones que se indica para las 48 horas, y luego analizaron CCR2 expresión. Nuestros datos indicaron que ionomycin por sí solo no afecta a la expresión de CCR2 (Figura 3A, panel central, carriles 4-6). Sin embargo, en presencia de un sub-óptimo PMA señal (1 nM), hubo una selectiva reducción dosis dependiente en CCR2 expresión (Figura 3A, panel central, carriles 7-9). Al mismo tiempo, similares concentraciones de AMP y ionomycin no afectó los niveles de CCR1 ni GAPDH (Figura 3A paneles superior e inferior). Monocitos tratados con PMA (1 nM) más ionomycin (1 μ M), también se observaron a adoptar un fenotipo adherente y aumentar de tamaño similar a los cambios en la morfología observada en el recién aisladas monocitos (datos no presentados). Además, la expresión de la superficie celular CCR2, pero no CCR1, resultó ser downregulated en presencia de AMP (1 nM) más ionomycin (1 μ M) después de 48 horas (Figura 3B]. Así, sub-óptimo de las concentraciones de AMP, junto con una modesta señal de calcio se combinan para la maduración de mediador en un fenotipo de los monocitos que también incluye el selectivo downregulation de CCR2.

Para determinar si el selectivo downregulation de CCR2 observado en la PMA PMA versus tratamiento más ionomycin células representó a la misma o dos diferentes vías de señalización, se realizó un experimento utilizando el amplio espectro inhibidor de quinasa, staurosporine (Figura 4]. Estamos preincubated HTP-1 con células staurosporine a las concentraciones que se indica durante dos horas y, a continuación, ya sea estimulada con PMA (50 nM; Figura 4A] o PMA (1 nM) más ionomycin (1 μ M; Figura 4B] durante 48 horas. Staurosporine solo (en concentraciones de hasta 200 nM) no inhiben significativamente la expresión de CCR2 (Figura 4A, carriles 9 y 10 y la figura 4B, carril 6) ni CCR1 (Figura 4A, carriles 3 y 4 y la figura 4B, carril 2). Además, el inhibidor de no derogar la downregulation de CCR2 mediada por AMP más ionomycin (Figura 4B, comparar carriles 7 y 8). En cambio, staurosporine a 50 nM, pero no a las 10 nM, bloqueó la pérdida de CCR2 en los PMA (50 nM) células tratadas (Figura 4A, comparar carriles 7, 8, 11 y 12).

Por lo tanto, estos resultados identifican al menos dos posibles vías de transducción de señales presentes en los monocitos que podrían regular la expresión de CCR2 en la diferenciación de los monocitos.

CCR2 expresión está regulada a nivel de transcripción

Una vez establecido que se establecen CCR2 reguladas en la diferenciación de los monocitos, que quería próxima para determinar si la reglamentación se produce a nivel de ARN o la estabilidad en el nivel de transcripción. Nosotros, por lo tanto, clonado un fragmento de 1335 bp CCR2 el promotor utilizando la secuencia descrita por Yamamoto y colegas [26]. Este fragmento fue entonces subcloned mamíferos en la expresión del vector pGL3 aguas arriba de la luciferase genes, que generan la construcción de pGL3-1335. Además de las secuencias de aguas arriba de la caja TATA, pGL3-1335 incluyó 115 bp de la 5'UTR, que contiene los dos tándem C / EBP reitera que se consideran necesarias para la expresión basal de la CCR2 genes [26].

Posteriormente, se ha transfectadas en la construcción de este HTP-1 utilizando células DEAE / dextrano y de la izquierda, ya sea que las células no tratadas o tratadas con PMA (50 nM) o PMA (1 nM) más ionomycin (1 μ M) durante 48 horas en la Presencia o ausencia de staurosporine (100 nM). Las células fueron entonces lyzed y análisis en busca de actividad transcripcional. Nuestros resultados muestran que la construcción de pGL3-1335, que a su vez, dio una inducción de 13 veces más de la falta de antecedentes construir el CCR2 promotor (Figura 5, comparar los carriles 1 y 2). Además, el PMA y PMA tanto más firmemente ionomycin derogó esta actividad transcripcional (Figura 5 carriles 3 y 4) lo que sugiere que la doble vías de transducción de señales activadas por el PMA y el PMA, más ionomycin mediada CCR2 expresión de la regulación a nivel de transcripción. En presencia de staurosporine, CCR2 promotor inhibición de la actividad mediada por AMP, pero no PMA (1 nM) más ionomycin (1 μ M), se derogó (Figura 5, comparar carriles 6 y 7). Por lo tanto, estos datos indican que la PMA (pero no el más ionomycin PMA) mediada por la inhibición de la actividad promotora CCR2 es, en última instancia regulada por una o más staurosporine sensible a los factores de transcripción.

El tratamiento con IFN-γ y M-CSF produce una diferenciación fenotipo similar a la observada con el PMA y ionomycin

Debido a los resultados obtenidos reflejan un fenotipo inducido por agentes farmacológicos y el próximo querían asegurarse de que este fenotipo es aplicable a los agentes también fisiológicos. Para ello, las células THP-1 tratados con IFN-γ plus M-CSF ya se han mostrado para promover la maduración de los monocitos, a pesar de que aún no se ha confirmado que estos agentes CCR2 expresión regular a nivel de la transcripción [32]. Inicialmente, sin embargo, hemos querido demostrar que los monocitos tratados con IFN-γ plus M-CSF mostraron cambios en la morfología similar a la observada con el recién aisladas monocitos (comparar las figuras 1 y 6]. Después de 48 horas de tratamiento con IFN-γ plus M-CSF, se convirtió en monocitos adherente y en el aumento de tamaño similar a la observada para los monocitos recién aisladas en la cultura (comparar Figura 1A y Figura 6A panel central). PMA tratados monocitos también sufrió cambios similares en la morfología (Figura 6A, panel inferior). Por otra parte, estudios de citometría de flujo reveló que monocitos tratados con IFN-γ, más o M-CSF PMA firmemente upregulated marcadores de la maduración de los macrófagos CD11b, CD36 y CD68 (Figura 6B]. Resultados similares se observaron para las células tratadas con más ionomycin PMA (datos no presentados). Así, monocitos tratados con un grupo de estímulos fisiológicos y farmacológicos para promover la maduración de los macrófagos en el fenotipo determinado por los cambios en la morfología y upregulation marcadores de la maduración de los macrófagos.

A continuación, queríamos determinar si el IFN-γ plus M-CSF induce la diferenciación asociada a downregulation de CCR2 (Figura 7]. Por lo tanto, los monocitos fueron tratados con IFN-γ (500 U / ml) por M-CSF (5 ng / ml) durante 48 horas y se examinó CCR2 ARNm (Figura 7A]. Nuestros resultados indican que el IFN-γ plus M-CSF hizo selectivamente downregulate CCR2, CCR1, pero no de una manera análoga a la observada para los PMA y PMA, más ionomycin (Figura 7A paneles superiores y medios). Un patrón similar se observó también cuando se examinó la actividad transcripcional (Figura 7B]. Aquí, PMA completamente modulada CCR2 transcripción, mientras que los efectos combinados de IFN-γ M-CSF más reducido esta actividad en un 70% aproximadamente. En presencia de staurosporine, la inhibición de la actividad promotora CCR2 mediada por IFN-γ (500 U / ml) por M-CSF (5 ng / ml) fue derogada de manera análoga a la observada para los PMA (Figura 7B carriles 6 y 7).

Tomados en conjunto, estos datos indican que el PMA (50 nM), el PMA y más ionomycin más IFN-γ M-CSF mediar cambios similares en el fenotipo de los monocitos durante la maduración de estas células. Así, la línea celular de monocitos, THP-1, es un modelo útil con el que el sistema para investigar los mecanismos de regulación que rigen la expresión del receptor de quimioquinas en la diferenciación de los monocitos.

Discusión

En el presente trabajo se demuestra que una consecuencia importante en la maduración de los monocitos macrófagos es la downregulation selectivo de los receptores de las quimioquinas, CCR2, pero no los relacionados con CCR1. Además, hemos demostrado que existen múltiples estímulos, el cual puede reducir selectivamente modular-CCR2 expresión, incluida la alta concentración de la PMA (50 nM), o de bajo PMA (1 nM) más ionomycin (1 μ M), o IFN-γ (500 U / Ml) por M-CSF (5 ng / ml). Cada uno de estos estímulos regulan la expresión de CCR2 en el nivel de transcripción, si bien parece que, al menos, dos diferentes vías de transducción de señales involucradas están basadas en la capacidad de staurosporine interferir en estos procesos. Tratamiento de la HTP-1 monocitos con staurosporine derogó la capacidad de los PMA y de IFN-γ, más M-CSF a downregulate CCR2. Por el contrario, staurosporine no pudo bloquear el PMA, más ionomycin mediada downregulation expresión de CCR2. Por tanto, este estudio proporciona evidencia de que existe un dinámico y selectivo, la regulación de la CCR2 genes durante la diferenciación de los monocitos.

Nuestros resultados indican que el tratamiento de la HTP-1 con las células, ya sea por sí solo PMA (50 nM) o PMA (1 nM) más ionomycin (1 μ M) promueve un fenotipo diferenciación que se caracteriza por cambios morfológicos y de la expresión de genes alterados CCR2. De hecho, estas observaciones han sido ya señalado por otros investigadores que estudian la diferenciación de los monocitos [27, 28, 32]. En particular, muestran que las células THP-1 convertido rápidamente en adherente y su morfología típica de los cambios de la forma redonda de los monocitos a las células con forma de huso con pseudópodos, que son característicos de los macrófagos. Al mismo tiempo existe también un aumento en el tamaño y la granularidad de las células. Además, hemos demostrado una regulación en la expresión de genes asociados con la diferenciación de los monocitos, en particular CD11b, CD36 y CD68. Al mismo tiempo, la expresión de CCR2, pero no CCR1, downregulated fue selectiva, lo que sugiere que la pérdida de este receptor de quimioquinas es una consecuencia de la diferenciación de los monocitos. Este downregulation se observó en el nivel de expresión del receptor de la superficie celular, la expresión mRNA, y la transcripción. Es evidente que estos acontecimientos son específicos de reglamentación ya que los niveles de mRNA CCR1 no se ven afectados por cualquiera combinación de agentes farmacológicos.

Sin embargo, cuando las células THP-1 fueron tratados con PMA (50 nM) o más ionomycin PMA, en presencia de staurosporine, diferencial resultados fueron obtenidos: PMA mediada por la modulación de CCR2 fue sensible a los efectos inhibitorios de staurosporine (50 nM), mientras que Staurosporine concentraciones tan altas como 200 nM PMA no bloquear más ionomycin inducida downregulation de CCR2. Staurosporine por sí solo no promover la pérdida de cualquiera de CCR2 o CCR1. Estos resultados indican que staurosporine define una dicotomía en la regulación de la expresión de CCR2 PMA (50 nM) frente a más PMA ionomycin que no había sido apreciada anteriormente.

Staurosporine, en sí, es un amplio espectro inhibidor de la proteína cinasas incluidas PKA, PKC, y PKG. PMA ha sido clásicamente se muestra a actuar casi exclusivamente a través de PKC y esto explicaría por qué staurosporine fue capaz de bloquear la PMA inducida downregulation de CCR2. Por inferencia, el PMA, más ionomycin parece actuar a través de una vía de transducción de señales que no es inhibida por staurosporine y esto significa que, presumiblemente, segundos mensajeros distintos de PKA, PKC y PKG están involucrados. Para ello, la calcineurina, una fosfatasa sensible al calcio puede ser un objetivo de la AMP, más ionomycin [33]. Un aumento de la concentración intracelular de calcio (como el que ofrecía la presencia de ionomycin) promueve un cambio conformacional en la calcineurina, que luego dephosphorylates y activa el factor de transcripción NFAT facilitar su traslocación al núcleo. Además, se ha demostrado que los PMA aumenta la sensibilidad de calcio NFAT, creando así una sinergia señal [33, 34]. Esta sinergia puede ser el resultado de la síntesis de novo y la modificación después de la traducción de otro factor de transcripción denominado activación de la proteína-1, AP-1 [33, 34]. De hecho, NFAT proteínas muestran una característica capacidad de cooperar con la AP-1 en el ADN vinculante y transactivation [33, 34]. Curiosamente, en la región del promotor CCR2 clonados que hay dos sitios de unión para putativo AP-1 (básico vinculante motivo TGA (C / G) TCA) y tres sitios de unión para putativo NFAT (básicos vinculante motivo GGAAA) según lo determinado por MatInspecter el factor de transcripción sitio de unión programa de análisis. También se ha sugerido que otros factores de transcripción incluyendo OCT1 y C / EBP puede actuar sinérgicamente con NFAT y de nuevo hay múltiples sitios de unión para cada una de estas proteínas que unen el ADN en el CCR2 promotor, aunque en este momento no tenemos pruebas que indiquen Que estén implicadas en la regulación fisiológica de la expresión génica CCR2.

Un requisito para la cooperación intersectorial y hablar entre estos dos agentes farmacológicos es apoyada asimismo por el hecho de que ionomycin solo (a concentraciones tan altas como 1 μ M) no pudo bajar de modular CCR2.

Algunos informes han sugerido que CCL2 podrían estar involucrados en las primeras etapas de CCR2 modulación de las proteínas, mientras que otros estudios indican que el proceso de diferenciación en sí, es un factor importante en la pérdida selectiva de la expresión de genes CCR2 [8, 32]. Numerosas citocinas son las que se sabe están involucrados en la activación y diferenciación de los monocitos, entre ellos el M-CSF e IFN-γ [32, 35, 36]. M-CSF es un linaje-específicos hematopoetic factor de crecimiento que estimula la diferenciación de los monocitos [35, 36]. El c-fms proto-oncogen codifica una alta afinidad por los receptores de H-CSF [37] y se ha demostrado que las células THP-1 expresar esta proteína y que es regulado en la diferenciación. Sin embargo, las células estimuladas con M-CSF solos durante 48 horas no perdió la expresión de CCR2 (datos no presentados).

Por el contrario, el IFN-γ por sí solo, que es constitutivamente expresadas por los monocitos linaje y células que promueve la maduración de los monocitos a macrófagos [38], ¿reducir significativamente la expresión de CCR2, aunque las células no se conviertan en adherente y tampoco cambian de morfología (datos No se muestra). Curiosamente, el IFN-γ se ha demostrado-a regular hasta los niveles de la M-CSF en monocitos durante la maduración [38], y cuando ambos IFN-γ y M-CSF se añadieron, HTP-1 hizo convertirse en células adherentes, modificó su morfología y selectiva CCR2 perdido, pero no CCR1 - todas las cuales son características de la diferenciación de los monocitos fenotipo. Estos resultados están en consonancia con los estudios publicados por Tangirala y colegas, que informaron de fenómenos similares en células THP-1 [32]. Además, nuestros estudios han demostrado también que los efectos de reglamentación mediada por IFN-γ plus M-CSF produjo en el nivel de transcripción, en donde un importante descenso de regulación del promotor en CCR2 Se observó actividad. Además, en presencia de staurosporine, además de IFN-γ M-CSF no pudo bajar de regular los niveles de CCR2. Este resultado probablemente refleja el hecho de que el IFN-γ señales ampliamente a través de la vía de JAK-STAT, y los estudios han sugerido que staurosporine puede bloquear la fosforilación de las quinasas Janus [39, 40]. Además, hemos encontrado dos putativo sitios de unión en el promotor de CCR2 STAT factores de transcripción que se siga prestando apoyo a la afirmación de que estos factores de transcripción puede ser importante en la regulación de IFN-γ mediada downregulation de CCR2.

Conclusión

Este estudio demuestra que la expresión de los receptores de quimioquinas CCR2 es exquisitamente correlacionado con monocitos maduración. Recién aisladas monocitos expresan altos niveles de ambos CCR2 ARN y proteínas, mientras que los monocitos-macrófagos derivados de expresar ni CCR2 ARN ni proteínas. Por el contrario, los niveles de quimioquinas estrechamente relacionada con el receptor CCR1 se mantuvo estable y elevación de los monocitos a lo largo de maduración. Un análisis de los mecanismos bioquímicos y moleculares subyacentes a la expresión regulada de CCR2 reveló la existencia de varias vías de señalización que modulan selectivamente abajo-CCR2 la expresión génica durante la diferenciación de los monocitos; esta expresión es en gran medida regulada a nivel de transcripción. PMA y de señalización a través de IFN-γ M-CSF más, pero no más ionomycin PMA fue derogado por el tratamiento previo de las células THP-1 con staurosporine. Aunque el papel fisiológico de este proceso no es bien entendido, es probable que CCR2 baja regulación pueda participar en la restricción de la 'revertir la emigración de los monocitos diferenciados de nuevo en el torrente sanguíneo. Esto, a su vez facilita la conservación de los monocitos diferenciados dentro de los tejidos inflamados. Así, mediante la mejora de nuestra comprensión de los mecanismos de regulación que rigen CCR2 expresión de los monocitos las células linaje, podemos apreciar mejor la forma de contratación y activación de los monocitos está controlado durante patologías inflamatorias crónicas como la aterosclerosis.

Conflicto de intereses

Brett Premack la actualidad trabaja como Director de Tecnología en Chemocentryx. Dr Premack es el titular de las poblaciones de peces dentro de esta empresa. Esta empresa investiga el papel de las quimiocinas y sus receptores como posibles terapias. Uno de estos proyectos es investigar el papel de los antagonistas CCR2 en la enfermedad cardiovascular y una primera fase de ensayos clínicos está en curso. En el momento de este estudio se llevó a cabo Dr Premack no remunerado es un consultor para Chemocentryx. Ni Marín ni Roderick Phillips Lutz tiene un interés compiten en este trabajo.

Contribuciones de los autores

RJP escribió el manuscrito y se lleva a cabo todos los experimentos con excepción de la Figura 1A y 1C. ML realizó experimentos presentados en la Figura 1A y 1C. BP concebido del estudio, y participaron en su diseño y la coordinación y la ayudó a redactar el manuscrito. Todos los autores leído y aprobado el manuscrito final.

RJP con el apoyo de la Asociación Americana del Corazón subvención 9960044Y