Journal of Inflammation (London, England), 2005; 2: 15-15 (más artículos en esta revista)

Nurr1 dependientes de la regulación en favor de los mediadores de la inflamación en inmortalizado fibroblastos sinoviales

BioMed Central
Mark Davies R (mark.r.davies @ astrazeneca.com) [1], Christine J Harding (christine.harding @ astrazeneca.com) [1], Stephanie Raines (stephanie.raines @ astrazeneca.com) [1], Kurt Hasan (kurt.tolley @ astrazeneca.com) [1], Andrew E Parker (andrew.parker @ astrazeneca.com) [1], Mark Downey-Jones (mark.downey-jones @ astrazeneca.com) [1], Maurice RC Needham (maurice.needham @ astrazeneca.com) [1]
[1] La inflamación respiratoria y Departamento de Investigación, AstraZeneca, Mereside, Alderley Park, Macclesfield, Cheshire, SK10 4TG, UK

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Nurr1 es un huérfano miembro de la superfamilia de receptores nucleares, los receptores de estos huérfanos son un grupo para el que un ligando aún no se ha identificado. Nurr1 se ha demostrado que la regulación de la expresión de un pequeño número de genes como un monómero, constitutivamente activa de los receptores. Estos genes están regulados Nurr1 principalmente asociados a la dopamina maduración de las células y la supervivencia. Sin embargo, informes anteriores han demostrado un incremento en la expresión de Nurr1 en la sinovial de los pacientes con artritis reumatoide (AR), sugiriendo un papel pro-inflamatorias para Nurr1 en la AR. En este estudio investigamos el potencial pro-inflamatorias papel de Nurr1 mediante la vigilancia de la expresión de genes dependientes de Nurr1 en una línea celular inmortalizada synoviocyte, K4IM.

Métodos

Estamos sobreexpresa el tipo salvaje y dominante negativo de la forma nuclear receptor Nurr1 huérfano, en un modelo synoviocyte línea celular. Uso de la Affymetrix HG-U133 Genechips que demostrar los efectos sobre la transcriptome por el receptor. Otra prueba de la expresión de genes del cambio se demostró mediante RT-PCR cuantitativa y análisis de ELISA.

Resultados

Nos muestran que Nurr1 regula la transcripción de un pequeño número de genes para pro-inflamatorias moduladores de los cuales el más importante es la interleuquina-8 (IL-8). También demuestran el aumento de la síntesis y secreción de IL-8 más un papel de apoyo para Nurr1 en vías de señalización inflamatoria.

Conclusión

Utilizando el análisis de microarrays nos muestran que los niveles elevados de Nurr1 conduce a un aumento de la expresión génica de los genes pro-inflamatorios: IL-8, Amphiregulin Kit y ligando en un modelo de línea celular. Esta información proporciona una prueba más de una función adicional para Nurr1 en la inflamación y pueden desempeñar un papel en la patogénesis de la artritis reumatoide.

Antecedentes

Receptores nucleares en general puede ser descrito como ligando activan factores de transcripción que forman una gran superfamilia de las proteínas. En humanos los receptores de esos 48 han sido identificados [1] y participan con un gran número de procesos celulares en todo el desarrollo y la fisiología de adultos [2]. Receptores nucleares se activan a través de vinculante por una gran variedad de la riqueza natural y producida sintéticamente moléculas ligando incluyendo hormonas, ácidos grasos y antibióticos. Además de los receptores conocidos de obligar a ligando, un grupo de receptores nucleares existen para que un ligando no ha sido identificado, que se denominan los receptores nucleares huérfanos. Entre este grupo de huérfanos es Nurr1 (NR4A2), un miembro de la RN4 grupo de receptores nucleares huérfanos junto con Nur77 (NR4A1) y NOR-1 (NR4A3) [3]. Esta familia puede obligar a los monómeros de ADN como elementos de respuesta en los promotores de los genes y activar la transcripción en ausencia de ligando [4]. Curiosamente, esta familia de los receptores son también capaces de unirse como un heterodimer con el 9 - cis-ácido retinoico receptor RXR [5] o como un heterodimer-Nur con otros miembros de la familia [6]. RXR como heterodimer con Nurr1 se mantiene activa, lo que sugiere que la regulación puede ser modificada por el uso de rexinoids concretas para mejorar la respuesta de estos receptores de factores de crecimiento y, por lo tanto, esto podría proporcionar una nueva vía terapéutica para el tratamiento de la enfermedad Nurr1 regulado.

La estructura de Nurr1 acaba de ser resuelto poner de relieve las diferencias entre Nurr1 y la conocida liganded receptores nucleares [7]. Sobre la base de homología de modelos, en la región Nurr1 que normalmente contienen el ligando vinculante bolsillo ha demostrado ser sustancialmente diferentes de otros receptores nucleares lo que sugiere que no hay suficiente espacio en el bolsillo putativo ligando vinculante para dar cabida a un ligando. Esto puede explicar las observaciones que Nurr1 se puede activar la transcripción de una manera independiente del ligando y ligando por qué no aún no se ha informado de Nurr1.

En contraste con la mayoría de los receptores nucleares, Nurr1 es codificada por un gen temprano inmediato que es rápidamente inducido en las células en respuesta a estímulos externos, como las citoquinas. Nurr1 ha sido implicado en una serie de enfermedades humanas incluyendo la enfermedad de Parkinson [8, 9], [10] esquizofrenia, la dependencia del alcohol [11] y de la artritis reumatoide [12]. De conformidad con la naturaleza de estas enfermedades, la expresión de Nurr1 se observa en los países en desarrollo y de adultos dentro de la CNS y de la inflamación sinovial reumáticas conjunto [12 - 14].

Una serie de genes que se han demostrado que se rige por Nurr1; muchos de estos están involucrados con el desarrollo y mantenimiento de las neuronas dopaminérgicas mesencéfalo. Estos incluyen tirosina hidroxilasa [4], Ret tirosina quinasa [15] y el transportador de dopamina (SLC6A3) [16]. La Nur-miembros de la familia también se han mostrado a desempeñar un papel fundamental en la regulación de la expresión de CRH y pro-opiomelanocortin (POMC) en el hipotálamo-hipofisario-adrenal (HPA) eje [6, 17 - 19]. Estos estudios, realizados en ratones células de la hipófisis, CRH también demostrar que es capaz de causar un incremento en la expresión de Nurr1, lo que sugiere la presencia de un circuito de retroalimentación positivo. Más recientemente, los estudios en el tejido sinovial reumatoide tomado del conjunto Nurr1 han demostrado ser altamente expresado. Además se ha demostrado que las citoquinas inflamatorias son capaces de aumentar Nurr1 expresión a través de NF-κ B, y dependen de señalización y CREB esta elevación en Nurr1 conduce a un aumento de la transcripción de CRH [12, 20]. Si bien en el eje HPA, estos estrecha-Nur miembros de la familia son capaces de compartir la superposición de funciones, sinoviocitos en la enseñanza primaria, el tratamiento con diversas citoquinas muestra predominantemente Nurr1 upregulation [20]. Por lo tanto, en reumática sinovial se propone que Nurr1 está actuando a exacerbar la respuesta inflamatoria por conducir un Nurr1-CRH bucle de respuesta positiva, lo que indica su potencial como un posible objetivo de la intervención terapéutica.

El propósito de este estudio fue investigar más a fondo el papel de Nurr1 en la regulación de procesos inflamatorios en las células sinoviales, y mediante el uso de perfiles de transcripción Nurr1 para identificar genes regulados en sinoviocitos, que pueden estar desempeñando un papel importante en la patogénesis de la artritis reumatoide.

Métodos
Plásmido expresión construcciones

Un reportero construcción genética generado por ligar oligonucleótidos que representa el 3 tándem repetido consenso Nurr1 sitios de unión (NurRE), en la SpeI / AflII sitio de la SW-gal construir a lo descrito previamente [21], para generar la construcción de: pNurRE3gal. El sentido capítulo oligonucleótidos (5'-3 ') para la inserción fueron los siguientes, 3XNurRE: ctagtgtgacctttattctcaaaggtcagtgacctttattctcaaaggtcagtgacctttattctcaaaggtcac. La construcción del plásmido control pCMV / hGH se ha descrito previamente [22]. Dominante se construye negativos producidos por la fusión del ADN de dominio vinculante de Nurr1 (aa94-365) y la Drosophila engrailed dominio (aa2-298) en el vector pcDNA3.1 expresión para dar pcDNA3.1-Nurr1-DN. El tipo de genes silvestres Nurr1 fue amplificado de PCR RNA de todo el cerebro y clonado en el pcDNA3.1-V5-SU vector de la secuencia de ADN y verificar.

Cultivo de células

K4IM células (un generoso regalo de E. Murphy) se cultivaron en los medios de comunicación RPMI-1640 suplementado con 10% (v / v) de suero fetal de ternera (FCS), 2 mM de glutamina y 50 μ g / ml de penicilina-estreptomicina (Gibco BRL). Células HeLa se cultivaron en los medios de comunicación MEDM complementado con un 10% (v / v) de suero fetal de ternera (FCS), 2 mM de glutamina y 50 μ g / ml de penicilina-estreptomicina (Gibco BRL). Para los ensayos de gen reportero, células HeLa se cultivaron en rojo fenol libre de MEDM complementado con 0,5% (v / v) FCS, glutamina 2 mM y 50 μ g / ml de penicilina-estreptomicina.

Reportero gen ensayos

24 horas antes de la transfección, 2,2 × 10 6 células HeLa Se sembró en un plato 9 cm 2, en pleno crecimiento medio. Las células fueron transfectadas por la precipitación de fosfato de calcio, con un total de 20-25 μ g de ADN por 1 ml de precipitado como ha sido descrito previamente [23]. En general, 10-15 μ g reportero de la construcción fue co-transfectadas con 2-5 μ g de Nurr1 vacía o vector de ADN (pcDNA3.1) e incluyendo CMV 0,5 μ g / plásmido hGH para la normalización de datos. 6 horas después de la transfección de las células fueron expuestas a choque osmótico (15% de glicerol en MEDM durante 90 segundos) y la sustituye por los medios de comunicación-rojo fenol libre MEDM complementado con 0,5% de FCS (ensayo mediano). Las células fueron cosechadas por 16-20 horas después de incubar las células con tripsina-EDTA (rojo fenol libre) por 3 min a 37 ° C. Las células fueron contados, sin semilla y en 96 placas de microtitulación a 10 5 células / así en el 100 μ l de ensayo mediano y incubados por un nuevo 16-20 hrs. Β-galactosidasa actividad fue medida utilizando el sustrato espectrofotométricos, CPRG (Boehringer) que se describió anteriormente [21]. En resumen, 100 μ l de un cóctel que contiene 7 μ l 50 mM CPRG, 7 μ l de buffer Z pH7 (600 mM Na 2 HPO 4; 400 mM NaH 2 PO 4; 100 mM KCl, 10 mM MgSO 4; 500 mM β-mercaptoetanol), 1 μ l 20% SDS y 85 μ l dH 2 O se añadió el agua directamente a cada bien y las placas se incubaron a 37 ° C antes de OD 570 nm medida fue tomada. Tiempos de incubación varía dependiendo de los ensayos individuales, pero en general eran 30 min-3 hrs. Secretan la hormona del crecimiento de la célula sobrenadantes se midió utilizando un anticuerpo 2-sandwich ELISA como ha sido descrito previamente [22]. Β-galactosidasa valores se normalizaron los valores utilizando la hGH.

Determinación de IL-8 niveles de proteína

IL-8 se cuantificó mediante ELISA (R & D de sistemas - D8050). K4IM células se resuspendió en Amaxa solución "R" a una concentración de 0,4 × 10 6 células por 100 μ l. Un total de 2 μ g de ADN se transfectadas Amaxa Nucleofector utilizando el siguiente protocolo del fabricante (A-23). Los medios de comunicación fueron recogidos 48 h posteriores nucleofection se utiliza en estado puro y en doble ejemplar de acuerdo a las instrucciones del fabricante.

RT-PCR cuantitativa

TaqMan cuantitativa en tiempo real de reacción en cadena de la polimerasa (PCR), ensayo se realizó utilizando un ABI Prism 7700 Sequence sistema de detección, de acuerdo con el protocolo del fabricante (Applied Biosystems), secuencias de los primers y sondas se encuentran en la Tabla 1. Además, primers y sondas para IL-8 se obtuvieron como un pre-formulado 20 × mezcla de Applied Biosystems. La amplificación de GAPDH (primers / sonda mezcla 4310884E) se realizó para normalizar la cuantificación del objetivo de ARN, lo que permite utilizar la cuantificación relativa ABI Prism 7700 SDS software v1.9. En resumen, 25 ng de una mezcla de cerebro, la placenta y los testículos ARN total (Ambion 7962, 7950 y 7972) y el posterior de 5 veces diluciones seriadas a 1 / 3125 de puro fueron amplificados por triplicado para ambos GAPDH y cada uno de los objetivos de genes para producir Una curva estándar. ARN fue extraído de células por medio de reactivo TRIzol (Gibco-BRL) de acuerdo con las directrices del fabricante. Total RNA fue analizado y cuantificado usando el Bioanalyser Agilent 2100 con el ARN Nano6000 chip. A los efectos de Taqman y análisis RT-PCR, el ARN fue tratado con DNasa la DNasa-excluir kit (Ambion) de acuerdo con el protocolo del fabricante. 5 μ l de ARN a una concentración de 5 ng / μ l fue dispensado por triplicado óptico en placas de 96 pozos para Taqman RT-PCR. Cada una de las muestras se complementó con las dos respectivas adelante, inversión de primer y etiquetados sonda fluorescente en un volumen total de reacción de 25 μ l utilizando Taqman Quantitect Probe-Mix Master y RT mezcla de enzimas (Qiagen - 204443). Cada objetivo sonda se amplificó en una placa de 96 pocillos. Todas las muestras fueron incubadas por una duración inicial de la transcripción invertida de la reacción a 50 ° C durante 30 minutos y luego a 95 ° C durante 15 minutos, seguido de 40 ciclos a 95 ° C durante 15 segundos y 60 ° C durante 1 minuto.

DNA microarray

Nucleofection se utilizó para transfect los siguientes tres construcciones de expresión en la línea celular K41M: 1. Vector pcDNA3.1 en blanco (control), 2. PcDNA3.1-Nurr1-WT (Nurr1 WT), 3. PcDNA3.1-Nurr1 194-365 EnR 2-298 dominante negativo (DN) co-transfectadas con pcDNA3.1-Nurr1-WT (Nurr1 DN/Nurr1 WT). Cada transfección se llevó a cabo por triplicado, con lo que la generación de 9 muestras de la que se extrajo el RNA. ARN total fue extraído de cada muestra utilizando RNeasy kit (Qiagen - 74.104). RNA de la integridad y el rendimiento fueron analizados y cuantificados mediante la Bioanalyser Agilent 2100 con el ARN Nano6000 chip antes de la síntesis de cRNA sondas. Preparación de cRNA, hibridación y la digitalización de la HG-U133 GeneChip oligonucleótido arreglos se realizaron según el protocolo del fabricante (Affymetrix, Santa Clara, CA). GeneChip imágenes se cuantificó la expresión de los genes y los valores fueron calculados por Affymetrix Microarray Suite versión 5.0 (5,0 Mas, Affymetrix). Para el análisis estadístico de un modo de análisis de la varianza (ANOVA) fue utilizada para comparar Nurr1 WT para muestras de control. Antes de la prueba, probesets que estaban ausentes y / o había señal de una expresión menos de 200 en todas las muestras fueron retirados. Probesets que había Valores de P inferior a 0,01 se consideraron estadísticamente significativos. Un similar utilizó un modelo lineal a través de análisis de cada probeset se utilizó para comparar Nurr1 DN para muestras de control. Genes que se mantienen si se mostró superior a 1,5 veces upregulation, (p <0,01) entre el control y la Nurr1 WT muestras y, sin embargo, la regulación no significativa (p <0,01) entre el control y la Nurr1 DN muestras. Estos genes restantes fueron elegidos manualmente para los genes que exhiben un ideal de perfil (que se cambió con Nurr1 y regresó a la actividad basal con Nurr D / N).

Resultados
Nurr1 bloques dominantes negativos Nurr1 reportero de la expresión génica inducida

Para demostrar la actividad transcripcional de Nurr1 y su posterior atenuación con dominante negativo construcciones, hemos utilizado un reportero de genes de ensayo para demostrar la inducción del gen LacZ bajo el control de la NurRE. En células HeLa transfectadas con el vector de expresión wildtype Nurr1, la activación de NurRE impulsada reportero construcciones genéticas se observó. Esto es consistente con informes anteriores que muestran que en la ausencia de un ligando de los receptores de esta familia son constitutivamente activa cuando ensayada mediante transfección de líneas de células [24, 25]. Con el fin de evaluar la función específica de Nurr1 en la expresión de genes en células K4IM se utilizó una dominante negativa Nurr1, en el que figura el dominio vinculante ADN de la Nurr1 (2-298) fusionados a la Drosophila engrailed represor de dominio. Este tipo de dominante negativo se ha utilizado ampliamente para estudiar el papel de factor de transcripción knockout fenotipos [26, 27]. K4IM transfección de células con wildtype Nurr1 expresión construye causas inducción de la expresión de genes, mientras que el reportero co-transfección de la dominante negativa con el tipo salvaje Nurr1 atenúa este efecto en un rango de concentraciones (Figura 1]. Esta actividad dominante negativa Nurr1 tanto, se utiliza para evaluar la función específica de Nurr1 en K4IM actividad de las células.

Nurr1 Análisis de la expresión génica mediada por células en K4IM

La línea celular de fibroblastos sinoviales K4IM fue elegido como un modelo de líneas celulares para explorar el papel de Nurr1 pro-inflamatorias en las vías de señalización de interés para el conjunto de artritis [12, 28]. Las células fueron transfectadas con Nurr1 construye y ARN extraído de células de 16 horas después nucleofection. Esta se utilizó para preparar cRNA sondas para hibridación a HG-U133 gen chip arrays. El control de calidad de evaluación de la Genechip arrays identificado factores de escala que son menos de 3 veces aparte, ratios de 5 'versus 3' sonda fija para GAPDH y β-actina se aproximaron a 1 y los niveles de ruido de fondo y son aceptables. Los genes que se consideraban Nurr1 dependientes sólo si mostraron una mayor de 2 veces el cambio (Nurr1-WT transfectadas las células en comparación con el control de vectores), y sólo si su expresión fue atenuada por la co-transfección con la construcción de Nurr1 DN expresión (véase el cuadro 2] . Sólo tres genes fueron identificados con este perfil de interleucina-8 (IL-8), Amphiregulin (AREG) y Kit ligando (KITLG). El mayor cambio que se observó con la IL-8, que se indujo 5 veces (p = 10 -4).

Nurr1 dependientes de la regulación de los genes pro-inflamatorias

Con el fin de confirmar las observaciones de los análisis de microarrays, K4IM células fueron transfectadas con una expresión Nurr1 construir y ARN de las células cosechadas después de 16 horas. RT-PCR cuantitativa análisis fue llevado a cabo con los cambios de expresión de GAPDH normalizado. K4IM células overexpressing Nurr1 mostraron aumento de expresión de IL-8, KITLG y AREG transcripciones en comparación con el vector de transfección de células en blanco que confirma las observaciones de los experimentos de microarrays (Figura 2]. Además, en consonancia con los datos de los microarrays, la inducida por los niveles de cada gen se volvió a los niveles basales de co-transfección con la construcción de Nurr1 dominante negativo (pcDNA3.1-Nurr1-DN) (Figura 2].

Nurr1 dependientes de la inducción de IL-8 en la producción de células K4IM

Para confirmar aún más las consecuencias funcionales de los niveles elevados de Nurr1 se determinó efectos sobre la IL-8 la producción de proteínas utilizando un sandwich ELISA a los medios de comunicación tomados de Nurr1 transfectadas K4IM células. Los experimentos se llevaron a cabo mediante el aumento de las concentraciones de Nurr1 ADN plásmido (pcDNA3.1-Nurr1-WT) dependientes de la dosis y un aumento de la cantidad de IL-8 secretada se observó (Figura 3]. Estos resultados indican que las células en K4IM niveles elevados de Nurr1 conduce directamente a un aumento de la síntesis y secreción de la citoquina pro-inflamatoria IL-8.

Discusión

Este estudio fue diseñado para explorar la posible relación existente entre la Nurr1, pro-inflamatorias señalización y la patogénesis de la artritis reumatoide fibroblastos sinoviales utilizando una línea celular derivada, K4IM como un sistema modelo. Transcripción de perfiles a través de microarrays de Affymetrix se utilizó para examinar las consecuencias de los niveles elevados de Nurr1 en K4IM células. Sobreexpresión de Nurr1 en K4IM células resultado constitutiva de la actividad del receptor como se muestra por el reportero de ensayo y esta actividad podría ser suprimida por cotransfection con una dominante negativa Nurr1 construir (Figura 1]. Dado que Nurr1 es un gen temprano inmediato [19] y que transactivation actividad utilizando el sistema de comunica-se observa dentro de las horas de transfección (datos no presentados), cosechadas ARN 16 horas después de transfección para maximizar la oportunidad de identificar las metas principales Nurr1 en oposición a Los efectos secundarios. Para tener confianza en la transcripción Nurr1 dependientes de elevación de los genes se compararon los perfiles de expresión entre las células transfectadas con Nurr1 sola o con una mezcla de Nurr1 y dominante negativo Nurr1. Usando nuestros estrictos puntos de corte, sólo tres genes: IL-8, Amphiregulin y Kit ligando se upregulated más de 2 veces y posteriormente regresó a los niveles basales por la presencia de la Nurr1 dominante negativo, lo que confirma la dependencia Nurr1. Una lista de probesets de 1,5 veces mayor entre Nurr1-WT en blanco y de control de vectores transfections se ofrece como un cuadro para demostrar que los genes pueden ser ya sea aumentando o disminuyendo su expresión en los siguientes Nurr1 transfección (ver archivo Adicional 1]. Este pequeño número de genes expresados diferencialmente puede ser representante de las consecuencias a corto plazo de expresión y de la especificidad de Nurr1 señalización. Es importante destacar que los tres han reconocido papel en la inflamación. Se examinaron con mayor detalle los Nurr1 dependientes de la inducción de estos genes en las células y K4IM confirmó el uso de microarrays observaciones Taqman RT-PCR cuantitativa. De estos tres genes, la más alta fue la de genes inducidos por citoquinas inflamatorias, IL-8 y es por ello que además demostró utilizando un ELISA IL-8 que Nurr1 específicamente induce la liberación de IL-8 proteína en el medio de cultivo de células K4IM (Figura 3]. IL-8 tiene un papel en el reclutamiento de neutrófilos a través de la CXCR1 / 2 receptores [29]

Amphiregulin y Kit ligando también han demostrado funciones en la inflamación [30, 31]. Ratones transgénicos que expresan Amphiregulin bajo el control de la queratina 14 promotor pantalla de inicio temprano y de la inflamación sinovial cutánea grave patología que demuestra un potencial para Amphiregulin papel en la psoriasis y la artritis psoriásica [30]. Kit ligando, también conocido como Stem Cell Factor (SCF), se ha demostrado que desempeñan un papel en la activación de los mastocitos. La administración de fluidos supercríticos en las vías respiratorias de los ratones normales se traduce en un aumento dosis dependiente hiperreactividad en la vía aérea a través de la activación de mastocitos que demuestra el papel de los fluidos supercríticos en el desarrollo de la inflamación alérgica y la hiperreactividad de vía aérea [31]. Además, el kit de activación de los receptores por SCF lleva a la fosforilación de Akt, que es necesaria para la IL-1 que dependen de NF-κ B transactivation [32], Akt ha postulado a desempeñar un papel en la AR a través de su capacidad para regular NF - Κ B, y también promover la resistencia a la apoptosis a través de una serie de mecanismos [revisado en [33]]. Este papel en el control del ciclo celular sigue siendo coherente con otras RN4 miembros del grupo, en particular la Nur77 con un papel establecido en el TCR mediada por apoptosis de las células T en hibridomas [34, 35].

Nurr1 ha sido demostrado previamente para actuar como un punto de convergencia de múltiples señales inflamatorias a través de CREB-1 y NF κ B señalización [20]. Estudios posteriores han demostrado Nurr1 y otros RN4 miembros de la familia a participar en la cascada inflamatoria de varios estímulos, incluyendo el TNF-α PAI-1 inducida por la expresión [36], y, en LPS / TNF α estimulado macrófagos [37]. TNF α desempeña un papel fundamental en la estimulación de reclutamiento de leucocitos y la producción de citoquinas y anticuerpos que actúan mediante el bloqueo de TNF α señalización han demostrado poseer efectos en el beneficio clínico en los pacientes con AR [38]. Por lo tanto, especular que, además de establecerse NF κ B, la activación de la señalización de IL-8 expresión [39], TNF α y otros que estimulan la inflamación puede actuar mediante la regulación de Nurr1 expresión que, a su vez, pueden regular la expresión de IL-8, ya sea directa o indirectamente. Labor que se está realizando dentro de nuestro laboratorio tiene por objeto abordar los mecanismos exactos de la actividad en Nurr1 IL-8, Amphiregulin y Kit ligando la expresión de los genes.

En resumen, hemos demostrado utilizando el análisis de microarray de que niveles elevados de Nurr1 conduce a un aumento de la expresión de genes de la IL-8, Amphiregulin y Kit ligando en el modelo de línea celular, K4IM. Por otra parte nos han confirmado estos cambios transcripcional Nurr1 dependientes Taqman mediante RT-PCR y demostró un aumento de la síntesis y secreción de IL-8 en las células transfectadas con Nurr1. "Creemos que los niveles elevados de Nurr1 observados en la artritis reumatoide puede exacerbar el proceso de la enfermedad en la AR. Por lo tanto, el bloqueo de la activación de Nurr1, o la modificación de la transactivation potencial de Nurr1 mediante el uso de rexinoids, metotrexato [40] o thiopurine análogos [41] representan una posible opción terapéutica para la artritis reumatoide y otras enfermedades inflamatorias o alérgicas.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

MRD diseñó el estudio, llevado a cabo los experimentos, analizar los datos, y redactó el manuscrito. CJH llevado a cabo la obra de construcción del plásmido. AR y KT llevó a cabo el análisis de microarrays. MDJ, AEP y MRCN participó en el diseño del estudio y la coordinación, así como la edición del manuscrito. Todos los autores han leído y aprobado el manuscrito final.

Material suplementario
Disposición adicional 1
Genes expresados diferencialmente siguientes Nurr1 sobreexpresión
K4IM células fueron transfectadas por triplicado Amaxa Nucleofector utilizando el sistema para cada una de las 2 condiciones: 1. 5 μ g vector pcDNA3.1 en blanco (control), 2. 2,5 μ g de pcDNA3.1-Nurr1-WT (Nurr1 WT). Las células se cultivaron durante 16 horas antes de la extracción de RNA. Los genes se identificaron en el Affymetrix U133A chip que muestra un cambio significativo (> 1,5 veces) entre blanco vector transfectadas sinoviocitos y Nurr1 transfectadas K4IM células (con un valor de p <0,01). Dobla los cambios en rojo son upregulated genes, los que se destacan en verde downregulated son los genes, los genes identificados previamente: IL-8, AREG y KITLG se resaltan en negrita.
Agradecimientos

Los autores desean agradecer a Dr H. Eibel (U. de Friburgo), la autorización de utilizar el K4IM células, el doctor E. Murphy (U. de Dublín) para la donación de células y K4IM útil para los debates, a los miembros de la RIRA artritis exploratorio equipo y en especial a Dr J. Wardale para la lectura crítica de este manuscrito.