Nuclear Receptor, 2005; 3: 4-4 (más artículos en esta revista)

Asociación de común variación en el gen PPARA incidente con infarto de miocardio en los individuos con diabetes tipo 2: Un estudio DARDOS Go -

BioMed Central
Alex SF Doney (a.doney @ chs.dundee.ac.uk) [1], Bettina Fischer (b.fischer @ gen.cam.ac.uk) [2], P, Simon Lee () [simonplee_2000@hotmail.com 2], Andrew D Morris (admorris@dundee.ac.uk) [3], Graham Leese (graham.leese @ dundee.ac.uk) [3], Colin NA Palmer (colin.palmer @ cancer.org.uk) [1]
[1] El Instituto de Investigaciones Cardiovasculares, Ninewells Hospital and Medical School, Dundee, DD1 9SY, Escocia, Reino Unido
[2] Centro de Investigaciones Biomédicas, Ninewells Hospital and Medical School, Dundee, DD1 9SY, Escocia, Reino Unido
[3] División de Medicina y Terapéutica, Ninewells Hospital and Medical School, Dundee, DD1 9SY, Escocia, Reino Unido

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Variantes comunes de la PPARA gen que se ha encontrado asociado con la cardiopatía isquémica en hombres no diabéticos. El L162V variante resultó ser de protección C2528G mientras que la variante de mayor riesgo. L162V también se ha asociado con alteraciones de los lípidos. Por lo tanto, trató de determinar el efecto del gen PPARA variación de la susceptibilidad a infarto de miocardio en pacientes con diabetes tipo 2. 1810 sujetos con diabetes tipo 2 de los posibles Go-DARDOS estudio fueron genotipados para el L162V y C2528G variantes en el gen PPARA y de la asociación de las variantes incidente con infarto de miocardio no fatal fue examinado. De los riesgos proporcionales de Cox se utilizó para interrogar a la vez caso de la contratación, y de regresión lineal para analizar la asociación del genotipo con rasgos cuantitativos clínica.

Resultados

El V162 alelo se asoció con una disminución del riesgo de infarto de miocardio no fatal (HR = 0,31, 95% CI 0.10-0.93 p = 0,037), mientras que el alelo C2528 se asoció con mayor riesgo (HR = 2,77 95% CI 1.34-5.75 p = 0,006). Del mismo modo V162 se asoció más tarde con una edad media de diagnóstico de la diabetes tipo 2 y C2582 una edad más temprana de diagnóstico. C2528 también se asoció con un aumento de colesterol total y colesterol LDL, que no cuenta para el aumento del riesgo observado. Haplotipo análisis demostró que cuando ambas variantes raras ocurrieron en el mismo haplotipo el efecto de cada uno se derogó.

Conclusión

Variación genética en el locus PPARA es importante en la determinación de riesgo cardiovascular en ambos y los pacientes con diabetes. Este genotipo de riesgo asociados parece ser independiente de los efectos de estos genotipos en los perfiles lipídicos y la edad de diagnóstico de la diabetes.

Antecedentes

Disregulación del metabolismo de los ácidos grasos juega un papel fundamental en la etiología de la diabetes tipo 2 [1], y explica, al menos en parte, la asociación entre obesidad, diabetes tipo 2 y las enfermedades cardiovasculares (ECV). PPAR α es miembro de la superpotencia nuclear receptor ligando familia de factores de transcripción activados. Ligandos de PPAR α incluir ácidos grasos poliinsaturados y el fibrato clase de hipolipemiantes drogas [2]. Se expresa en altos niveles en varios tipos de células que participan en el proceso aterosclerótico [3], y su activación tiene efectos beneficiosos sobre los lípidos plasmáticos, función endotelial y marcadores de la inflamación [4]. Así, el PPARA gen es un fuerte candidato para un determinante genético de riesgo de las enfermedades cardiovasculares en las personas con diabetes de tipo 2 [5].

PPARA El gen ha sido controlada por la variación común [6 - 8]. El más estudiado es la variante leucina 162 valina (L162V) polimorfismo, alelo presente en las frecuencias de entre 5 y 10%, y situado en el dominio vinculante ADN. Funcional estudios han demostrado que el alelo V162 es más activa in vitro [7, 9], y el alelo V162 se ha asociado con alteraciones de los niveles de lípidos en plasma [6, 8, 10], el retraso de la progresión de las enfermedades cardiovasculares angiographically determinado en el Lopid coronaria Angiografía Trial (LOCAT), y reducir el riesgo de enfermedad isquémica del corazón en la Segunda Northwick Park Heart Study (NPHS2) [11]. Una segunda, más común, G → C situado en la variante intrón 7 (G2528C) es parcial alélica en asociación con la variante L162V y muestra efectos opuestos en el riesgo cardiovascular y cardíaca crecimiento [9, 11]. Recientemente se ha demostrado que los haplotipos de estas variantes, en asociación con una nueva variante A → C en el intrón 1 influir en la edad de inicio de consumo de tipo 2 y la hora de exigir la insulina [12].

Activadores PPAR α mejorar la dislipemia asociada con la diabetes tipo 2 y puede ser particularmente beneficiosa en la reducción del riesgo de las enfermedades cardiovasculares en sujetos con diabetes tipo 2 o síndrome metabólico [13]. Por ello, investigó la asociación entre la variación genética PPARA con riesgo de las enfermedades cardiovasculares y la diabetes relacionados con rasgos caucásicos, en los sujetos con diabetes tipo 2 que participan en el prospectivo basado en la población de Genética de la Diabetes de Auditoría e Investigación en Tayside Scotland (Go-DARTS) estudio [14 - 16 ].

Resultados

Las características clínicas de la cohorte genotipo se muestran en el cuadro 1. Las frecuencias de los alelos de ambos polimorfismos fueron consistentes con los publicados anteriormente Europea para la población no diabética (tabla 2]. Los dos polimorfismos son a la vez en equilibrio de Hardy-Weinberg y fueron significativos en la vinculación desequilibrio D '= 0,204 p = <0,00001. Estimación de las frecuencias de haplotipos se indica valores muy similares a los publicados anteriormente (cuadro 3]. Hubo pocas pruebas de que los genotipos bien individualmente, o cuando se incluyen en el modelo en conjunto, se asociaron con la presión arterial o las mediciones de lípidos (tabla 4]. V162 se asoció con un perfil cardioprotector generalmente más con V / V homocigosis haber menor presión arterial sistólica y diastólica, la reducción de colesterol LDL y HDL colesterol mayor que L / L homocigosis, aunque ninguna de estas diferencias fueron significativas. Por C2528 homocigosis había una pequeña pero significativamente más altos de colesterol total y colesterol LDL calculado en comparación con el G / G homocigosis. También se encontró una asociación del genotipo con la edad diagnosticados con diabetes tipo 2, con el V162 alelo se asocia significativamente con una edad más avanzada de diagnóstico y la C2528 con un alelo significativamente edad más temprana de diagnóstico (Tabla 5]. Cuando hemos considerado encontramos que los haplotipos V162-G2528 se asoció con casi 4 años de retraso en el diagnóstico de la diabetes en comparación con el común L162-G2582 haplotipo (p = 0,004). Esta asociación es totalmente derogado C2528 se produjo cuando junto con V162 como un haplotipo.

Durante una mediana de tiempo de seguimiento de 49,6 meses hubo 108 infarto de miocardio no fatal y eventos de 355 muertes por todas las causas. En un plenamente ajustada de los riesgos proporcionales de Cox modelo (cuadro 6], nos encontramos con que fue significativamente V162 de protección contra infarto de miocardio no fatal (RR 0,31, IC del 95%: 0.10-0.93, p = 0,037), mientras que la variante C2528 se asoció con una significativa Mayor riesgo de infarto de miocardio no fatal (RR 2,77, IC del 95%: 1.34-5.75, p = 0,006). Esta asociación resultó ser similar en ambos sexos. Ni la variante demostrado ninguna evidencia de una asociación con el riesgo de infarto de miocardio cuando se los considera en forma aislada. Una vez más, cuando hemos considerado haplotipos, encontramos que en comparación con el haplotipo común con ambos alelos, el haplotipo L162-C2528 se asoció con un aumento significativo del riesgo cardiovascular (HR 1,68 95% CI 1.16-2.43 p = 0,006) y el V162-G2528 Una disminución en el riesgo, aunque en este caso esto no fue significativo (RR 0,54, IC del 95%: 0.20-1.48, p = 0.23). Una vez más la relación de las asociaciones de cada variante fueron completamente abolidos cuando ocurrieron juntos en el mismo haplotipo. La inclusión de colesterol total en el modelo no se observó atenuar estas asociaciones, sino más bien a fortalecer aún más (V162: HR 0,28, IC 95% 0.09-0.89, p = 0,031 y C2528: HR 2,87, IC 95% 1.38-5.95, p = 0,005) que demuestra que el aumento de riesgo asociado a la C2528 no estaba vinculado a los niveles de colesterol planteadas. Cuando un punto final combinado de muerte por cualquier causa, y el infarto de miocardio no fatal fue examinado en el mismo modelo se constató que la V162 seguido demostrando una reducción del riesgo de un evento, si bien la asociación se atenuó (HR 0,52, IC del 95%: 0,28 -0,98, P = 0,044). C2528 demostrado una vez más un aumento del riesgo, aunque esto es ahora débiles y límite no significativo (RR 1,52, IC del 95%: 0.99-2.31, p = 0.052).

Discusión

Se ha demostrado que dos variantes comunes en el locus PPARA están asociados con los riesgos opuestos de desarrollo de la enfermedad vascular aterosclerótica y el infarto de miocardio en dos poblaciones separadas de los no diabéticos hombres que participan en la LOCAT y NPHS2 estudios [11]. Las personas con diabetes tipo 2, sin embargo son particularmente susceptibles a la enfermedad aterosclerótica macrovasculares, y activadores PPAR α fibrato como el grupo de las drogas parecen ser especialmente beneficiosos en la reducción de eventos cardiovasculares en este grupo de pacientes [13]. En este estudio se confirmó la observación de que la V162 está asociado con una disminución en el riesgo y la C2528 variante se asocia con un mayor riesgo de enfermedad cardiovascular y que esta observación se puede extender a los individuos con diabetes tipo 2. Asimismo, se encontró que la asociación es similar en hombres y mujeres individuales. Finalmente nos confirman una reciente conclusión de que estas variantes se asocian con influencias opuestas en la edad de diagnóstico de la diabetes de tipo 2 [12], y que la variante C2528 está también asociada con significativamente más alta de colesterol total y LDL calculado los niveles de colesterol.

Varios estudios han examinado el potencial importancia clínica de la variación genética en el locus PPARA aunque la mayoría se han concentrado en los niveles de lípidos y han considerado la L162V variante en el aislamiento. Estos estudios han sido inconsistentes L162V que indica que pueden influir en los niveles de colesterol de las lipoproteínas o de otro tipo, dependiendo de la población analizada [6, 8, 10, 12, 17, 18], mientras que otros estudios no han encontrado pruebas de tal asociación [19, 20]. Estas inconsistencias pueden ser debidos en gran parte a diferentes entornos, antecedentes genéticos y la condición de enfermos (incluidos los medicamentos prescritos) entre las poblaciones consideradas. Por ejemplo la relativa concentración en la dieta de grasas poliinsaturadas a saturadas Recientemente se ha demostrado que afectan de manera significativa a la asociación de L162Vgenotype con perfil de lipoproteínas [21, 22]. Además, es probable que se uso diferencial de fibrato (así como la modificación de otros lípidos) drogas entre las personas con diabetes tipo 2 y no diabéticos poblaciones, que también puede influir en los niveles de lípidos diferencialmente por PPAR α haplotipo [23, 24]. Gene / interacciones de genes también pueden ser importantes como lo demuestra la observación de que las variantes en el PPARD y APOE genes pueden influir en la asociación observada [10, 20]. La inevitabilidad de los genes y el medio ambiente, y observó la falta de concordancia entre los estudios, ilustran las dificultades de considerar solo las medidas de los rasgos cuantitativos. Estas medidas pueden variar considerablemente a lo largo de la vida de un individuo, en función del estado de salud y la dieta. Es importante destacar que las medidas clínicas de este estudio fueron una media de múltiples medidas adoptadas a lo largo de un período de tres años y, por tanto, representan una limitada integración de tales fluctuaciones temporales.

En este estudio encontramos que la G2582C variante, pero no la variante L162V, influenciado los niveles de lípidos y de esta asociación no fue influenciado por la L162V. La diferencia entre los valores medios de colesterol LDL de los individuos frente a GG CC es bastante pequeña (0,36 mmol / L), e incluso en esta población de alto riesgo no cuenta para el aumento de riesgo cardiovascular asociados con la C2582. Esto no fue inesperado, ya que de acuerdo con los estudios previos en hombres no diabéticos, la inclusión de colesterol total o colesterol LDL en el modelo no afecta a la asociación con los resultados cardiovasculares, lo que indica que el aumento de riesgo asociado a la variante C2528 no es probable A ser a través de su influencia en los niveles de lípidos.

Pocos estudios han examinado las enfermedades cardiovasculares o considerarse variantes distintas de la L162V. Un reciente estudio también demostró una tendencia no significativa hacia un efecto protector de la V162 en los individuos con diabetes [19]. Este estudio no examinó el G2825C variante. Sin embargo, el presente estudio confirma que la V162 es la variante de protección contra el infarto de miocardio no mortal, mientras que el C2528 variante se asocia con un mayor riesgo en esta población con diabetes tipo 2. Estas observaciones también parecen afectar la mortalidad global en esta población. Esta aparente coherencia entre los estudios con respecto a eventos cardiovasculares probablemente refleja los pequeños, aunque a nivel mundial, la modulación en el fenotipo actuando a través de la vida de una persona debido a los ligeros cambios en la actividad de PPAR α asociados con cada variante. A diferencia de solo medidas de lípidos o lipoproteínas, que es menos probable que se efectuará temporal por los cambios ambientales. Esto también es probable que sea cierto en el caso de eventos clínicos como la edad de diagnóstico. En el estudio previo que de acuerdo con la edad de diagnóstico de una nueva variante en el intrón 1 del PPARA se utilizó para la construcción de haplotipos con L162V y G2825C [12].

En este estudio, como en la nuestra, la C2825 se asoció a una edad más temprana de diagnóstico, con el V162 alelo está asociado con la protección de diagnóstico temprano, de una manera compatible con la modulación de riesgo de ECV. Este es el primer estudio que presente la asociación con la edad de diagnóstico de la diabetes tipo 2 en la misma población con la asociación con el riesgo cardiovascular, y podemos afirmar que la inclusión de la edad de diagnóstico no modulan la observada con las asociaciones de riesgo cardiovascular y Viceversa, lo que demuestra que estas observaciones son independientes. Esto no es sorprendente, ya que PPARA variación se asocia con el riesgo de ECV, independientemente de la condición de diabético.

El G2825C variante se encuentra en una región no codificante (intrón 7) y, por tanto, poco probable que constituya una variante de causalidad directa, sin embargo otros estudios han indicado su potencial importancia biológica [9, 11, 12], y también una disminución en la respuesta a la terapia fibrato [ 25]. Estas observaciones, junto con el de la activación de PPAR α fibrato a través de la terapia han dado lugar a la sugerencia de que la C2528 variante está asociada con una reducción de la transcripción del RNA y, por tanto, los niveles más bajos PPAR α. A pesar de que esta propuesta, junto con un mecanismo aún no se ha demostrado, se debe probablemente a una nueva (todavía) no identificados en la variante o cerca de la PPARA gen.

Hemos demostrado anteriormente una situación similar en el PPARG lugar en el que el efecto biológico de una variante con probables consecuencias funcionales es constantemente modificado en una manera de oponerse a la presencia de una variante de una función para la que es difícil de atribuir [14, 15]. Dada la función de los PPARs como maestro de controladores de metabolismo energético es probable, ya que la acumulación de pruebas parece sugerir, que se manifiesta epistasis y equilibrado polimorfismo que permite una rápida adaptación evolutiva respuesta a los retos ambientales muy diferentes. De hecho, la existencia de un fenómeno generalizado, equilibrado variación Recientemente se ha sugerido para los genes implicados en los rasgos complejos [26].

Conclusión

Hemos confirmado la posible importancia de la variación genética en el locus PPARA en la modulación de la susceptibilidad a las enfermedades cardiovasculares, y han demostrado que esta asociación es importante para las personas con diabetes tipo 2.

Métodos

En la región de Tayside Scotland clínica detallada información sobre todas las personas con diabetes mellitus se registra en una continua actualización del sistema electrónico de información clínica conocida como DARTS (Diabetes Auditoría e Investigación en Tayside Scotland) [16]. Validado, en toda la región-vínculo electrónico técnicas de facilitar la identificación de las personas con diabetes en la población Tayside con una sensibilidad de 97% [16]. Datos clínicos relevantes está vinculado a las bases de datos con todos los ingresos hospitalarios en pacientes hospitalizados Tayside de 1980, con los códigos diagnósticos de ICD-9/10 (Clasificación Internacional de Enfermedades, novena y la décima revisión), y los registros de los certificados de defunción del registrador general. Esta electrónico automatizado de seguimiento manualmente es validado a través de un ciclo continuo de revisión de estudio dedicado por los médicos. Incidente eventos cardiovasculares en esta población se han descrito anteriormente [27].

Después de su consentimiento informado por escrito de las personas registradas en DARDOS, muestras de sangre para estudios genéticos se han recogido, con lo que la creación de un sub-estudio genético conocido como Go-DARDOS. NHS riguroso cumplimiento de la protección de datos y normas de cifrado se mantiene y el estudio fue aprobado por el comité de ética de la investigación local.

El PPAR α L162V y G2528C genotipos fueron determinados en 1810, todos los individuos de los cuales eran de raza caucásica con diabetes tipo 2 diagnosticada a la edad de entre 35 y 70 años. Taqman (Applied Biosystems) alélica discriminación ensayos se utilizaron. La primers y sondas utilizadas para la discriminación alélica ensayos fueron las siguientes: L162V Adelante-primer CAGAAACAAATGCCAGTATTGTCG, Reverse-primer GGCCACCTTACCTACCGTTGTG, L162 sonda (FAM etiquetados) - TTCACAAGTGCCTTTCTGTCGGGATGT TTCACAAGTGCCTTTCTGTCGGGATGT TTCACAAGTGCCTTTCTGTCGGGATGT, V162 sonda (TET etiquetados) - TTCACAAGTGCGTTTCTGTCGGGATGT TTCACAAGTGCGTTTCTGTCGGGATGT TTCACAAGTGCGTTTCTGTCGGGATGT.

G2528C Adelante-primer TCCTTAAATATGGTGGAACACTTGAAG, Reverse-primer TCACAACCACCAGTTTTGCAT, G2528 sonda (FAM etiquetados) - ATATCTAGTTTGGATTCAAAAGCTTCATTTCCCA ATATCTAGTTTGGATTCAAAAGCTTCATTTCCCA ATATCTAGTTTGGATTCAAAAGCTTCATTTCCCA, C2528 sonda (TET etiquetados) - ATATCTAGTTTCGATTCAAAAGCTTCATTTCCCA ATATCTAGTTTCGATTCAAAAGCTTCATTTCCCA ATATCTAGTTTCGATTCAAAAGCTTCATTTCCCA.

Estadísticas

Para cada clínica medida se determinó la media de múltiples medidas obtenido hasta un período máximo de tres años (hasta dos años antes de la matrícula, y hasta un año después de la matrícula). Colesterol LDL se calculó mediante el uso de la ecuación Freidwald. De regresión lineal se utilizó para determinar la asociación con el genotipo de cada una de las medidas para corregir edad a la genotipificación. Para determinar la asociación del genotipo con la edad de diagnóstico, esto se corrige con el género y la presencia de una historia de tabaquismo y por la determinación de la adición de estos residuos a la edad media de diagnóstico. De los riesgos proporcionales de Cox se utilizó para modelar el tiempo al primer evento. Todos los individuos fueron seguidos desde el punto de genotipo hasta que un infarto de miocardio no fatal ocurrió, o un compuesto de miocardio no fatal o infarto por todas las causas de muerte. Censura se produjo al término del estudio o muerte por cualquier causa. Ambas variantes se incluyeron en el modelo y se llegó a la conclusión de que un co-modelo dominante de cada variante produce el mejor ajuste. Las siguientes variables fueron también incluidos en el modelo; edad a la genotipo, el género, la historia de tabaquismo, el tratamiento con insulina, una historia previa de un infarto de miocardio, angina de pecho y la prevalencia de la enfermedad cerebrovascular prevalente. Estimaciones de las frecuencias de haplotipos junto con haplotipo efectos se determinaron utilizando el Programa THESIAS [28, 29]. En el caso de los análisis de supervivencia de haplotipos utilizando sólo THESIAS edad a la genotipificación, prevalece la angina de pecho y una historia previa de un infarto de miocardio fueron incluidos en el modelo.

Lista de abreviaturas

Dardos diabetes de auditoría y de investigación de estudios en Tayside

Go-DARDOS Genética de DARDOS

PPAR α Peroxisome proliferador activado del receptor alfa

PPARA Gene para PPAR α

PPARD Gene para PPAR δ

ECV enfermedades cardiovasculares

LOCAT Lopoid angiografía coronaria juicio

NPHS2 segundo Northwick Park centro de estudios

HR razón de riesgo

IC: intervalo de confianza

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

ASFD y CNAP escribió el manuscrito y se realizó el análisis, CNAP y ADM concibe el estudio y participaron en su diseño y coordinación. GL ayudó a redactar el manuscrito y contribuyó al análisis de datos. BF y SL realizó la genotipificación. Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

El Go-DARDOS contratación fue financiada por un fideicomiso donaciones anónimas a Tenovus Tayside. Colin Palmer y Andrew Morris cuentan con el apoyo de los escoceses Consejo de Financiación de la Educación Superior (SHEFC), y el Ejecutivo escocés Genéticos Iniciativa de Salud. Go-DARDOS es actualmente apoyada por el Wellcome Trust.