Journal of Carcinogenesis, 2005; 4: 23-23 (más artículos en esta revista)

Ausencia de mutaciones en la secuencia de codificación de los posibles supresores tumorales en melanoma metastásico 3pK

BioMed Central
Roland Houben (houben_r@klinik.uni-wuerzburg.de) [2], C Jürgen Becker (becker_JC@klinik.uni-wuerzburg.de) [2], Ulf Rapp R () [rappur@mail.uni-wuerzburg.de 1]
[1] Institut für Medizinische Strahlenkunde und Zellforschung (MSZ), Universität Würzburg, Versbacher Str. 5-97078 Würzburg, Alemania
[2-97078 Würzburg, Alemania

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

La activación de Ras o Raf contribuye a la tumorigénesis de melanoma. Sin embargo, la activación constitutiva Raf es también una característica de la mayoría de los nevus melanocíticos benignos y de alta intensidad de señalización ya sea de Ras o Raf se encontró para inducir la inhibición del crecimiento y la senescencia en lugar de la transformación. Dado que el cromosoma 3p quinasa (3pK)) es un blanco de la Ras / Raf / Mek / Erk vía de señalización que el antagonista de la función oncogén y anti-factor de diferenciación Bmi-1, 3pK pueden funcionar como un gen supresor tumoral de los tumores con constitutivos Ras / Raf activación. Por consiguiente, si nosotros probamos 3pK inactivar las mutaciones están presentes en el melanoma.

Métodos

30 melanoma metastásico muestras, que fueron positivas para la activación de cualquiera de las mutaciones BRaf o NRas, fueron analizados para su posible mutaciones en el gen 3pk. Codificación de los 10 exones y sus secuencias intrón de acompañamiento fueron amplificados por PCR y secuenciación directa de los productos de PCR se realizó.

Resultados

Este análisis reveló que, además de la presencia de algunos polimorfismos de nucleótido único en el 3pk gen, pero no hemos podido detectar cualquier posible pérdida de la función de la mutación en alguno de estos 30 melanoma metastásico muestras seleccionadas para la activación de la presencia de mutaciones en el barrio de Ras / Raf / Mek / Erk vía de señalización.

Conclusión

Por lo tanto, en el melanoma con constitutivamente activa Ras / Raf inactivación de las mutaciones en el gen 3pk no contribuyen al fenotipo oncogénico de este tumor maligno.

Antecedentes

Represores transcripcionales de grupo Polycomb (PcG) son parte de la maquinaria celular epigenéticos [1]. Las proteínas PcG Bmi-1 fue descrito como un oncogen en linfomas murinos, que actúa a través de la represión de la ink4A locus [2]. Su implicación en la tumorigénesis humana es sugerido por el hallazgo de que se amplifica o sobreexpresa en varios cánceres humanos [3 - 5] Bmi-1 demostró ser un anti-factor de diferenciación, por ejemplo, su sobreexpresión grados replicativa la vida de fibroblastos humanos por La supresión de la p16-dependiente de senectud vía [6]. Además, Bmi-1 es un factor de auto-renovación de hematopoyéticas y las células madre neuronales [7 - 9].

El gen del cromosoma 3p quinasa (3pK; también conocido como Mapkap Kinase 3) fue aislado por el análisis de la región 3p21.3 cromosómicas que se homozygously suprimido en dos líneas celulares de cáncer [10]. Muy recientemente hemos descubierto que interactúa con 3pK y fosforila Bmi-1 con lo que la disminución de Bmi-1 cromatina asociación [11]. Sobreexpresión de 3pK tiene propiedades supresoras del crecimiento en diversas líneas celulares, que se puede superar por Bmi-1 sobreexpresión (Voncken y Rapp, la observación no publicados). Cabe señalar, que 3pK es una meta de la clásica mitógenos Ras / Raf / Mek / Erk vía de señalización y se activa a través de la fosforilación de Erk [12].

Es bien sabido que la activación de Ras / Raf / Mek / Erk vía contribuye a la tumorigénesis y el melanoma es el tumor con mayor prevalencia de la activación de mutaciones en el gen braf [13 - 15]. Por otra parte BRaf la activación de mutaciones están presentes en la mayoría de los melanocíticos benignos y lesiones de alta intensidad de señalización ya sea de Ras o Raf se encontraron para inducir la inhibición del crecimiento y la senescencia en lugar de la transformación [16]. Estas observaciones pueden ser explicadas por una activación de la rama 3pK/Bmi-1/Ink4A. Así, 3pK inactivación de la mutación puede ser parte de la transformación neoplásica de los tumores con Ras activada o Raf como melanoma.

Materiales y métodos
Tumor material

Parafina incrustados muestras tumorales del 30 de los melanomas metastásicos fueron obtenidos por escisión quirúrgica. Todos los tumores se han sometido a la histología para el diagnóstico de rutina. El inmediatamente adyacentes diapositivas de los bloques se utilizaron para la extracción de ADN. El consentimiento informado se obtuvo de todos los pacientes antes de que cualquiera de estas medidas.

Reacción de polimerasa en cadena

Se aisló el ADN genómico de las muestras de parafina incrustados tumor Aislamiento de ADN utilizando un Kit (Qiagen). La aplicación de la PCR convencional sobre estas plantillas permiten a los frecuentes abandonos no ceder el producto deseado. Por lo tanto, aplica los protocolos de PCR anidada con un primer ciclo de 22 PCR (30 μ l), seguido de un segundo ciclo de 35 PCR (55 μ l), en la que 1 μ l de la primera reacción sirve como plantilla. Los ciclos siempre consistió de 30 segundos de desnaturalización a 95 ° C, 30 segundos seguido de recocido elongación 30 segundos en 72 ° C. Primers y temperaturas de recocido correspondientes figuran en el cuadro 1.

Secuenciación

Las muestras fueron secuenciadas utilizando BigDye Terminator ™ Ciclo de Secuenciación Listo Reacción Kit (Applied Biosystems) de acuerdo con el manual del fabricante, y se analizaron en un ABI PRISM 3100 Genetic Analyzer Avant. Las secuencias fueron analizadas por inspección visual, en busca de la doble picos o atípicas antecedentes señales. Además alineaciones con la secuencia genómica publicada se realizaron mediante el software DNAStar ™.

Resultados y discusión

Anteriormente habíamos analizado una serie de 200 muestras de melanoma para activar la presencia de mutaciones en BRaf y NRas [17]. De estas muestras se elige un conjunto de 30 melanomas metastásicos 25 de las cuales llevaba un BRaf (V599E, V599R o V599K) y 5 una mutación NRas (Q61R o Q61K). Para estas 30 muestras, amplificación de la codificación más adyacentes intrón secuencias de los exones 2 a 11 y sometió a análisis de secuencias. Con este fin, el intercambio de nucleótidos que no se altere la secuencia de aminoácidos de la proteína 3pK se detectó que indica que el 3pKinase no es frecuentemente afectado por mutaciones en el melanoma metastásico con constitutivamente activado Ras / Raf vía de señalización.

Intronic un polimorfismo de nucleótido único (SNP) se detectó 42 nucleótidos río abajo (en 3 'dirección) del exón 4. Dentro de la secuencia de la última GCAGGAGGATTCAGGGTGAG G fue alterado con frecuencia a la A. En dos casos hemos recibido sólo una señal de una. En 13 casos se encontraron heterocigotos A y G y en 15 casos sólo el publicado G estaba presente (Figura 1A, B, y 1C]. 160 nucleótidos río arriba (en 5 'dirección) del exón 9 dentro de la secuencia GTTTCAAAACAAGAAATAG la primera G se modificó a una A en todos los casos salvo uno (Figura 1D]. Sólo de esta una muestra además de la señal de una señal para G fue detectable (Figura 1E]. Debido a la muy rara aparición de la secuencia publicada nos pregunta si esta alteración puede ser un melanoma SNP específico. Por lo tanto, amplificado y secuenciado esta región de ADN genómico de 14 donantes sanos. En todos los 14 casos se encontraron G en lugar de A en la posición correspondiente, lo que demuestra que esta es la preferencial de nucleótidos alemán en la población.

La ausencia de inactivación de las mutaciones en el gen 3pk, sin embargo, no excluye la posibilidad de que 3pK en función de estos tumores podrían ser afectados por la reducción de los niveles de expresión. Por ejemplo, en el melanoma uveal mutaciones en la secuencia de codificación del gen supresor tumoral Ink4A son muy raros, pero la hipermetilación de su promotor es una causa común de la reducción de Ink4a expresión en estos tumores [18].

En un estudio previo la correlación Ras / Raf mutacionales estado 200 lesiones con el melanoma el curso clínico, la presencia de la activación de mutaciones en tumores primarios no afectan el pronóstico - una noción más fundamentadas por los resultados de análisis multivariado reveló que para Esta cohorte de pacientes mutaciones en el gen braf no se correlaciona con marcadores establecido para mal pronóstico como el grosor del tumor o ulceración. La presencia de mutaciones en BRaf lesiones metastásicas, sin embargo, se asocia a peor pronóstico, es decir, acortar la supervivencia tanto de la eliminación de los respectivos metástasis o diagnóstico clínico de la enfermedad en etapa IV. Debido a esta observación, junto con el hecho de que la carcinogénesis es un proceso multietápico uno puede suponer que otras alteraciones genéticas o epigenéticos son necesarias para la transformación neoplásica de las células melanocíticos y que, en ausencia de estas reformas (s) de las propiedades de mal pronóstico activado BRaf Están enmascarados. En el presente estudio, hemos descartado, que la inactivación de las mutaciones de 3pk eventos son frecuentes en el melanoma metastásico con constitutivamente activado Ras / Raf vía de señalización. Otros probado un posible tumor supresor de la función de 3pK por ectópico expresión de 3pk en dos líneas celulares de cáncer. Esto sin embargo no antagonizar el crecimiento tumoral de estas células en ratones Scid [19]. 3pK, por lo tanto, sigue siendo un canditate supresor de tumor y su posible papel en el desarrollo de tumores requiere más investigación.

Contribuciones de los autores

RH realizó el análisis de mutaciones. RH y JCB escribió el manuscrito. JCB siempre que el gDNA de la muestras tumorales. UR fue el supervisor del proyecto y diseñó el estudio.

Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

Damos las gracias a Reinhold Krug que hicieron el trabajo de secuenciación. Este estudio fue apoyado por becas de la Deutsche Forschungsgemeinschaft (DFG Ra 642/6-2), la Deutsche Krebshilfe (10-1793-Ra-7) y el Stiftung Sander (2000.033.2).