Kinetoplastid Biology and Disease, 2005; 4: 6-6 (más artículos en esta revista)

LmxMPK4, mitogen-activated proteína quinasa (MAP) homólogo esencial para promastigotos y amastigotes de Leishmania mexicana

BioMed Central
Qiong Wang (qiongkunle@yahoo.com) [1], Inga M Melzer (inga.melzer @ bni-hamburg.de) [1], Martin Kruse (martin.kruse @ zmnh.uni-hamburg.de) [1], Claudia Sander-Juelch (juelch@bni.uni-hamburg.de) [1], Martin Wiese (martin.wiese @ bni-hamburg.de) [1]
[1] Instituto Bernhard Nocht de Medicina Tropical, Sección de Parasitología, Bernhard-Nocht-Strasse 74, D-20359 Hamburgo, Alemania

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Parásitos Leishmania profundos cambios morfológicos y bioquímicos, pasando a través de su ciclo de vida. Proteína quinasas han demostrado ser implicados en la diferenciación de los promastigotes extracelular flagelado a la intracelular "no flagelado" amastigotos y viceversa. Además, estas enzimas es probable que participan en la regulación de la proliferación de las diferentes etapas de su vida.

Resultados

En este sentido, caracterizar LmxMPK4, mitogen-activated proteína quinasa (MAP) homólogo de Leishmania mexicana. La quinasa secuencia revela todos los motivos para su clasificación como una MAP quinasa. LmxMPK4 demostrado ser activa como una proteína recombinante. La quinasa se expresa en promastigotos y amastigotos. Es imposible generar la supresión de genes mutantes homocigotos para LmxMPK4 en promastigotos. Además, amastigotos episomal teniendo sólo una copia del gen LmxMPK4 mantenerse estable durante un período prolongado de antibióticos sin presión en los ratones infectados.

Conclusión

LmxMPK4 es esencial para promastigotos y amastigotes de Leishmania. Muestra significativa secuencia de aminoácidos a la divergencia de mamíferos MAP quinasas. Así, LmxMPK4 es un nuevo y prometedor medicamento objetivo.

Antecedentes

Proteína quinasas son fundamentales en todas las moléculas reguladoras células eucarióticas. Junto con sus antagonistas de la proteína fosfatasas forman redes complejas de la activación y silenciamiento mutuamente moléculas. Su actividad afecta a los procesos vitales como la diferenciación, proliferación, motilidad, la respuesta de estrés, y la apoptosis [1]. Mitogen activados por proteínas quinasas (MAP) son a menudo la final quinasas en cascadas de transducción de señal de transmisión de señales de sumar estímulos ambientales a través de varios pasos de la fosforilación reversible de diferentes receptores para las proteínas efectoras que puede conducir en última instancia a los cambios en los perfiles de expresión proteica. Eucariotas superiores en el núcleo de la MAP quinasa cascada de transducción de señal se compone de una MAP quinasa quinasa quinasa (MKKK), una MAP quinasa quinasa (MKK) y una MAP quinasa. Tras un estímulo el MKKK se activa por fosforilación. La activa MKKK fosforila una MAP quinasa quinasa (MKK) en serina y / o threonine residuos en su fosforilación bucle. MKKs son de doble especificidad quinasas, que son capaces de phosphorylate sus sustratos, el MAP quinasas, en un threonine de residuos de tirosina y una de las conservadas TXY motivo de la fosforilación de bucle con el fin de causar la máxima actividad enzimática. Por último, MAP quinasas activadas pueden trasladar en el núcleo y phosphorylate factores de transcripción o phosphorylate quinasas citosólicas o proteínas estructurales. Y análisis de la secuenciación del genoma del Leishmania principales y L. Infantum reveló la presencia de todos los miembros de la MAP quinasa módulo de transducción de señales básicas [2]. Sin embargo, ni los receptores típicos que conducen a la activación de la MAP quinasa vías de transducción de señales, como los receptores de tirosina kinasas y G-receptores acoplados a proteínas ni típico MAP quinasa sustratos como factores de transcripción de la RNA polimerasa II promotores se han encontrado en los parásitos. No se sabe aún cómo regulación de la expresión genética se logra en los parásitos, pero es probable que los sustratos de MAP quinasas son moléculas reguladoras de genes, aunque no factores de transcripción. En general, se supone que se produce en la regulación post-transcripcional como los niveles de la maduración de los ARNm de un precursor polycistronic a un tope y poli-adenylated mRNA en transeuropeas de empalme, el ARNm la estabilidad, la eficiencia de la traducción, o incluso la estabilidad de la proteína.

Leishmania digenetic parásitos tienen un ciclo de vida con los mamíferos y las moscas de arena como sus anfitriones. A su paso a través de su ciclo de vida de los parásitos se alternan entre las formas de proliferación, la procíclico promastigotos y amastigotos, formas y detenido en el ciclo celular, la muy infecciosa metacyclic promastigotes. Proteína cinasas es probable que participan en la regulación de la proliferación de las diferentes etapas de su vida y en la diferenciación de los procesos procíclico metacyclic promastigotes a las formas, a amastigotos después de la transmisión a un mamífero y de la absorción por los macrófagos anfitrión, y una vez de vuelta a promastigotos amastigotos llegar a la Gut de una mosca de la arena. Miembros de la MAP quinasa vías de señalización se han encontrado a desempeñar funciones importantes en la diferenciación y la proliferación de Leishmania. LmxMKK una MAP quinasa quinasa homólogo participa en la formación y mantenimiento de la flagelo en el promastigote. Un mutante nulo mostradas flagelos reducido a máximo 1 / 5 de la longitud del tipo salvaje flagelo [3]. Es probable que esta quinasa participa en el resultado de un nuevo flagelo antes de la división celular en la promastigotos y en la diferenciación de la amastigote que muestra una breve flagelo no sobresale de flagelar el bolsillo, una invaginación de la membrana plasmática en la base de El flagelo, a la promastigote con un flagelo que podría ser incluso más largo que el cuerpo de la célula. Con un segundo LmxMPK9 kinasa perteneciente a una vía de señalización MAP quinasa se ha encontrado que interviene en la regulación de la longitud flagelar. En este sentido, mostró nula mutante promastigotos alargada flagelos, en comparación con las células de tipo salvaje, lo que indica que esta quinasa afecta a la reducción del flagelo [4]. LmxMPK1, la primera MAP quinasa homólogo descrito en L. Mexicana, ha resultado ser esencial para la proliferación de amastigotos [5]. Una supresión mutante sigue siendo capaz de infectar las células huésped, transformar a la amastigote morfología, pero no pudo proliferar. Como tal, esta cinasa es una meta ideal de drogas y un inhibidor específico sería prometedor para tratar la enfermedad.

En este sentido, caracterizar LmxMPK4, una MAP quinasa homólogo de L. Mexicana, que es esencial para promastigotos y amastigotos y, en consecuencia, también tiene el potencial de ser utilizado como un fármaco para el tratamiento de Leishmaniasis objetivo.

Resultados
Caracterización molecular de LmxMPK4

Hemos clonado y secuenciado el gen de LmxMPK4, que es una MAP quinasa homólogo de L. Mexicana. El marco de lectura abierta (orf), de LmxMPK4 se compone de 1089 bp que codifique una proteína de 363 aminoácidos y una masa molecular calculado de 41,5 kDa [6]. LmxMPK4 es altamente conservados en las distintas especies de Leishmania (L. panamensis 98,6%, L. donovani 97,5%, 97,5% L. infantum y L. principales 98,9% de aminoácidos identidades) y tiene homólogos en otros kinetoplastids, como Trypanosoma brucei (67,2 %; Valor de E 5e -139) y T. Cruzi (67,4%; E 2e valor de -143), en Chlamydomonas rheinhardtii (43,9%; E valor de la 6e -82), y, en Dictyostelium discoideum (45,0%; E valor de 1e -85). Además, muestra la debilidad de homología a los humanos MAP quinasas ERK1 (42%; E valor de 1e -70) y ERK2 (42%; E 6e valor de -71). LmxMPK4 contiene los doce quinasa subdominios y aminoácidos que se sabe están muy conservadas en el MAP quinasas (Fig. 1]. El dominio kinasa tirosina alcanza de 17 a fenilalanina 318 que abarca casi la totalidad de las proteínas dejando sólo un dieciséis de residuos amino-terminal y un 45 de residuos carboxi-terminal de la región. Esta última región revela un potencial común de acoplamiento (CD) dominio (DAAEE), una región enriquecido para residuos de carga negativa que participan en la unión de las proteínas que interactúan [7]. Subdominio I contiene fosfato de la cinta de anclaje para ATP vinculante con el consenso (GXGXXG). Un conservadas de residuos lisina (K59), que está involucrada en la orientación de la ATP para una adecuada transferencia de fosfato se encuentra en el subdominio II. El motivo TXY llevando una glutamina en su centro en LmxMPK4, P +1 y la especificidad de bolsillo, tanto por MAP quinasas características están presentes en subdominio VIII. Por último, una serie de otros residuos conservados que se encuentran en los diferentes subdominios. Southern blot análisis de ADN genómico de L. LmxMPK4 mexicana demostró que es una copia única de genes en el genoma haploides (Fig. 2]. PstI PstI recortes en el fragmento de ADN utilizado como una sonda y, por tanto, mostró dos bandas hibridadas mientras que todas las otras endonucleasas de restricción reveló sólo un único grupo.

El análisis por inmunotransferencia

El uso de un antisuero policlonal planteadas en conejos contra un carboxi-terminal del péptido LmxMPK4, la proteína puede ser detectada en un lisado de 4 × 10 7 promastigotes de tipo salvaje después de la extracción de los lípidos, pero difícilmente detectables en el mismo número de lesiones derivadas de amastigotes ( Fig. 3, carriles 1 y 2). Sin embargo, hemos podido detectar que en diferenciarse in vitro y cultivado amastigotes que se había amastigote bajo condiciones de crecimiento para diez pasajes. Incluso aquí 1 × 10 8 celdas tuvieron que ser extraídos y cargaron en el gel para generar una tenue banda que indica que la proteína es el regulado en el amastigotes (Fig. 3A, carril 3). Por otro lado, podríamos fácilmente sobreexpresan LmxMPK4 de un episome promastigotos en que se llegue a una sobreexpresión de al menos diez veces (Fig. 3A, carril 4). Para demostrar diferencial de carga de la mancha cantidades de proteínas fue desnudado y re-probaron con un antisuero contra myo-inositol-1-fosfato sintetasa, una proteína que se sabe que son igualmente expresadas en promastigotos y amastigotos [8].

Expresión recombinante de LmxMPK4 quinasa y de ensayo

Para generar un enzimáticamente inactivos KM-mutante LmxMPK4 mutado fue cambiando la lisina 59 a metionina. Ambos, el tipo silvestre y mutante de la proteína, se subcloned en pGEX-KG [9] recombinante y expresado como glutatión S-transferasa proteínas de fusión en Escherichia coli. Ambas proteínas resultado en el mismo patrón de bandas después de enriquecimiento de glutatión-sepharose, la separación en geles de poliacrilamida-SDS y tinción con Coomassie azul brillante. Los principales contaminantes son bandas de la glutatión S-transferasa fusión socio (no se muestra), una proteína menos abundante de una mayor masa molecular, y una segunda banda GSTLmxMPK4 justo debajo de la proteína de fusión (Fig. 4A, carriles 1 y 2). Esta última contaminaciones También se encontraron al tiempo que expresó no vinculados MAP quinasas de L. Mexicana en E. Coli y, por lo tanto, probablemente de origen bacteriano (datos no presentados). En ensayos quinasa podríamos detectar autophosphorylation de LmxMPK4, pero no de la KM-mutante (Fig. 4A, carriles 1 'y 2'), indicando que la fosforilación de LmxMPK4 no se debe a una enfermedad quinasa que podrían haber sido co-purificado. Sin embargo, la actividad quinasa fue relativamente débil como las películas tenían que ser expuestos durante un máximo de tres días para obtener los resultados que se muestran en la figura 4. Fosforilación de la proteína básica de la mielina (MBP) se pueden obtener con algunos preparativos de LmxMPK4 recombinante, pero no otros (datos no presentados). Nos suelen realizar ensayos quinasa en presencia de 10 mM Mg 2 + y 2 mM Mn 2 + a 27 ° C. Resultó que el manganeso por su propia cuenta en una concentración de 10 mM los mejores resultados en ensayos quinasa para LmxMPK4 (Fig. 4B]. Por último, un pH entre 6,0 y 7,0 mostraron más alto autophosphorylation actividad en el ensayo (Fig. 4C].

Supresión de análisis LmxMPK4

Para investigar la función de los parásitos Leishmania LmxMPK4 en que trataron de obtener mutantes homocigotos supresión. Con el fin de suprimir los dos alelos del gen de la única copia que genera construcciones compuesto de los 5'-y 3'-regiones no traducidas (UTRs) LmxMPK4 acompañamiento de la hygromycin B fosfotransferasa gen o los genes de la proteína de unión phleomycin. Tras primeras rondas de recombinación homóloga obtuvimos un solo alelo mutantes supresión de todos los constructos (datos no presentados). Todos nuestros intentos de generar un mutante nulo para LmxMPK4 dado lugar a los clones que transportaba a los genes marcadores de resistencia en el contexto genómico espera, sin embargo, todos conservarse una copia adicional de LmxMPK4 (datos no presentados). Este resultado parece ser indicativo de un gen que es necesario para la etapa de la vida promastigote de L. Mexicana. Por lo tanto, hemos decidido añadir una episomal primera copia de la LmxMPK4 tipo de genes silvestres en la promastigotos utilizando el plásmido pXPACLmxMPK4. La presencia del plásmido y el grado de expresión de la MAP quinasa fue verificada por el Sur y el análisis de inmunoblot (datos no presentados; Fig. 2, carril 4). Siguiente repetimos nuestra estrategia de supresión, esta vez conduce a una exitosa sustitución de la genómica de LmxMPK4 alelos en un clon (Fig. 5, carril 5), mientras que la mayoría de los parásitos recombinante conservado un alelo de genómica LmxMPK4 a pesar de la presencia del gen En la episome (un ejemplo se muestra en la Fig. 5, carril 4). El resultado genómica mutante nulo parásitos no mostró evidentes en comparación con el fenotipo de tipo salvaje promastigotos. Se utilizó esta línea celular para infectar hembra Balb / c mice lesión y supervisado el desarrollo de más de 1,5 años. Todos los ratones inyectados mostraron lesión desarrollo (datos no presentados). Hacia el final del experimento se sacrificaron a los ratones, ya sea aislado y la lesión derivada de la transformación de amastigotes a promastigotos, o tomó aspirados de la lesión de reacción en cadena de polimerasa (PCR) para evaluar el análisis de la ausencia o presencia de la ejecución LmxMPK4 plásmido. PCR en la población total de recién diferenciadas promastigotos demostrado la presencia de LmxMPK4 en la población de células. Re-aislamiento de plásmidos de recién diferenciadas promastigotos y la restricción análisis confirmó la identidad del plásmido (datos no presentados). Para evaluar la presencia de plásmidos en amastigotos estamos aislados por parásitos teniendo aspirado de la lesión. Como un control de tipo salvaje amastigotos fueron aislados y tratados como el mutante amastigotos. El amastigotos fueron liberados de sus células de acogida por las fuerzas de cizalla también perturbar agregados de amastigotes que conduzca a una suspensión de células individuales. El ADN de las células se tiñeron utilizando SYTO16 (Invitrogen, Heidelberg, Alemania), seguido de la clasificación de los parásitos en placas de 96 pozos. Un duplex PCR se realizó con un par de oligonucleótidos específicos de la única copia LmxMPK9 gen, que genera un fragmento de 254 pb de ADN, y una segunda pareja de oligonucleótidos específicos para detectar la presencia de LmxMPK4 por un fragmento de 420 pb de ADN. En una serie de informes de terminación de proyecto utilizando diferentes números ordenados de tipo salvaje amastigotos resultó que por lo menos diez por amastigotos así tenía que ser usado para dar resultados fiables en la posterior PCR. Sólo una reacción de los 44 no se presentaron al control de LmxMPK9 fragmento en el mutante. Este raro caso de no amplificación no se ha encontrado para LmxMPK9 tipo en la naturaleza, pero se observó en ambos LmxMPK4 de tipo silvestre y mutante amastigotos indicando que es realmente un fracaso de PCR y el plásmido es definitivamente presente en todas las células. Buscan a recién diferenciadas promastigotos hemos tenido una imagen muy diferente. Como promastigotos podría ser purificado logramos mucho más fácil de realizar la PCR dúplex en la única celda con un alto nivel de eficiencia. Una vez más un fallo de la PCR se puede observar, como en el 5% de todos los pozos (4 / 77) el control no es fragmento amplificado. El porcentaje de los pozos que carecen de la LmxMPK4 fragmento fue de 27% (21/77). Este porcentaje más alto es indicativo de la presencia de las células individuales que carecen de plásmido y, por tanto, el gen. Como esto da ninguna pista acerca de la capacidad de los promastigotos que han perdido el plásmido a proliferar, clonados de células de la serie de dilución de las poblaciones analizadas y derivadas de la utilización de las células individuales duplex PCR. Todos los 66 clones obtenidos aún conservaba el plásmido. Por lo tanto, es esencial para LmxMPK4 promastigotos y amastigotos.

Discusión

LmxMPK4 Se ha descubierto que ser una MAP quinasa homólogo de L. Mexicana por la comparación de secuencias de aminoácidos y una activa la proteína quinasa, al demostrar la actividad de la fusión recombinante GST-proteína quinasa en ensayos in vitro. La proteína es difícilmente detectable por inmunoblot amastigotos en el análisis, sin embargo, el hecho de que carecen de la genómica amastigotos copias de LmxMPK4 mantenerse un plásmido que lleva el gen sin ningún tipo de antibiótico de selección impuestas a las células mientras que en el ratón durante más de 1,5 años sugiere que el Proteína se expresa y esenciales para esta etapa de vida. Además, todos los intentos de generar mutantes homocigotos supresión en el promastigotos fracasado constantemente y terminó en los parásitos que muestra precisa la sustitución de los dos alelos de LmxMPK4, pero una copia adicional del gen, que podrían reflejar una duplicación cromosómica. Así, LmxMPK4 se requiere en la etapa de insectos promastigotos también. Esto es contrario a TbMAPK2, el T. Brucei homólogo de LmxMPK4, que se puede suprimir en el torrente sanguíneo de mamífero etapa forma tripanosomas sin detectables fenotipo [10]. Sin embargo, la diferenciación de los mutantes nulos para procíclico tripanosomas por cambio de temperatura de 37 ° C hasta 27 ° C y la adición de cis-aconitate reveló retraso en la diferenciación de la cinética y la detención de los parásitos en todas las fases del ciclo celular. Es probable, que en T. Brucei procíclico formas la progresión del ciclo celular depende de un estímulo a través de TbMAPK2 constitutiva de señalización. Leishmania en la importancia de LmxMPK4 es incluso extensivo a los mamíferos etapa del parásito que esta quinasa un posible objetivo de drogas para el tratamiento de la leishmaniasis.

Conclusión

LmxMPK4 es un mitogen-activated homólogo de la proteína quinasa L. Mexicana, que es altamente conservado durante diferentes especies de Leishmania y es esencial para la proliferación de las dos principales etapas de su vida, la promastigotos y amastigotos, del parásito. Además, pone de manifiesto importantes diferencias de aminoácidos en comparación con el MAP quinasas de mamíferos a los que muestran más alto de homología de proteínas quinasas kinetoplastids, baja homología a humanos quinasas y quinasas de Chlamydomonas y Dictyostelium. Por lo tanto, representa un adecuado y prometedor objetivo de drogas para prevenir la proliferación de los parásitos y curar la enfermedad.

Métodos
Parásitos

Promastigotes de L. MNYC/BZ/62/M379 mexicana se cultivaron tal y como se describe [11]. Mujeres Balb / c ratones fueron infectados en la almohadilla del pie izquierdo posterior a la edad de 6-8 semanas con 1 × 10 7 promastigote parásitos en 30 μ l de PBS (137 mM NaCl, 2,7 mM KCl, 8 mM Na 2 HPO 4, 1,4 mM KH 2 PO 4). Infección experimentos han sido aprobados por las autoridades veterinarias y de la Freie Hansestadt Hamburgo y se realizaron de conformidad con el artículo 8 bis, apartado 1, junto con el artículo 10 bis de la Ley de Protección Animal alemán modificada el 25 de mayo de 1998, con la última enmienda de 6 de agosto de 2002 (GZ.: G 21132/591-00.33). Utilizando una pinza medidor, el curso de la infección fue seguido de medir el tamaño de las lesiones en relación con la no infectada derecho footpad posterior a intervalos de 4-5 semanas. Amastigotos fueron aisladas de las lesiones de ratones Balb / c ratones, tal como se describe [5]. A pequeña escala amastigote preparación la lesión fue aspirado 2-3 veces con un 23 G × 1 1 / 4 "aguja y una jeringa. El tejido aislado fue transferido en 0,5 ml de frío SYTO16-buffer (21 mM Hepes pH 7,5, 137 mM NaCl, 5 mM KCl, 6 mM de glucosa) y se mantuvo en hielo. El tejido se aprobó cinco veces a través de un 30 G × 1 / 2 "aguja para generar células individuales. 850 μ l de frío SYTO16-buffer, 150 μ l DMSO y 0,5 μ l de 33 μ M SYTO16 (Invitrogen) en DMSO se añadieron, las células mixtas e incubados durante 30 minutos a temperatura ambiente en la oscuridad. Posteriormente, las células fueron lavadas dos veces con SYTO16-buffer y finalmente resuspendido en 1 ml de buffer SYTO16 y almacenadas a 4 ° C en la oscuridad antes de la clasificación. Por promastigote tinción 1,1 × 10 8 células se tomaron de un registro de la fase cultura, lavados dos veces con 1 ml SYTO16-buffer, y procesados como se ha descrito anteriormente.

Genética de la clonación, la secuenciación y análisis

Fagos clones positivos para LmxMPK4 fueron seleccionados utilizando digoxigenina (DIG)-etiquetados sondas [6], la amplitud y los insertos de ADN clonado en pBSKII (+) usando EcoRI EcoRI (Stratagene, La Jolla, CA) pBE25LmxMPK4 rendimiento. A 4514 bp ClaI ClaI fragmento de ADN fue liberada de pBE25LmxMPK4 y ligated en pBSKII (+) pB2CLmxMPK4 rendimiento. Ambas ramas se secuencia ADN. Plásmido aislamiento, secuenciación y análisis de ADN, el ADN y el aislamiento secante, y se realizaron hibridaciones básicamente como se describe antes [12]. Una sonda que abarca nt 204 - nt 930 de la orf de LmxMPK4 se DIG-etiquetados utilizando los oligonucleótidos 5'-TGCGGGAGATGGAGATAA-3 'y 5'-CTTCGCAGTTAATCGTCTT-3' y la PCR DIG síntesis kit de la sonda, tal como se describe por el fabricante (Roche, Mannheim, Alemania). Para el etiquetado de 2350 bp SphI SphI / NruI NruI fragmento de ADN correspondientes a los 3 'de la región sin traducir LmxMPK4 el fragmento fue aislado de pB2CLmxMPK4 y etiquetados utilizando el kit de etiquetado de ADN DIG (Roche). LmxMPK4 secuencia de los datos se han presentado a la DDBJ / EMBL / GenBank bases de datos en virtud del número de AJ293282 .

LmxMPK4 supresión construye

La Alta Fidelidad Ampliar ™ PCR o Ampliar la plantilla de Long PCR System (Roche) fue utilizado para todas las cadena de la polimerasa (PCR) de reacción aplicaciones. Para generar la construcción de una supresión genómica alelo mutante LmxMPK4 el acompañamiento de las regiones fueron amplificados por PCR de pB2CLmxMPK4 cortar con BglII BglII utilizando 5'-GCTGAGCCATGGTTCTCTATGCCTCC-3 'y 5'-TGAAAGCCTAGGAATCTGGTGCTCTC-3' (3 min 94 ° C, 10 × [20 seg 94 ° C, 30 segundos a 45 ° C, 7 min 68 ° C], 20 × [20 seg 94 ° C, 30 segundos a 45 ° C, 7 min + 20 seg / ciclo de 68 ° C], 7 min 68 ° C, 4 ° C). El gel-PCR-fragmento purificado fue recortado en los extremos usando NcoI NcoI y AvrII AvrII, y ligated a un BspHI BspHI / NheI NheI fragmento que contiene la proteína de unión de genes phleomycin (BLE) o la hygromycin B fosfotransferasa gen (HYG) tal y como se describe Antes [12], dando pB11C Δ LmxMPK4phleo y pB21C Δ LmxMPK4hyg. Ambas construcciones se redujeron con ClaI ClaI y NruI NruI, los fragmentos de ADN para la recombinación homóloga de gel fueron purificados y utilizados para la electroporación en dos rondas consecutivas y recombinantes seleccionados en el soporte de 5 μ g ml -1 bleocin y 20 μ g ml -1 hygromycin B [ 4].

Expresión episomal construye para LmxMPK4

Por episomal LmxMPK4 expresión de la orf se amplificó desde pB2CLmxMPK4 utilizando 5'-CCCGATATCATGACTCAGCTCGTCCC CCCGATATCATGACTCAGCTCGTCCC CCCGATATCATGACTCAGCTCGTCCC CCCGATATCATGACTCAGCTCGTCCC CCCGATATCATGACTCAGCTCGTCCC-3 'y 5'-CCCGATATCTCGAGCCTATTCGTTCAATTGTG CCCGATATCTCGAGCCTATTCGTTCAATTGTG CCCGATATCTCGAGCCTATTCGTTCAATTGTG CCCGATATCTCGAGCCTATTCGTTCAATTGTG CCCGATATCTCGAGCCTATTCGTTCAATTGTG-3' (5 min 94 ° C, 20 × [30 seg 94 ° C , 30 seg a 45 ° C, 1 min 72 ° C], 7 min 72 ° C, 4 ° C), que presenta EcoRV EcoRV, BspHI BspHI, y los sitios de restricción XhoI XhoI, acabado con EcoRV EcoRV y ligated en pBSKII (+) para el rendimiento PB6ELmxMPK4. Ambas ramas se secuencia ADN. El 1104 bp EcoRV fragmento EcoRV desempeño LmxMPK4 fue liberado y clonado en pX63polPAC linearised en su único EcoRV EcoRV sitio [4]. Las células fueron transfectadas con 20 μ g del plásmido construye designado pXPACLmxMPK4 como se ha descrito anteriormente, y transformantes fueron seleccionados en el SDM-79 con 20 μ M puromycin.

Expresión construye, mutagénesis y la producción de anticuerpos

El 1095 bp BspHI BspHI / XhoI XhoI fragmento de ADN fue aislado de pB6ELmxMPK4, ligated en pGEX-KG [9] cortar con NcoI NcoI y XhoI XhoI, y la consiguiente construcción se transformó en E. Coli XL1-Blue. Expresión y purificación de la glutatión-S-transferasa proteína de fusión se realizó según lo descrito antes [4]. Para generar un enzimáticamente inactivos LmxMPK4 versión de la lisina 59 fue sustituido por metionina. Los oligonucleótidos 5'-GTTGTCGCGAGTCTTTGGTGATCTTCGTG GTTGTCGCGAGTCTTTGGTGATCTTCGTG GTTGTCGCGAGTCTTTGGTGATCTTCGTG-3 'y 5'-AGACTCGCGACAACCGCATGATAGCCACTCGCTCACC AGACTCGCGACAACCGCATGATAGCCACTCGCTCACC AGACTCGCGACAACCGCATGATAGCCACTCGCTCACC-3' introducir NruI NruI y sitios de la mutación deseada se utilizaron en una PCR en pB6ELmxMPK4 (94 ° C, 5 min, 10 × [94 ° C , 30 s, 45 ° C, 30 s, 68 ° C, 3 min], 10 × [94 ° C, 30 s, 55 ° C, 30 s, 68 ° C, 3 min + 20 s / ciclo] 68; ° C, 7 min, 4 ° C). El fragmento amplificado fue purificado-gel, acabado en los extremos usando NruI NruI, circularised por la libre ligadura, y se transforma en E. Coli. El éxito de mutagénesis fue confirmada por secuenciación. Por último, el gen mutado fue clonado en pGEX-KG, tal como se describe más arriba. Un antisuero de conejo se produce en contra del péptido CEDLWRVVEAHSQLNE correspondiente a la carboxi-terminal de 15 aminoácidos de LmxMPK4 (Eurogentec, Seraing, Bélgica).

Immunoblotting

Las células fueron cosechadas por centrifugación y se lavan de una vez usando PBS. El pellet se resuspendió en cloroformo / metanol / ddH 2 O (1:2:0.8) en una concentración de 2 × 10 8 células / ml y dejado a temperatura ambiente durante 30 min. Las células se extrajeron pildoradas durante 10 min a 15000 × g a temperatura ambiente y la de pellets secado al vacío (speed-vac). Luego, el pellet se resuspendió en 100 μ l de 50 mM Tris / HCl pH 8,0, 20 μ M leupeptina, 1 mM phenylmethylsulfonyl fluoruro, 5 mM 1,10-phenanthroline, 10 mM MgCl 2, 100 U / ml benzonase (Merck, Darmstadt, Alemania) E incubadas a 37 ° C durante 30 min. Dithiothreitol (TDT) se añadió a una concentración final de 50 mM y ajustado a la sonda 1 × SDS muestra de amortiguación (0,4% SDS, el 4% de glicerol, 0,0002% bromphenol azul, 50 mM TDT, el 12,5 mM Tris-HCl pH 6.8). Las sondas se hierve durante 10 minutos, 20-40 μ l sometido a SDS-electroforesis en gel de poliacrilamida (PAGE) y borró a poli (vinylidenedifluoride) (PVDF) membranas. Immunodetection se llevó a cabo según lo descrito antes [5] utilizando el antisuero policlonal de conejo y de cabra anti-conejo anticuerpos secundaria junto a peroxidasa (Dianova, Hamburgo, Alemania), seguido por quimioluminiscencia utilizando el sistema ECL (Amersham Pharmacia Biotech, Freiburg, Alemania).

Quinasa ensayo

1 μ g de la cinasa purificada se utilizó en 50 μ l quinasa solución de ensayo (50 mM Tris pH 7,5, 0-50 mM MgCl 2, 0-10 mM MnCl 2, 0,1 M NaCl, 5 μ Ci (γ P-32)-ATP, 1 mM ATP, 5 μ g proteína básica de la mielina) y se incuba a 27 ° C. Las diferentes condiciones de pH se llegó a la prueba con 50 mM de ácido sulfónico morpholinoethane para pH6.5 y más adelante, 3 - (N-morpholino) propanesulfonic ácido para pH7 y 7,2, y 50 mM Tris / HCl de pH 7,5 y superior. 12,5 μ l 5 × SDS muestra de amortiguación se han añadido y la solución se calienta durante 10 minutos a 95 ° C. 25 μ l de la solución, se dividieron en un 12% SDS-PAGE, teñidos con Coomassie azul brillante, destained, secos y expuestos a rayos X películas a -70 ° C.

Célula de clasificación y análisis de PCR

Única promastigotos SYTO16 fueron teñidas con acceso controlado, con un delantero de dispersión FSC-A <80 y una parte de dispersión SSC-A <80 y ordenados en 96-vestida así placas de PCR (Sarstedt, Nuembrecht, Alemania) usando un FACSAria (Becton & Dickinson , Franklin Lakes, NJ). Por lesión derivada de la menor amastigotos SYTO16 de partículas positivas (FSC-A <50, SSC-A <50) fueron ordenados con diez células por así. Todas las reacciones de PCR se realizaron en un Eppendorf Mastercycler ep (Eppendorf, Hamburgo, Alemania). 25 μ l de una mezcla se añade a cada pozo que contenía pro-o amastigotos. 24 μ l de la mezcla y 1 μ l de ADN genómico (c = 0,24 μ g / μ l), de L. Mexicana sirvió como control positivo, como un control negativo 25 μ l de mezcla se utilizaron. Después de la adición de la mezcla de las placas fueron selladas con papel de aluminio adhesivo (Sarstedt). 0,5 μ l AccuPrime Taq ADN polimerasa (Invitrogen) se utilizaron en un volumen de 25 μ l con 5 pmol de los respectivos oligonucleótidos (10 min 94 ° C, 45 × [10 seg 94 ° C, 15 segundos a 60 ° C, 45 seg 68 ° C], 7 min 68 ° C, 4 ° C). Para la amplificación de las 254 bp control de los fragmentos de ADN derivados de LmxMPK9 [6] hemos utilizado 5'-GTCAGCGTGCCAATGAAAT-3 'y 5'-CAAGCTCCGGTGCGCGGTA-3'. Un fragmento de ADN 420 pb correspondiente a LmxMPK4 se amplifica por 5'-TATGATTCAAGCATTCCGCG-3 'y 5'-CGGCCGATGCGGCTGAGAG-3'. Las muestras se analizaron en geles de agarosa 1,5%.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

QW clonado y secuenciado LmxMPK4, construido a la supresión y sobreexpresión construye, y se lleva a cabo el análisis y la supresión immunoblotting experimentos.

IMM expresado y purificado las proteínas recombinantes y realizó la caracterización enzimática.

MK amastigotes aislados, preparado para las células FACS clasificación y análisis de PCR realizadas en células ordenados.

CS-J. Realiza la clasificación de células en un Becton Dickinson FACSAria.

MW concebido en el estudio, bajo la supervisión de la ejecución, hizo el análisis de PCR sobre líneas de células clonadas, y preparó el borrador final del manuscrito.

Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

Damos las gracias a Anne Scholz de la lectura crítica del manuscrito, el Gilberger grupo en el Instituto Bernhard Nocht de Medicina Tropical de asesoramiento y dejar que nos utilicen su Mastercycler Eppendorf, Iris Goercke de expertos para la asistencia técnica, y Thomas Ilg (Tuebingen) de la prestación de los myo-inositol - 1-fosfato sintetasa antisuero.