Plant Methods, 2005; 1: 13-13 (más artículos en esta revista)

Vectores de expresión transitoria de la genómica funcional, la cuantificación de la actividad promotora y silenciamiento de ARN en las plantas

BioMed Central
Roger P Hellens (rhellens@hortResearch.co.nz) [1], Andrew C Allan (aallan@hortResearch.co.nz) [1], Ellen N Friel (efriel@hortResearch.co.nz) [1], Karen Bolitho (Kbolitho@hortResearch.co.nz) [1], Karryn Grafton (kgrafton@hortResearch.co.nz) [1], Mateo D Templeton (mtempleton@hortResearch.co.nz) [1], Sakuntala Karunairetnam (skarunairetnam @ hortResearch . Co.nz) [1], Andrew P Gleave (agleave@hortresearch.co.nz) [1], William A Laing (wlaing@hortResearch.co.nz) [1]
[1] HortResearch, Mt Albert Research Centre, Private Bag 92169, Auckland, New Zealand

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Se describe novela plásmido vectores de la expresión génica utilizando transitoria Agrobacterium, se infiltraron en hojas de Nicotiana benthamiana. Hemos generado una serie de vectores de clonación pGreenII que se adapta perfectamente a la expresión génica transitoria, mediante la eliminación de elementos de los vectores convencionales binarios necesarios para la transformación estable como la transformación de selección de genes.

Resultados

Nos dan un ejemplo de la expresión de la heme-thiolate P450 para demostrar la eficacia de este sistema. También hemos diseñado vectores que se aprovechan de un doble luciferase sistema de ensayo para analizar secuencias de promotor o posterior a la regulación transcripcional de la expresión génica. Nos han demostrado su utilidad por la co-expresión de factores de transcripción y putativo de la secuencia promotora de los genes y el posible objetivo mostrar cómo ortólogos promotor responder a las secuencias de estos genes. Por último, hemos construido un vector que nos ha permitido investigar las características de diseño de horquilla construcciones relacionadas con su capacidad para iniciar el silenciamiento de ARN, y han utilizado estas herramientas para estudiar cis-efecto regulador de intrón que contienen construcciones genéticas.

Conclusión

En el desarrollo de una serie de vectores ideal para la expresión transitoria análisis hemos proporcionado un recurso que además promueve la aplicación de esta tecnología. Estos vectores son mínimos ideal para los métodos convencionales de la clonación y que las han utilizado para demostrar su flexibilidad para investigar la actividad enzimática, regulación de la transcripción y después de los procesos de regulación transcripcional en ensayos de transitorios.

Antecedentes

Agrobacterium tumefaciens es la principal herramienta utilizada para generar plantas transgénicas [1]. Durante las primeras etapas de co-cultivo, de un solo varados T-ADN es transferido de la bacteria a células vegetales [2]. Una vez trasladado a la planta de la célula bacteriana y codifican proteínas vegetales [3, 4], este se convierte en T-ADN de doble varados y migra al núcleo. Sólo un pequeño porcentaje está integrado en los cromosomas de acogida para establemente células que pueden transformarse posteriormente ser regenerada en las plantas transgénicas. Aunque el destino a largo plazo de la T-DNAs que no integrarse en los cromosomas no es clara, por un tiempo, estas piezas de ADN son transcriptionally competente, que es la base de la mediada por Agrobacterium transitoria de sistemas de expresión [5]. Aunque mediada por Agrobacterium estable de genes de plantas de transformación requiere binario vectores que permiten la manipulación del plásmido en tanto E. Coli y Agrobacterium y un marcador seleccionable para recuperar transformado plantas [1], no seleccionable marcador es necesaria para la expresión transitoria. La omisión de la seleccionables marcador permite a los vectores de clonación a ser más pequeñas y más fáciles de manejar (por ejemplo, menos posibilidades de duplicar los sitios de restricción se produzcan) y puede dar lugar a aumento de la frecuencia y la ligadura de plásmido bacteriano de transformación [6].

Hemos construido una serie de vectores de clonación binarios que se han diseñado específicamente para transitoria de la expresión génica en células vegetales. El uso de las plantas como una expresión sistema ofrece varias ventajas sobre procariótico o no planta de sistemas de expresión. Por ejemplo, los genes que contienen intrones son procesados y ambos subcelular de orientación y después de la traducción modificaciones son posibles. Además, los componentes necesarios para la iniciación transcripcional, el procesamiento del ARN, y el inicio de traducción ya están presentes en la planta.

En este estudio, describimos nuestra plásmido vectores y transitoria de la expresión de genes del sistema, basándose en los ejemplos de (i) la asignación de función a un heme thiolate (TH)-P450 gen, (ii) la determinación de un factor de transcripción objetivo promotor, y (iii) el estudio de El papel en el procesamiento del ARN dsRNA horquilla inducida por silenciamiento de ARN.

Proteínas de la HT-P450 clase de los genes son de particular importancia para el metabolismo secundario. Ellos catalizar una NADP dependiente de la hidroxilación paso en una variedad de metabolitos de plantas que permite la modificación de la base de compuestos (por ejemplo, terpeno, fenil propanoid) por otras enzimas como metil transferasas o alcohol acyl transferasas. Hem thiolate-P450s son una de las mayores familias de enzimas en las plantas; hay 246 HT-P450 genes en el genoma de Arabidopsis: Arabidopsis citocromo P450)) [7], aunque muy pocos se han caracterizado funcionalmente [8]. Como estas enzimas están obligados membrana y requieren de un NADPH HT-P450 reductasa (EC 1.6.2.4) para la actividad, analizaron estas enzimas in vitro es difícil. Aunque la levadura de expresión se han desarrollado sistemas que permiten que estos genes a ser analizados [9], nos muestran que nuestro sistema de expresión transitoria se puede utilizar para analizar la manzana homólogo de la HT-P450, cinnamic ácido 4-hidroxilasa, MdC4H1 (CE 1,14. 13.11). Cinnamic ácido es un metabolito de la fenil propanoid vía, una vía clave en las plantas principales, entre otros, a la producción de lignina, lignan, antocianinas y flavonoides [10].

Factores de transcripción (TF) son una gran clase de los genes con el ADN vinculante motivos [11]. Mecánicamente estas proteínas se unen a los elementos dentro de una secuencia del gen promotor y regular la transcripción. TFs son capaces de regular coordinadamente complejos procesos de desarrollo o de control de toda la vía metabólica [11]. Hay más de 1400 conocida TFs en el genoma de Arabidopsis [11] y la identificación de las metas para cada uno de ellos es una tarea difícil. Hemos tomado ventaja de un simple, comercial luciferase doble sistema de ensayo que permita la expresión de la meta promotor control de la expresión de firefly luciferase (LUC) reportero y un gen promotor de control (CaMV 35S), la regulación de la expresión de Renilla luciferase (REN) reportero Gen. Hemos sido capaces de determinar la eficacia relativa de los diferentes TFs en estimular la expresión de un reportero promotor de la construcción de secuencias de genes.

Tanto el exceso de proteínas y expresión genética enfoques se han beneficiado de los últimos avances en el silenciamiento de ARN, una secuencia específica de ARN del mecanismo de degradación [12]. Sin embargo, hay aspectos de la bioquímica de ARN, como el efecto de procesamiento del ARN, lo que puede influir en silenciamiento génico, que siguen siendo escasos los conocimientos [13]. Hay varios eventos de procesamiento de ARN, como intrón mediada por el aumento [14], que se sabe que después de los transcriptionally acto, y un enlace entre el procesamiento del ARN y silenciamiento génico sigue siendo posible. Utilizando el sistema de ensayo transitorio con doble reportero genes que pudimos investigar horquilla expresión construcciones que se diferencian en el intrón configuración y especular sobre el papel que puede desempeñar el procesamiento del ARN para influir en la expresión de los genes vecinos.

Resultados y Discusión
Vector construye desde hace más de expresión

En el segundo paso de la vía fenil propanoid, cinnamic ácido es hidroxilado en la posición de cuatro (véase la Fig. 2A] por HT-P450 hidroxilasa, C4H (EC1.14.13.11), para producir ácido p-coumaric. Una manzana orthologue, MdC4H1, fue identificado a partir de la base de datos de EST HortResearch manzana por similitud de secuencia [15] a los genes de Arabidopsis, Al-C4H (At2g30490), y un largo clon cDNA insertado en el pGreenII 62-SK vector (Fig. 1 ). Como NADPH (+) HT-P450-actividad de la reductasa (EC 1.6.2.4) se ha demostrado que sea necesario que analizaron HT-P450 actividad en ambas bacterias [16] y [9] levadura, también identificó un cDNA homólogas a la Arabidopsis HT-P450 reductasa (At4g30210), que corresponden a anuncios HT-P450 reductasa, de los kiwis y se inserta en pGreenII 62-SK.

La expresión transitoria de la heme-thiolate P450

Los primeros experimentos evaluaron el nivel de actividad de la enzima transitoriamente expresó Md-C4H1 y el efecto de Ad-P450 reductasa Agrobacterium 10 días después de la infiltración. La medida de la conversión de ácido cinnamic a ácido p-coumaric, medida por HPLC, fue similar para ambos la MdC4H1 y la MdC4H1 + Ad-P450 reductasa, y significativamente más alto que para un vacío transformado transitoriamente el control de los vectores (datos no presentados). Además, analizaron Agrobacterium culturas justo antes de la infiltración no reveló endógeno C4H actividad de la enzima en la bacteria. Esto sugiere que la actividad endógena en la hoja de tabaco proporcionado suficientes NADP-dependiente P450 reductasa, y que la capacidad adicional de la expresión transitoria de la reductasa no era necesaria. A este respecto, los ensayos de transitorios en las plantas difiere de la de otros sistemas de expresión que un exógenos reductasa se requiere para la óptima actividad enzimática. El adicional de la expresión viral silenciar supresor P19 no aumentó significativamente la actividad de la enzima (datos no presentados). Si bien la expresión de P19 se ha demostrado para mejorar la expresión de otros genes expresados transitoriamente en otros estudios [5], en el caso de HT-P450 parece que los niveles de expresión génica no son perjudicados por silenciamiento génico. Esto indica que, o bien la membrana microsomales superficie disponible para facilitar la reacción o la disponibilidad del sustrato es la limitación de la infiltración

La expresión transitoria tiempo curso

Después de haber establecido nuestra capacidad de medir la conversión de ácido cinnamic a ácido p-coumaric, más optimizado que el ensayo para determinar el periodo óptimo para la infiltración sustrato. El HPLC pico alturas para ambos sustrato (cinnamic ácido) y productos (ácido p-coumaric) se representará gráficamente como una función del tiempo transcurrido entre la extracción y la infiltración de sustrato. La conversión de cinnamic ácido a ácido p-coumaric aumento de hasta una hora, aunque posteriormente el nivel de ácido p-coumaric disminuyó (Figura 2B]. La concentración de ácido cinnamic disminuido durante todo el período de tiempo a prueba. No ácido p-coumaric se detectó en el control. Esta disminución en el producto puede sugerir que el ácido p-coumaric fue modificada por enzimas endógenas durante ese tiempo. Esto es apoyado además por la aparición de un segundo pico de productos en un anterior tiempo de retención en el punto 2 h tiempo cromatógrafo.

Hemos investigado el próximo tiempo entre la infiltración de Agrobacterium y el sustrato. Tiempo puntos fueron elegidos un máximo de seis días (con 60 min sustrato entre infiltración y extracción de hojas) (Fig. 2C]. En t = 0, también hubo poca conversión de cinnamic ácido p-coumaric de ácido, lo que demuestra una baja endógeno C4H actividad de la N. Benthamiana hoja, y la ausencia de la actividad de la C4H infiltrado Agrobacterium (Fig. 2C]. Los niveles de des-reaccionó cinnamic disminuido como ácido p-coumaric ácido acumulada durante el período de tiempo de seis días (Fig. 2C]. Así se llegó a la conclusión de que seis días de la infiltración de Agrobacterium y 60 min infiltración de un sustrato sensible de ensayo HT-P450s.

Además, verificó la utilidad del método con otros dos genes; Actinidia deliciosa galactosa deshidrogenasa, [17], y L-galactosa-1-fosfato fosfatasa [18]. Ambos genes expresados altos niveles de actividad de sus respectivas enzimas. En el caso de la galactosa deshidrogenasa, los niveles de expresión se ~ 100 veces superior a P19 infiltrado hojas de control a los 7 días después de la infiltración, mientras que la fosfatasa mostraron altos niveles de expresión de un L-Galactose-1-P fosfatasa específica en comparación con indetectable actividad en el Control (datos no presentados).

Un vector para el análisis de las interacciones promotor factor de transcripción

El promotor para cuatro secuencias chalcone sintasa (CHS) genes (EC 2.3.1.74) de cada una de las cuatro especies: Arabidopsis, manzana (Malus domestica), el guisante (Pisum sativum) y petunia (Petunia hybrida) se inserta en cada uno de los múltiples sitios de clonación PGreenII de 0800-LUC (Fig. 3]. En todos los casos el promotor fue modificado para introducir un NcoI NcoI sitio en el extremo 3 'de la secuencia (en el codón de iniciación CHS, ATG), que permite al promotor para ser clonados como la fusión transcripcional de genes con la LUC. Así, TFs que unen a los promotores y aumentar la transcripción podría ser identificado por un aumento de la actividad LUC. Los promotores de Malus domestica MdCHS1 [GenBank: DQ026297 ] Identificado como un fragmento de 1,3 Kb PCR en el Ecl136II Ecl136II-enlazador de la ligadura de biblioteca [de genes DQ022678 ], Arabidopsis CHS (TT4; AT5G13930 insertar referencia), petunia CHS-A [GenBank: X14591 ] Y Pisum sativum CHS-1a [GenBank: X80007 ] Fueron aisladas de ADN genómico. En la misma construcción, un REN de genes bajo el control de un promotor 35S presentó una estimación de la medida de la expresión transitoria (Fig. 3]. Actividad es expresada como la relación de LUC a REN actividad.

El reportero de construir, transformar en Agrobacterium, se mezclaba con una cepa de Agrobacterium con un 35S-MYB construir y co-infiltrado en las hojas del tabaco.

Transitorios análisis de los factores de transcripción

A falta de una MYB TF, la LUC a REN proporción fue baja. Este nivel de fondo de la actividad presumiblemente representa a los niveles basales de MYBs presente en las hojas del tabaco. En prácticamente todos los casos, la adición de un TF a la mezcla el aumento de la infiltración de la LUC nivel relativo de la actividad en comparación con el fondo promotor de la actividad en ausencia de Agrobacterium contienen un candidato TF (Fig. 4]. La mayoría de los TFs probados mostraron una similar, ligeramente superior a la de fondo, el nivel de actividad. "Creemos que muchas de estas TFs tendrá una baja afinidad a estas secuencias de promotor, y, por tanto, una pequeña causa no específica transeuropeas de activación. Se postula que en la interacción entre TF y promotor fue más específico transeuropeas de activación, hay un aumento significativo de la actividad en relación con LUC REN (Fig. 4]. Para seis de la TF-promotor comparaciones, múltiples repeticiones del ensayo utilizando seis independiente infiltrado en hojas con el mismo Agrobacterium cultura se utiliza para generar el error estándar de los datos (fig. 4B]. Ensayos preliminares se mostró poco día a día, a la planta de hoja de la planta o posicional efectos en el ratio calculado (datos no presentados). Además, la concentración de Agrobacterium en la infiltración de amortiguación no afecta a la relación significativa (datos no presentados). En estos experimentos en un error de 14-17% se observó, similar a la anterior transitoria estimaciones de ensayo error. Elegimos no a la estimación de error para el resto de ensayo, sino establecer un límite tal que la REN hubo que calcular el valor por encima de 100 unidades relativas de luz (RLU) para tener la seguridad de un grado de error comparables en el resto de los datos.

La utilidad de la luciferase vector fue demostrada por determinación de TFs que mostraron significativamente mayor LUC a REN ratios de antecedentes que, en comparación con la media de otros TFs. Casos en los que un promotor-TF interacción fue identificado generalmente traducido en por lo menos diez veces mayor a REN LUC ratio superior a la media en comparación con otros antecedentes MYBs que mostraba un 1 a 2 veces más en la relativa LUC actividad de la promotora solo. Así, hemos identificado a un grupo de 20 factores de transcripción, los TFs que probablemente esté implicado en la regulación del gen CHS (Fig. 4].

La capacidad de estos ensayos de transitorios para discriminar entre fuertes y débiles transeuropeas de activación fue significativamente influenciado por el período transitorio de expresión y de la relación de Agrobacterium que llevan la transcripción y las cintas luciferase reportero. La expresión transitoria demostrado claras distinciones entre TFs después de tres a cuatro días. Sin embargo, la expresión transitoria prolongado más de ocho días (datos no presentados) la reducción de las diferencias entre TFs, lo que sugiere una acumulación de TF a los niveles de proteínas que son capaces de interactuar con una serie de secuencias en un promotor de moda genérica, en lugar de con el objetivo de los promotores que Ser utilizados in vivo. Este comportamiento promiscuo no es sorprendente, teniendo en cuenta la secuencia de conservación en el ADN R2R3 MYB vinculante de dominio [19]. Por lo tanto, es importante señalar que la no específica transeuropeas de activación en los ensayos de transitorios se pueden evitar por optimizar el período de tiempo entre la inoculación y ensayo.

También se encontró que el aumento de la proporción de la carretera TF-que contiene Agrobacterium para el promotor-LUC-REN de fusión contiene Agrobacterium hizo una clara diferencia entre alta y baja fuerza trans-activación. No hemos podido determinar TF interacciones cuando el promotor-LUC fusión comprometido menos del 10% del total de infiltrarse, lo que fue debido a que la correspondiente baja actividad luciferase hecho ratio mediciones más variable.

Había importantes trans-activación de las similitudes entre la mayoría de estos promotores CHS; especialmente MdMYB22 [GenBank: DQ074470 ] Fue el más fuerte en TF transeuropeas de la activación de LUC en tres de los promotores de la prueba CHS: Arabidopsis (Fig. 4A], Petunia (Fig. 4D] y Apple (Fig. 4B]. MdMYB22 tiene homología de secuencia de genes del maíz P [GenBank: M73029 ] Y AtMYB12 [AT2G47460], que se ha demostrado que la regulación de genes implicados en la biosíntesis de flavanol vía [20]. Además MdMYB18 [GenBank: DQ074466 ] Hasta reguladas LUC cuando fusionó a la Pea CHS-1a promotor (Fig. 4C].

Para cada promotor probado hubo una distribución de los antecedentes transeuropeas de activación, que se podría distinguir de un promotor de la interacción de la distribución de trans-activación (Fig. 5A]. Mediante el examen de la petunia CHS-El promotor de datos parece que hay tres grupos de TFs. Grupo 1 mostró poco o ningún transeuropeas de activación, lo que tomamos para ser el promotor de la actividad de fondo en estas condiciones de ensayo. Grupo 2 mostraron una distribución normal de las actividades muy por encima de antecedentes. Este grupo incluía MdMYB18 [GenBank: DQ074466 ] Y representa la interacción que tomamos de ser pobres o no específicos transeuropeas de activación. Grupo 3, en este caso MdMYB22 [GenBank: DQ074470 ], Es una TF que parece haber una trans-activación del promotor. Ninguno de los MYB TFs manzana fue capaz de activar la trans-dihidro Arabidopsis flavonoides promotor reductasa (TT3, At5g42800) (Fig. 5B], aunque AtMYB-75 (AtPAP1, At1g56650), que es conocido por regular la antocianina vía [21] Fue capaz de trans-activar este promotor de fusión, lo que demuestra aún más que la trans-activación perfil de los promotores de estos CHS se concreta.

Vector para investigar el silenciamiento de ARN

Hemos adaptado el sistema de ensayo transitorios con el fin de medir los efectos sobre el silenciamiento de ARN de la estructura de la horquilla dsRNA y la influencia de silenciar suppressers. Estamos especialmente interesados en determinar el papel que podría desempeñar el procesamiento del ARN en dsRNA producción eficiente, y si la presencia de intrones dentro de la horquilla casetes puede mejorar la eficiencia del silenciamiento de ARN de activación [22]. Nuestro sistema de ensayo silenciamiento de ARN consiste en la LUC y REN luciferase genes reportero en el frente de orientación en una sola T-ADN, cada uno de ellos en virtud de la regulación de la transcripción del promotor 35S (Fig. 6A]. Entre los dos genes es un reportero LUC horquilla secuencia (hpLUC), bajo el control de la nopaline sintasa (NOS) promotor. A falta de un NOS-hpLUC horquilla tanto la LUC y REN actividades acumulado (Fig. 6B].

Para probar la eficiencia del silenciamiento y transitorio para cuantificar el efecto de que un intrón tiene sobre este eficiencia, que construyó dos construcciones: pGreenII 0800-3.6 (+) y pGreenII 0800-3.6 (-), cada uno incluyendo un intrón en cualquiera de los dos splicable (+ ) O inversa (-) orientación de la horquilla (Fig. 6B]. Tanto la NOS-hpLUC casetes fueron eficaces en la reducción significativa del nivel de actividad LUC (Fig. 6B]. Esta reducción en la actividad LUC fue el resultado de la activación de silenciamiento de ARN debido a que la co-expresión de la infiltración de Agrobacterium P19, un supresor de genes virales silenciar [5], fue eficaz en la superación del efecto de silenciar a la LUC horquilla, y el restablecimiento de los niveles LUC A los del control (Fig. 6C].

En particular, el nivel relativo de LUC en la horquilla que figura la construcción de un edificio funcional, splicable intrón fue menor (0,0171 ± 0,0014) equivalente a más de la cinta de donde fue el intrón en una orientación invertida (0,0394 ± 0,0099) tal que no se puede procesar. Esta observación parece ser consistente con informes anteriores [22], que mostró un aumento en el porcentaje de plantas transgénicas con un silenciamiento génico fenotipo cuando el dsRNA horquilla construye contenía un intrón. Sin embargo, en estas pruebas los niveles absolutos de LUC fueron muy similares para ambos horquilla construcciones, y la diferencia de nivel relativo luciferase también puede alcanzarse mediante la elevación de los niveles de REN en la que figura la construcción de la splicable intrón. Como la NOS-hpLUC cassette y el 35S-REN casetes están a la par, es posible que el promotor NOS o la tramitación de la intrón está influyendo en la actividad transcripcional del gen REN. Para probar esta posibilidad hemos construido y ensayaron otros dos construcciones, pGreenII 0800-3.1 (+) y (-) (Fig. 6B]. En estas construcciones de la NOS-hpLUC dirige la transcripción de casetes en la orientación opuesta a la de pGreenII 0800-3.6, de manera que cualquier cis-activación de la NOS casete debe influir 35S-LUC actividad, pero no 35S-REN actividad. En transitoria de las construcciones de uso de estos ensayos no hubo diferencias significativas entre la horquilla splicable con un intrón (0,0492 ± 0,0032) y el equivalente construir invertida con un intrón (0,0504 ± 0,0029). Esto sugiere que incluye un intrón en la construcción de un cassette que genera un dsRNA horquilla pueden funcionar para influir en la expresión de genes de cualquier tándem abajo. En el caso de la pHannibal vector, [13] esto correspondería a la kanamicina NptII de genes de resistencia, utilizados para la transformación de selección. Esto sugiere que el mayor porcentaje de silenciar descrito por Smith et al [22] quizás se deba en parte a una mayor recuperación de la estabilidad o transgénicos a través de la mejora de las líneas de expresión de la kanamicina selección de genes. No se pudo identificar mediante RT-PCR, ARN cualquier especie que representa un híbrido entre la ARN NOS promotor y, o bien la LUC o REN gen, lo que sugiere que el tratamiento caso podrán actuar como transcripcional efecto potenciador en lugar de la iniciación de la transcripción a un Distancia.

Medición de la supresión de ARN viral en el silenciamiento
Conclusión

Hemos presentado un método simple usando la expresión transitoria de los genes en el consumo de tabaco a prueba de una serie de funciones de los genes. Vectores También se han elaborado para excluir a la transformación de selección de los genes presentes en muchos vectores binarios. Extracción de la transformación selección plásmido reducido tamaño y la clonación con fines de mejora de la eficiencia. Nos describe un método para caracterizar la actividad enzimática de las proteínas codificadas por estos genes clonados en vectores de Agrobacterium, un método para seleccionar a la relativa transcripcional de TFs actividades, y un método de estudio a través de dsRNA silenciamiento génico. Al incorporar tanto luciferase y renilla quimioluminiscente reportero genes en una sola T-ADN que son capaces de reducir de forma efectiva la variabilidad intrínseca de la hoja de infiltración, lo que permite reproducir determinaciones de la actividad promotora.

Materiales y métodos

Nicotiana benthamiana plantas cultivadas en un invernadero a 22 ° C y la utilización de la luz natural con la luz del día la ampliación a 16 h. Las plantas se cultivan hasta que tenía seis hojas y las hojas más jóvenes de más de 1 cm de largo se infiltró con Agrobacterium y mantenerse en el invernadero para la duración del experimento.

Agrobacterium tumefaciens, GV3101 (MP90) [25] se cultivaron en agar Lennox (Invitrogen) complementado con 50 μ g.ml -1 kanamicina (Sigma) y se incuba a 28 ° C. Un 10 μ l bucle de confluente bacteria se re-suspendió en 10 ml de la infiltración de los medios de comunicación (10 mM MgCl 2, 0,5 μ M acetosyringone), a un OD 600 de 0,2, y incubados a temperatura ambiente sin agitación durante 2 h antes de la infiltración. Infiltraciones se realizaron según los métodos de Voinnet et al. (2003) [5]. Aproximadamente 300 μ l de esta mezcla Agrobacterium se infiltró en una hoja joven de N. Benthamiana y fue ensayada expresión transitoria de tres a 14 días después de la inoculación.

Cada uno de los promotores-LUC fusiones en pGreenII 0800-LUC fueron utilizados en la transformación transitoria mediante la mezcla de 100 μ l de Agrobacterium transformado con el reportero de cassette y 900 μ l de una segunda cepa de Agrobacterium transformado con un casete que contenía el gen TF fundido a la promotor 35S En tanto un pART27 derivados o pGreenII-62-SK binario de vectores se describe a continuación.

Oligonucleótidos

RPH-138: GTGAGAGGTCCTAAGCTTATGTCCGGTTAT; RPH-139: CTTGACTGGCGAGAATTCCCACGATCTCTTT; RPH-140: ATTGACAAGGATGGATCCCTACATTCTGGA; RPH-141: CACGATCTCTTTTTCCGTCATCGTCT; RPH-146: TGGCCTTTATGAGGGAATTCCTGATTTTTC; RPH-179: TGGCGGTTTTGGTACCCCGGGTCAAC; RPH-180: CCATCACCATGGTAGTATACACCAAC; RPH-198: CACACAGTTGGGAGGAGTTGCTGTCCC; RPH - 199: CTTGCGAACTTCTTCGACGGTCACCAT; RPH-212: AATTGGTACCGATATCGAGCTC; RPH-213: AGCTGAGCTCGATATCGGTACC; RPH-332: ACTCCTCGACTGTCACCATGGTTGCTTG; RPH-333: GCGGAAGGGTACCGAATTCATAGCAACTGG

Construcción de pGreenII-62-SK

El virus del mosaico del coliflor (CaMV) 35S expresión cassette (KpnI KpnI-BglII BglII), de pJIT-62 [26], fue insertado en el sitio de clonación múltiple (MCS) (KpnI KpnI-BamHI BamHI), de pGreenII-0000 [24]. De las secuencias de acompañamiento a la LB-35S y del promotor CaMV-terminator a la RB se suprimieron por la digestión, (StuI StuI-KpnI KpnI y SpeI SpeI-HpaI HpaI respectivamente), pol T4 y volver a la ligadura de producir pGreenII-62 -1. El pUC9 MCS se convirtió a la supervisión, control y vigilancia por pBluescript ligar dos oligonucleótidos (RPH-212 y RPH-213) a la EcoRI HindIII EcoRI HindIII corte-vector, la generación de KpnI KpnI y SacI SacI sitios, y luego se inserta un KpnI KpnI-SacI SacI fragmento de PBluescript SKII + (Stratagene).

La construcción de los plásmidos que contienen genes de las enzimas y los TFs

La manzana HortResearch EST bibliotecas se construyeron ni en el Lambda ZAP Express o el Lambda ZAP sistemas de vectores II (Stratagene), lo que resulta en ADNc clonado unidirectionally como EcoRI EcoRI-XhoI XhoI fragmentos en pBK-CMV o pBluescript SK -, respectivamente.

Genes que codifican las enzimas y los diversos factores de transcripción fueron clonados a una de las dos planta de vectores de expresión derivados de la pART7/27 sistema binario de vectores [27]. Ambos vectores de la misma regulador transcripcional de señales para la expresión de genes de plantas, es decir, el promotor CaMV35S y octopine sintasa terminador. El T-ADN frontera elementos, quimérico kanamicina marcador seleccionable y vector columna vertebral son idénticas en los dos vectores. Los dos derivados difieren en que uno es adecuado para convencionales enzima de la restricción de la clonación con fines de ADNc mientras que el segundo facilita Gateway recombinación de la clonación con fines de ADNc.

Con el fin de mejorar la compatibilidad de los sitios de restricción en el sitio de clonación múltiple pART7 con los de la pBK-CMV o pBluescript SK - EST biblioteca vectores, la XhoI XhoI-XbaI XbaI región de pART7 fue sustituido por el SalI SalI-XbaI XbaI múltiples Sitio de clonación región pBK-CMV, la generación de pSAK7. ADNc de la EST bibliotecas fueron clonados en pSAK7 ya sea como EcoR1 EcoR1-XhoI XhoI o BamHI BamHI-XhoI XhoI fragmentos, colocándolos bajo el control transcripcional del promotor CaMV 35S. El 35S-cDNA-ocs3 ocs3 'cassette fue clonado como Not1 Not1 fragmento en pART27, para generar la construcción de la expresión de genes de plantas.

En caso de que la clonación es convencional más problemática, debido a la falta de lugares adecuados de restricción, un Gateway-versión adaptada de la planta de transformación pART7/27 sistema fue utilizado. Esta versión adaptada Gateway-fue producido por clonación el promotor CaMV35S, múltiples clonación sitio y octopine sintasa terminador transcripcional cassette de pART7 como un fragmento NotI NotI en pART27. Posteriormente, el 1711 bp Gateway RfA cassette (Invitrogen Corp) fue clonado en el sitio SmaI SmaI de los múltiples sitios de clonación para generar pHEX2 (35S-attR1 attR1 Cm-R - ccdB ccdB-attR2 attR2-ocs3 ocs3 '). ADNc de la EST bibliotecas fueron clonados en pHEX2 Gateway usando tecnología de recombinación y todos Gateway reacciones se realizaron a lo recomendado por el fabricante (Invitrogen Corp). ADNc fueron amplificados utilizando primers universales destinadas a la clonación sitio múltiples regiones del pBK-CMV o pBluescript SK -. Los primers utilizados para pBluescript SK-5-clones se GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCCGGGCTGCAGGAATTC-3 'y 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCCGGGCCCCCCCTCGAG-3' y de los primers utilizados para pBK-CMV clones fueron 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGACACTAGTGGATCCAAAGAATTC-3 'y 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCGCTCTAGAAGTACTCTCGAG-3'

Amplificación con los primers estos resultados en los productos de PCR con attB attB extremos que se recombinó con el attP attP sitios de la puerta de enlace pDONR201 vector, la creación de pENTRY vectores. Todos los clones fueron pENTRY vector secuencia verificada para garantizar la fidelidad de la secuencia de cDNA. Gateway attP attP × attR attR reacciones fueron llevadas a cabo con el pENTRY vector y el vector pHEX2 de destino, para generar la construcción de la expresión de genes de plantas.

Enzimas de expresión plásmidos. La manzana de cDNA clon MdC4H1 [GenBank: DQ075002 ] Se inserta en pGreenII 62-SK como EcoRI EcoRI-XhoI fragmento XhoI. Los genes de L-galactosa deshidrogenasa [GenBank: AY176585 ] Y L-galactosa-1-P fosfatasa [GenBank: AY787585 ] De los kiwis fueron clonados a lo descrito previamente [18] y transformarse en Agrobacterium utilizando métodos estándar.

Construcción de pGreenII 0800-LUC

El gen reportero Renilla pRL nulo (Promega, Madison, WI) se ha modificado para eliminar los mamíferos 5'UTR intrón por digestión con NheI NheI-SpeI SpeI, T4 Pol, seguido de la ligadura de nuevo. Este gen se inserta en el cassette de expresión p35S-2 [24], y las secuencias de acompañamiento como suprimido anteriormente. Este cassette se inserta en la HpaI HpaI sitio pGreenII de 0000, para producir pGreen 0800-1. A 35S-LUC-cassette de expresión se inserta en pGreenII 0800 para producir pGreenII 0800-35S-LUC. La secuencia de acompañamiento entre el terminador CaMV y el presupuesto ordinario se ha eliminado (SpeI SpeI-StuI StuI, T4 pol, ligadura). Por último, la supervisión, control y vigilancia pBluescript sustituirá el promotor 35S para producir pGreenII 0800-LUC. Estos vectores son disponibles bajo petición.

Promotor clonación en pGreenII 0800-LUC

Un 0,97 kb región de la Arabidopsis CHS promotor (At5g13930) fue amplificado por PCR a partir de la Arabidopsis ecotipo Columbia utilizando los primers RPH-179 y RPH-180, y luego digiere con KpnI KpnI y NcoI NcoI y clonados en la supervisión, control y vigilancia de pGreenII 0800-LUC . El 1,04 kb guisante CHS-1a promotor [GenBank: X80007 ] Fue subcloned en pGreenII 0800-LUC como EcoRI NcoI EcoRI-NcoI fragmento [28]. Un 0,92 kb Petunia CHS-Un promotor [GenBank: X14591 ] Fue amplificado por PCR usando primers RPH-332 y RPH-333 de un V26 ADN genómico, digeridos con KpnI KpnI y NcoI NcoI y clonado en pGreenII 0800-LUC. El 1,3 kb CHS1 promotor Apple [GenBank: DQ022678 ] Fue aislado de Malus domestica Royal Gala, utilizando el kit de Genoma Walker (Clonetech) con primers específicos de genes RPH-198 y RPH-199, luego clonado en pGEM T-fácil (Promega) y como subcloned SalI SalI-NcoI fragmento en NcoI PGreenII 0800-LUC. Pwo-polimerasa (Roche) se usó PCR para todas las amplificaciones y genes clonados fueron secuenciados para confirmar la secuencia de modificaciones no fueron incorporadas.

Construcción de HP-cassette

A corto horquilla asimétrica fue construido por la amplificación de una región del gen LUC: primers RPH-138 y RPH-146 se utilizaron para ampliar un fragmento de 454 pb introduciendo un HindIII EcoRI HindIII EcoRI sitio y cerca de la final de la PCR producto. El segundo producto de PCR correspondiente a la región antisentido de la horquilla 283 pb fue un producto de amplificación de PCR usando primers RPH-140 y RPH-139. El primer ejemplo, RPH-140, era de la misma región que RPH-138, pero presentó un BamHI BamHI sitio cerca del final de la PCR producto. RPH-139 está más cerca de 142 bp RPH-138 y RPH-140 que RPH146, y también presentó una EcoRI EcoRI sitio cerca del final del producto amplificado. Los productos de PCR fueron digeridos con las enzimas de restricción y PCR digeridos estos dos productos se utilizan en una de 3 vías a la ligadura HindIII HindIII-BamHI BamHI cortar pNOS-7 [24] para producir la NOS-hpLUC cassette. Este NOS-hpLUC fue modificada para sustituir el bucle región con un intrón amplificando la NOS-hpLUC primer cassette con RPH-141, comunes a ambos el sentido y antisentido región, con pwo-polimerasa. Una secuencia de un intrón kiwis terpeno sintasa genes [GenBank: DQ026298 ] También fue amplificado con los primers RPH-099 y RPH-100. El intrón producto de amplificación fue tratado con polinucleótido quinasa (ORC) y se utiliza en una ligadura con la no fosforilados producto de amplificación de la NOS-hpLUC cassette. El resultado casetes o bien contiene un intrón en + ve (RPH-099 a RPH-100 relativo a la NEP promotor) o-ve (RPH-100 a RPH-099 relativo a NOS promotor) de configuración. En consecuencia, el intrón + ve tenía una configuración para splicable GT AG intrón arreglo, la ve-intrón configuración no. El nos hpLUC-cassette y intrón que contiene derivados se insertaron en un LUC-35S, 35S-REN cassette; pGreenII 0800 35S-LUC, como un fragmento EcoRV EcoRV. De esta manera, el reportero de casetes se generó con el intrón que contiene NOS-hpLUC cassette en ambas orientaciones. PGreenII 0800-3.6 NOS promotor tuvo la dirección de la transcripción en la misma orientación que el 35S-REN y hacia el T-ADN Derecho frontera (hacia adelante). PGreenII 0800-3.1 había NOS promotor dirigir la transcripción de la hpLUC en la misma orientación que el 35S-LUC y hacia la izquierda de T-ADN frontera (inversa) (Fig. 6A].

Construcción de pSoup-P19

El ayudante pSoup plásmido [24] se convierte en una T-ADN versión desempeño mediante la inserción de un fragmento BglII BglII que figura el T-ADN de pGreen0000 en el único sitio BamHI BamHI de pSoup crear pSoup0000. A 35S-P19-CaMV fusión fue aislado de pBIN-61-P19 [5] como un SacI SacI-BglII BglII parcial y se insertan en el sitio pSoup0000 múltiples clonación para producir pSoup-P19.

Enzimas de ensayos
Contribuciones de los autores

RPH para el diseño experimental, vector de la construcción, el promotor de aislamiento, la recopilación de datos y preparación manuscrito.

ACA y WAL factor de transcripción para la minería, el análisis de datos y preparación manuscrito.

ENF EMD y de la minería, la enzima de análisis, recopilación de datos y preparación manuscrito.

APG vector de la estrategia de diseño, la edición y la secuencia de montaje, preparación manuscrito

SK, KG y KB vector para la construcción y la microbiología.

Agradecimientos

Lesley Beuning de manzana EST bibliotecas, Ross Crowhurst de Bioinformática, Robin M. MacDiarmid y Ralf Dietzgen de asistencia con el reportero PTGS construir y útil para los comentarios sobre el manuscrito, Denis Lauren y Wendy Smith para algunos de análisis HPLC y Julie Nicholls para mantener N . Benthamiana plantas.