BMC Cell Biology, 2006; 7: 1-1 (más artículos en esta revista)

Pim quinasas phosphorylate múltiples sitios en Bad y promover 14-3-3 vinculante y disociación de Bcl-X L

BioMed Central
Andrew Macdonald (a.macdonald @ dundee.ac.uk) [1], David G Campbell (dgcampbell@dundee.ac.uk) [1], Rachel Toth (r.toth @ dundee.ac.uk) [1], Hilary McLauchlan (hjmclauchlan@dundee.ac.uk) [2], C James Hastie (cjhastie@dundee.ac.uk) [2], Simon J Arthur C (jscarthur@dundee.ac.uk) [1]
[1] Unidad MRC de fosforilación de proteínas, de la Escuela de Ciencias de la Vida, de la Universidad de Dundee, Dundee, DD1 5EH, UK
[2] Signal Transduction División de Terapia de la Facultad de Ciencias de la Vida, de la Universidad de Dundee, Dundee, DD1 5EH, UK

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen
Antecedentes

Pim-1, 2 y 3 son un grupo de enzimas relacionadas con el calcio calmodulina familia de las proteínas quinasas. La sobreexpresión de la Pim-1 y Pim-2 en ratones promueve el desarrollo de linfomas, y sobre regulación de Pim expresión se ha observado en varios cánceres humanos.

Resultados

Aquí nos muestran que el pim quinasas son constitutivamente activa cuando se expresa en células HEK-293 y son capaces de phosphorylate la Bcl-2 Bad miembro de la familia en tres residuos, Ser112, Ser136 y Ser155 in vitro y en células. In vitro mostraron que la cartografía Pim -2 Predominantemente fosforilados Ser112, mientras Pim-1 fosforilados Ser112, sino también Ser136 y Ser155 a un precio reducido en comparación con Ser112. Pim-3 resultó ser el menos específico de Ser112, y la más eficaz en fosforilantes Ser136 y Ser155. Pim-3 también pudo phosphorylate otros sitios en Bad in vitro, incluyendo Ser170, otro potencial sitio in vivo. Mutación de Ser136 alanina impedido a la fosforilación de Ser112 y Ser155 por Pim quinasas en células HEK-293, lo que indica que este sitio debe ser fosforilados primero a fin de que los otros sitios accesibles. Pim fosforilación de Bad También se encontró para promover la unión de Bad 14-3-3 y bloquear su asociación con Bcl-X L.

Conclusión

Los tres miembros de la familia Pim quinasa predominantemente phosphorylate Bad sobre Ser112 y además son capaces de Bad fosforilantes en múltiples sitios asociados a la inhibición de la función pro-apoptótica de Bad en células HEK-293. Esto sería coherente con la función propuesta de Pim quinasas en la promoción de la prevención de la proliferación celular y la muerte celular.

Antecedentes

Pim-1, 2 y 3 conforman un grupo de mamíferos estrechamente relacionados con la serina / threonine quinasas que forman parte de la calmodulina dependiente de la proteína quinasa familia [1, 2]. Pim-1 se identificó por primera vez como un gen oncogénico en murino linfomas de células T, que se convirtió después de activarse a favor de la inserción viral en el 3'UTR de los genes Pim-1 [3]. Inserción en esta región se estabilizó el ARNm para Pim-1-por lo tanto, hasta la regulación de la proteína [4]. El exceso de expresión del gen Pim-1 y B en las células T en ratones transgénicos dado lugar a un alto nivel de desarrollo de linfoma en estos ratones, lo que confirma la oncogénico propiedades de esta proteína [5, 6]. Un segundo gen relacionados, Pim-2, también fue identificado como un sitio común de inserción viral en linfomas murinas [7]. Al igual que Pim-1 la sobre expresión de Pim-2 en ratones transgénicos predispone a los ratones con el desarrollo de linfoma [8]. El mecanismo preciso por el que Pim-1 y 2 de promover la formación de los linfomas no se conoce del todo, sin embargo, se ha sugerido que Pim-1 synergises con c-myc en este proceso [8 - 10]. Pim-1 también parece ser importante en el desarrollo de cánceres humanos, como el Pim-1 mapas de genes a una zona que muestra cariotípica anomalías en la leucemia, y el ARNm de Pim-1 ha demostrado ser hasta reguladas en el cáncer de próstata y Leucemia [11 - 13]. Una tercera isoforma, Pim-3, que es 72% idéntica a Pim-1 también existe en células de mamífero, aunque la oncogénico propiedades de esta proteína están menos estudiados. Pim-3 ha sido recientemente demostrado ser regulada hasta Ewing en líneas celulares tumorales, transcripcional es un objetivo para el sistema de alerta temprana factores de transcripción oncogénicos y es capaz de promover el anclaje independiente de crecimiento de las células en cultivo de tejidos modelos [14]. Recientemente, la sobre expresión de Pim-3 se ha demostrado en un modelo murino de carcinoma hepatocelular, aunque el papel funcional de Pim-3 no se determinó [15].

Varios sustratos se han sugerido para Pim-1 incluida mdm2 [16], p21 [17], fosfatasa cdc25 [18] y c-myb [19], todas las proteínas implicadas en el control del ciclo celular. Pim-2 ha informado de mantener la fosforilación de la traducción represor 4EBP-1 y para phosphorylate y inactivar la proteína pro-apoptótica Bad sobre Ser112 [20, 21]. Pim-1 también se ha notificado que puede hacer phosphorylate Bad Ser112 en [22], sin embargo la capacidad de Pim-3 a phosphorylate Bad es desconocida. Ambos-1 Pim Pim-2 y, por tanto, parecen actuar como la supervivencia o la proliferación de señales en vivo. En consonancia con esta expresión Pim-1 se ha demostrado que promover el crecimiento independiente de citoquinas de las células haematopoetic [23, 24]. En cambio, se sabe menos acerca de los sustratos de Pim-3, y su función en vivo en gran parte aún es poco clara.

Bad es un pro-apoptóticos miembro de la familia de proteínas BH3. Bad activa induce la apoptosis por medio de la unión de anti-apoptótica Bcl-2, como los miembros de la familia Bcl-X L. Esto permite que otras proteínas pro-apoptóticos como BAX y BAK para agregar, que induce la liberación del citocromo C de la mitocondria y la activación de la caspasa (revisado en [25]]. La actividad de Bad es reprimida por fosforilación, y tres de los residuos (Ser112, Ser136 y Ser155) han sido identificados como el predominante en vivo sitios de fosforilación. Además de Pim-2 varias quinasas han sido identificados como posibles para Bad quinasas, incluidos PKB [26 - 28], República de la Krajina Serbia [29, 30], [31] PAK, p70S6K [32] y PKA [33 - 35]. Parece probable que varias quinasas Mayo phosphorylate Bad en estos sitios in vivo, en función del tipo de células y de la situación. En consonancia con esto, varias de las propuestas quinasas phosphorylate preferentemente una o dos de los tres sitios en Bad. Por ejemplo, la República de la Krajina Serbia fosforila in vitro Ser112 y, en menor medida, Ser155, mientras PKB fosforila Ser136 y preferentemente PKA fosforila Ser155 [33]. Además de estos sitios de fosforilación, una quinasa no identificado se ha demostrado que inhiben la apoptosis por fosforilantes Bad sobre Ser170 [36]. Por el contrario, la fosforilación por Cdc2 de Ser128 en Bad se encontró para promover la actividad de Bad apoptosis [37].

En este trabajo se analiza la especificidad de Pim-1, 2 y 3 de la Ser112, 136 y 155 sitios de fosforilación de Bad, tanto in vitro como en células HEK-293.

Resultados
Pim quinasas phosphorylate Bad en tres sitios in vitro

El mal se ha descrito anteriormente a ser fosforilados en tres sitios, Ser112, Ser136 y Ser155 in vivo. Péptidos de todo estos lugares fueron utilizados como sustratos para purificada Pim-1, 2 o 3 en ensayos in vitro quinasa. Los tres se encontraron Pim quinasas phosphorylate a la Ser112 péptido de manera eficiente (fig. 1A-C]. En cambio la Ser136 y Ser155 péptidos son mucho menos eficaces para los sustratos-1 y Pim Pim-3 (Fig 1A y 1C] y sustratos muy pobres para Pim-2 (Figura 1B]. Como fosforilación de péptidos sintéticos no siempre dan un reflejo fiel de una capacidad de quinasas phosphorylate el sitio correspondiente en una proteína, la capacidad de Pim quinasas a phosphorylate Bad proteína recombinante fue también examinado. Como era de esperar se Bad fosforilados por las tres Pim quinasas, con un máximo de fosforilación se producen en los primeros 5 a 10 minutos (Fig 1D-F]. Esta actividad se debió a la quinasa Pim, como incubación de la proteína Bad en ausencia de Pim (Fig DF), o con quinasa Pim muertos (datos no presentados), no dio lugar a ninguna incorporación de 32 P en Bad. Para determinar los sitios fosforilados por Pim-1, 2 o 3, Bad recombinante se fosforilados con 32 P etiquetados ATP y digerido con tripsina. Péptidos fueron resueltas por HPLC en fase inversa y ms / ms utilizado para identificar el fosfato péptidos eluidos (datos no presentados). La posición del fosfato en cada péptido fue confirmado también por la secuencia de reacciones en fase sólida y la medición de la radiactividad ciclo en el que fue puesto en libertad. Pim-1 fosforilados 4 grandes péptidos en Bad, designado P1, P2 P3 y P4 (Figura 2A]. Peak P1 se encontró que corresponden a fosfato Ser155, P2 a Ser136 mientras tanto P3 y P4 corresponden a fosfato Ser112 (Tabla 1]. Los diferentes tiempos de elución de los péptidos Ser112 es probablemente explica por diferentes estados de oxidación de la metionina de residuos en el péptido. Análisis de la cpm en cada pico Ser112 demostró que era el sitio más fosforilados por Pim-1, con aproximadamente 7 veces el nivel de fosforilación que se produjeron en cualquiera de Ser136 o Ser155. Esto es coherente con lo que se encuentra por la tasa de fosforilación de los péptidos sintéticos para cada sitio (Figura 1A]. Pim-2 se encontró a phosphorylate dos grandes picos que eluyen en una posición idéntica a la P3 y P4 picos en el Pim-1 fosforilados Bad (Figura 2B]. Ms / ms análisis confirmaron que estos péptidos también correspondió a Bad fosforilados en Ser112. Los pequeños picos, también se observó que corresponde a P1 y P2 en la Pim-2 fosforilados Bad HPLC rastrear, y se confirmaron a estas corresponden a fosfato Ser155 y Ser136. La cantidad de fosfato incorporado en estos lugares fue de 15 veces menor que en Ser112 (Tabla 1].

Pim-3 fosforilados Bad también dio picos correspondientes a P1, P2, P3 y P4, y de nuevo estos se confirmaron como Ser112, Ser136 y Ser155 por ms / ms y secuencia de fase sólida (Figura 2C y 2D]. De los tres quinasas Pim-3 dio la más alta de la fosforilación Ser136 y Ser155 en comparación con Ser112 en Bad (Tabla 1]. Cinco más pequeños picos fosfato péptido (P5-9), también se observaron en el HPLC cuando Pim-3 fue utilizada para phosphorylate Bad. Estos sitios, sin embargo, no fueron significativamente fosforilados por Pim-1 o Pim-2. P5 se observó en el flujo a través de la columna y péptidos en esta fracción no se identificó por espectrometría de masas. Mala predicción de la secuencia muestra que digerir tríptico daría 2 pequeños péptidos que contienen serina o threonine que podría haber sido fosforilados. Phosphopeptides de P9 tampoco con éxito identificados por espectrometría de masas. P7 fue identificado como el péptido AATNSHHGGAGAMETR (residuos de 92 a 107 de Bad) con 1 grupo fosfato. Ms / ms análisis sugirió que se trataba de una mezcla de fosforilación de Thr94 o bien Ser96. Fase sólida secuenciación confirmó este resultado, y también sugirió que Ser96, el predominante fue el sitio (Figura 2D]. P6 y P8 fueron identificados por espectrometría de masa como SAGTATQMR (residuos de 170 a 178 en Bad) fosforilados en Ser170. La fosforilación de Ser170 se confirmó en fase sólida para la secuenciación de ambos P6 y P8. Sorprendentemente, en fase sólida secuencia también mostró que P8 en el 4 º de residuos en el péptido fue también fosforilados, lo que sugiere que Thr 173 también pueden ser fosforilados por Pim-3.

Pim quinasas son constitutivamente activa en células HEK-293 y phosphorylate Bad sobre Ser112, 136 y 155

Para examinar la regulación de Pim-1, 2 y 3 en las células, FLAG etiquetados Pim quinasas se expresaron en HEK-293 células por transfección transitoria. Los niveles endógenos de Pim-1, 2 o 3 no puede ser detectada en las células HEK-293 con los anticuerpos disponibles. Después de suero inanición de las células así tratadas con diferentes estímulos y de la actividad de las quinasas Pim determinarán después de immunoprecipitation con un anticuerpo anti-FLAG. Los tres de las quinasas Pim resultaron ser activos en el suero de hambre células, y su actividad no se incrementó mucho más por estimulación de las células con las señales de mitógenos (PMA o IGF), el estrés celular (anisomycin, sorbitol, la radiación UV-C o peróxido de hidrógeno ) O AICar, un activador de la AMPK (Fig 3A].

GST-Bad expresadas por transfección transitoria de suero de hambre HEK-293 células, en ausencia de la co-expresión de cualquier quinasa, resultó ser fosforilados en Ser136, fresa no Ser112 o Ser155, como juzgados por inmunotransferencia utilizando anticuerpos específicos para el Diversos sitios de fosforilación. De acuerdo con estudios anteriores [33], la estimulación de las células con PMA dio lugar a un pequeño aumento de la fosforilación Ser112 mientras forskolin dado lugar a aumentos en Ser155 fosforilación y, en menor medida, Ser136 (Fig 3B]. Co-expresión de Pim-1 y Bad dado lugar a un aumento de la fosforilación y la fosforilación Ser136 de Ser112 y Ser155, en comparación con Bad expresa en la ausencia de Pim-1. Similares resultados se obtienen también a la co-expresión de Pim Pim-2 o-3, aunque Pim-2 tiene un efecto sobre la reducción de la fosforilación en Bad Ser136 en comparación con el co-expresión con Pim Pim-1 y-3 (Fig 3B]. La fosforilación de Bad por Pim quinasas no se incrementó mucho más por estimulación PMA, aunque Ser155 fosforilación aumentó aún más por estimulación Forskolin. La fosforilación de Bad dependía de la actividad de quinasa quinasas Pim, como co-expresión de la quinasa muertos versiones de Pim-1, 2 o 3 y Bad no resultó en la fosforilación de Bad (Fig. 3C].

La capacidad de Pim-1 a phosphorylate Bad en el que uno de los sitios de fosforilación se había mutado también fue determinada por la co-expresión. Como era de esperar la mutación de alanina Ser112 impedido a la fosforilación de este sitio por Pim-1, pero que no afectan significativamente la fosforilación de una de las Ser136 o Ser155 (Fig 4A]. Del mismo modo, la mutación de Ser155 impedido la fosforilación de este sitio por Pim-1, pero no afectan de manera significativa a la fosforilación de Ser112. Sorprendentemente mutación de alanina a Ser155 fuera la causa de una reducción en el nivel de fosforilación Ser136 por Pim-1 (Fig 4A], y una reducción similar en Ser136 fosforilación también fue visto en Ser112/Ser155Ala mutantes (fig. 4B]. Mutación de Ser136 a alanina no sólo bloquean la fosforilación de Ser136 por Pim-1, pero también muy reducido Ser112 y Ser155 fosforilación (Fig 4A]. Mutación de Ser136 a un residuo de ácido para imitar fosforilación fue capaz de restablecer la fosforilación de Ser112 y Ser155 (Fig 4A].

Efectos similares de los mutantes también se observa en la falta de co-expresó Pim-1, cuando las células fueron estimuladas con agentes para inducir la fosforilación de sitios específicos dentro de Bad. PMA promueve Bad Ser112 fosforilación, probablemente a través de República de la Krajina Serbia, sin embargo esto fue impedido por Ser136 mutación. Forskolin estimulado Ser155 a través de la fosforilación PKA, y esto también fue impedido por la mutación de Ser136 [véase la archivo adicional 1].

Pim promueve 14-3-3 vinculante a través de la fosforilación de Bad Ser136 y disociación de Bcl-X L

Fosforilación de una proteína pueden crear sitios de unión para las proteínas 14-3-3, y Ser112 y 136 en Bad reside en un posible consenso 14-3-3 motivo [38]. Ser155 no reside en un consenso vinculante 14-3-3 motivo, sin embargo in vitro la fosforilación de Bad por PKA (que fosforila predominantemente Ser155) hace 14-3-3 promover la interacción [33]. Para poner a prueba la capacidad de interactuar con Bad 14-3-3, GST-Bad fue co-expresado en células HEK-293 con Pim-1, y la superposición de 14-3-3 ensayos se utilizaron para determinar si podría obligar Bad 14 -- 3-3 proteínas. En la superposición de ensayo, 14-3-3 proteína recombinante se ha utilizado para detectar la presencia de proteínas en un Western blot capaces de unirse 14-3-3. GST-Bad aislados por la glutatión-Sepharosa tirar bajas de la célula lisados se puso a prueba por su capacidad para obligar a 14-3-3. A falta de Pim-1 co-expresión, GST-Bad no fue significativamente fosforilados en Ser112, 136 o 155 y no obligará a 14-3-3 en la superposición de ensayo (Fig 4A y 4C]. Co-expresión de Pim-1 sin embargo resultó en la fosforilación de los tres sitios y promueve la interacción de la GST-Bad 14-3-3 con superposición en el ensayo. Mutación de cualquiera Ser112 o Ser155 a alanina dado lugar a una modesta reducción en la capacidad de la Pim-1 fosforilados GST-Bad interactuar con proteínas 14-3-3 en la superposición de ensayo (Fig. 4C]. Como era de esperar, la mutación de Ser136 de la alanina, que también bloquea la fosforilación de Ser112 y Ser155, completamente bloqueado la capacidad de GST-Bad interactuar con proteínas 14-3-3. Mutación de Ser136 a un residuo de ácido también bloqueó la capacidad de obligar a Bad a proteínas 14-3-3 en la superposición de ensayo, a pesar de Pim-1 era capaz de phosphorylate tanto Ser112 y Ser155 en el Ser136Asp o Ser136Glu Bad mutantes (Fig 4C ). Estos datos sugieren que Ser136 es el principal sitio de unión 14-3-3. En consonancia con ello, un doble mutante de ambos Ser112 y Ser155 a alanina, que se fosforilados en Ser136 (fig. 4B], sigue siendo capaz de interactuar con las proteínas 14-3-3 en la superposición de ensayo (Fig. 4D]. Similar a la Pim-1, cuando Pim Pim-2 o-3 se co-expresada con GST-Bad, también son capaces de promover 14-3-3 obligatorio en la superposición de ensayo (Fig. 4E]. Para probar si Pim quinasas promovido la interacción de Bad 14-3-3 y proteínas en las células, Pim quinasas y GST-Bad fueron co-expresado en células HEK-293 y la GST-Bad aislados por la glutatión-Sepharosa tirar bajadas y borró para La presencia de proteínas endógenas 14-3-3 usando una sartén 14-3-3 isoforma de anticuerpos (Fig. 4F]. A falta de Pim quinasa co-expresión, 14-3-3 proteínas no se detectaron en el GST-Bad pull downs, sin embargo la expresión de Pim-1, 2 o 3 se encontró para promover la unión de 14-3-3 a GST-Bad en células (Fig. 4F]. La capacidad de Pim quinasas para promover la interacción de Bad 14-3-3 y depende de su actividad quinasa, como co-expresión de la quinasa muertos Pim-1, 2 o 3 no vinculante como promover 14-3-3 juzgados por Ya sea co-precipitación o de superposición de los ensayos de 14-3-3 (Figura 4E y 4F].

Fosforilación de Bad se ha demostrado que la prevención de una interacción con Bcl-X L [39]. La capacidad de Pim quinasas para evitar la interacción de GST-Bad endógeno con Bcl-X L se probó en tirar de experimentos. Células HeLa fueron utilizados para estos experimentos ya que estas células expresan niveles detectables endógeno de Bcl-X L.

Como era de esperar, GST-Bad, que no fue significativamente fosforilados en ausencia de co-quinasa expresión, es capaz de interactuar con Bcl-X L en células HeLa. Co-expresión de Pim-1, 2 o 3 resultó en la fosforilación de Bad-GST y la reducción de la interacción de GST-Bad con Bcl-X L. Esto depende de la actividad de quinasa Pim, como co-expresión de la quinasa muertos Pim mutantes no tienen este efecto (Fig. 5A]. Similar a la interacción 14-3-3, Ser136 parece ser el crítico de residuos que participan en este proceso. Mutación de Ser112, Ser155 (Fig. 5B], o ambos Ser112 y Ser155 a alanina (Fig. 5C] en Bad no afectar a la capacidad de Pim-1 para evitar la interacción de GST-Bad y Bcl-X L. Mutación de Ser136 en Bad a alanina (que bloquean la fosforilación de los tres sitios) o un ácido de residuos (que no afecta a Ser112 o Ser155 fosforilación) bloqueó la capacidad de Pim-1 para promover la disociación de GST-Bad y Bcl-X L (Fig. 5B].

Discusión

Pim-1, 2 o 3 se encontraron para poder phosphorylate Bad in vitro y en células. Pim-2 se mostró como el más específico de la Pim quinasas de Ser112 de Bad in vitro, aunque también es capaz de phosphorylate Ser155 tanto in vitro-y cuando más se expresa en las células HEK-293. Pim-2 es un pobre Ser136 kinasa in vitro y, en coherencia con esto, fue el menos eficaz de todas las quinasas Pim fosforilantes en este sitio en las células. De acuerdo con este Pim-2 ha sido descrito previamente a phosphorylate Ser112 [20, 21]. Curiosamente, la fosforilación de Ser136 y Ser155 por la sobre expresión de Pim-2 ha sugerido que se depende de la línea celular utilizada [21]. Los dos resultados anteriores y nuestros resultados sugieren que esto puede reflejar diferentes niveles de expresión de Pim-2 alcanzados en los diferentes tipos de células utilizadas. Pim-1 era capaz de phosphorylate Ser112, Ser136 y Ser155 en Bad, sin embargo fosforilación de Ser112 fue significativamente más eficaz que la fosforilación de otros sitios in vitro. Pim-1 ha sido encontrado a phosphorylate Ser112 en Bad, aunque su capacidad de Bad phosphorylate en otros sitios no ha sido reportado anteriormente [22]. La capacidad de Pim-3 a phosphorylate Bad no ha sido abordado anteriormente. Aquí mostramos que Pim-3 también es capaz de phosphorylate Ser112 en Bad. Curiosamente Pim-3 es el más eficaz kinasa in vitro para Ser136 de Bad. A diferencia de Pim-1 o Pim-2, lo que demuestra una marcada preferencia por Ser112, Pim-3 fue también eficaz en fosforilantes Ser136, y, en menor medida, Ser155, cuando Bad proteína se utilizó como sustrato in vitro (Cuadro 1]. Además Pim-3 también pudo phosphorylate otros sitios incluidos en Bad Ser170 in vitro. Este sitio ha sido informado de que se fosforilados in vivo, aunque la quinasa responsable no fue identificado en el estudio inicial [36]. Mutagénesis de Ser170 en Bad ha sugerido que la fosforilación de este sitio, al igual que la fosforilación de Ser112, 136 y 155, inhibe la actividad pro-apoptótica de Bad [36]. Fosforilación de este sitio por Pim-3, por lo tanto, ser coherente con el favor de la función de supervivencia de Pim-3. Sobre la base de nuestros conocimientos, este estudio es el primero en informar de un Pim-3 sustrato celular.

La interacción entre los sitios de fosforilación de Bad y su papel en Bad función es compleja. Fosforilación de Ser136 parece ser necesaria para la fosforilación de Ser112 y Ser155 que se producen cuando hay un exceso de Bad expresado en las células. Del mismo modo, Ser136 parece ser el principal sitio de unión 14-3-3 en Bad (Fig 4] [38, 40], mientras que Ser155 se sugiere que se requiere para la unión a Bcl-X L [41]. A pesar de ello, la fosforilación de Bad endógeno en Ser136 ha resultado difícil de demostrar in vivo. Esto puede reflejar los pobres sensibilidad de los anticuerpos disponibles, sin embargo también se ha sugerido que este sitio no puede ser fisiológicamente importante [42]. En contraste con esto, los estudios que utilizaron transfectadas Bad han sugerido que la fosforilación de este sitio es esencial para la fosforilación de Ser112 y Ser155 y 14-3-3 vinculantes, que son necesarios para inhibir la actividad de Bad apoptosis [38, 40]. Estudios sobre Ser112 han sugerido que este sitio puede ser un "guardián" del sitio, y que dephosphorylation de este sitio es necesario contratar a un fosfatasa que luego dephosphorylates Ser136 y Ser155 [43]. Una extensión de esta idea de llevar a la propuesta de que Pim-1 sólo fosforila directamente Ser112, y que un aumento de la fosforilación Ser136 cuando Pim-1 se expresó sobre-se debió a una disminución en la tasa de Ser136 dephosphorylation [22]. Si bien esto no puede excluirse por completo, no es compatible con nuestros datos que Pim-1 puede promover la fosforilación de un Ser112Ala Bad mutantes en las células. La interacción entre los diferentes sitios de fosforilación de Bad es muy complejo y por lo tanto, aún es necesario comprender completamente estos mecanismos. Un añadido grado de complejidad es el número de quinasas de Bad fisiológicas, incluyendo Pim-1-3, PKB, PAK, República de la Krajina Serbia, PKA [26 - 35] y, posiblemente, otras quinasas potencialmente jugar un papel. El contexto exacto en el que Bad Pim fosforila in vivo pueden, por tanto, dependen de ambos tipo de células y de estímulo y aún no se ha comprendido plenamente.

La capacidad de Pim quinasas a phosphorylate Bad es coherente con la propuesta de la función de estos quinasas en pro o la proliferación de las vías de supervivencia. El hallazgo de que los tres Pim cinasas pueden phosphorylate sitios similares en Bad podría explicar en parte la redundancia entre Pim quinasas celulares para proporcionar una señal de supervivencia. Las eliminatorias de Pim quinasa podría, por lo tanto, se espera contar con un fenotipo grave, sin embargo un triple de knockout Pim-1, 2 y 3 ha sido recientemente denunciados. Sorprendentemente estos ratones resultaron ser viable, y si bien se más pequeñas en tamaño que los ratones de tipo salvaje que no mostró evidentes problemas de salud [44]. Sin embargo, estos ratones muestran la reducción de la proliferación de algunas células hematopoyéticas en respuesta a factores de crecimiento. Curiosamente, una triple mutación de Bad knockin (como resultado de la mutación de la Ser112, 136 y 155 a alanina) en ratones también fue encontrado para ser viables y no mostraron un aumento de los niveles de apoptosis en los tejidos en condiciones normales [45]. Estos ratones también muestran menor número de células T y B, y la reducción inducida por citoquinas supervivencia de estas células in vitro, un fenotipo con alguna similitud a la de la triple Pim quinasa knockout.

Conclusión

Presentamos aquí las pruebas bioquímicas que las tres isoformas de Pim cinasa son capaces de phosphorylate Bad. El principal sitio de Bad fosforilación de las tres isoformas de Pim quinasa es Ser112. Sin embargo, también demuestran que Pim quinasas son capaces de phosphorylate Bad, en menor medida, sobre Ser136 y Ser155 in vitro. Curiosamente Pim-3 exposiciones menos especificidad para Ser112 que-1 o Pim Pim-2, y fue la más eficaz para la isoforma pim Ser136 y Ser155 en Bad fosforilación in vitro. También tenemos pruebas de que Pim quinasas puede modular la fosforilación de Bad sobre Ser112, Ser136 y Ser155 en células HEK-293.

Métodos
Plásmidos

La codificación de una región amino-terminal versión ampliada de la Pim-1 (NCBI Acc. NM_002648) predice que sea sintetizada por la traducción alternativa inicio a un codon CUG aguas arriba [46] se amplificó de IMAGEN consorcio EST 4591723 clon usando primers 5'- Gcgaattcgccaccatggactacaaggacgacgatgacaagctgccgcacgagccccacgag gcgaattcgccaccatggactacaaggacgacgatgacaagctgccgcacgagccccacgag gcgaattcgccaccatggactacaaggacgacgatgacaagctgccgcacgagccccacgag-3 'la incorporación de un 5' BANDERA etiqueta secuencia y primer 5'-gcgaattcctatttgctgggccccggcgac-3 '. El producto de PCR fue ligated en pCR2.1 vector-TOPO (Invitrogen), secuenciado, clonado y sub-como EcoR1 EcoR1-EcoR1 EcoR1 insertar en la pCMV5 vector de expresión [47]. La misma región fue de codificación clonado en el vector de expresión pEBG2T [48] sin el 5 'BANDERA etiqueta de secuencias utilizando los primers como Spe1 Spe1-Spe1 Spe1 insertar. La codificación de una región amino-terminal versión ampliada de la Pim-2 (NCBI Acc. NM_006875.2) predice que sea sintetizada por la traducción alternativa inicio a un CUG aguas arriba del codón se amplificó IMAGEN consorcio EST 3913552 clon usando primers 5'-gcgaattcgccaccatggactacaaggacgacgatgacaagctggcgcgcgcggcgaatctcaac Gcgaattcgccaccatggactacaaggacgacgatgacaagctggcgcgcgcggcgaatctcaac gcgaattcgccaccatggactacaaggacgacgatgacaagctggcgcgcgcggcgaatctcaac-3 'la incorporación de un 5' BANDERA etiqueta secuencia y primer 5'-gcggatccttagggtagcaaggaccaggccaaag-3 '. El producto de PCR fue ligated en pCR2.1-TOPO vector, secuenciado, clonado y sub-como EcoR1 EcoR1-BamH1 BamH1 insertar en el vector de expresión pCMV5. La misma región fue de codificación clonado en el vector de expresión sin pEBG2T el 5 'BANDERA etiqueta de secuencias utilizando los primers como BamH1 BamH1-Not1 Not1 insertar. 125-1455 nucleótidos (codón de parada de CDS), de murino Pim-3 (NCBI Acc. NM_145478) mRNA fueron amplificados de IMAGEN consorcio EST 4924687 clon usando primers 5'-gcgaattcgagcgtccggcttccccag-3 'y 5'-primer gcgaattctcacttgtcatcgtcgtccttgtagtccaagctctcactgctggaagtg-3' la incorporación de una BANDERA etiqueta secuencia en el extremo 3 '. El producto de PCR fue ligated en pCR2.1-TOPO vector, secuenciado, clonado y sub-como EcoR1 EcoR1-EcoR1 EcoR1 insertar en el vector de expresión pCMV5. La misma región del Pim-3 mRNA fue clonado (que carecen de la Pim-3 codón de parada) con un C-terminal GST secuencia (generada por la superposición PCR) en pCMV5 como Kpn1/HindIII insertar. El Pim-3 secuencia también fue clonado con un N-terminal Su Etiqueta en pFastBAC a un vector de expresión de Baculovirus expresión. Quinasa muertos versiones de la Pim-1, Pim Pim-2 y expresión-3 construcciones fueron generados por la mutación de los DFG 'motivo' AFG ', en cada caso, utilizando la QuikChange Site-Dirigido Mutagénesis Kit (Stratagene). Una codificación de cDNA de longitud completa Bad murino se amplificó a partir de la construcción de Bad pGEX se describe en [33] usando primers 5'-gcggatccatgggaaccccaaagcagccctc-3 'y 5'-primer gtgcggccgctcactgggagggggtggagcc-3'. El producto de PCR fue ligated en pCR2.1-TOPO vector, secuenciado, clonado y sub-como BamH1 BamH1-Not1 Not1 insertar en el vector de expresión pEBG6P-1 (pEBG2T que contiene una PreScission sitio de la proteasa). S112A, S155A, S136A, S136D y S136E mutantes se generaron utilizando la QuikChange Site-Dirigido Mutagénesis Kit (Stratagene).

Cultivo de células

HEK-293 células se mantuvieron en MEDM con 10% de SFB (Sigma), 2 mM de L-glutamina, 50 unidades / ml penicilina G y 50 μ g / ml estreptomicina (Invitrogen). Las células fueron transfectadas utilizando PEI, tal como se describe [49]. Antes de la estimulación y el análisis de las células se mueren de inanición en MEDM carece de suero durante dieciocho horas a 37 ° Cy 5% de CO 2. Las células fueron estimulados con IGF (100 ng / ml 5 min), sorbitol (0,5 M durante 30 min), AICar (2 mM durante 1 hora), UV-C (200 Jm 2 / 10 segundos seguidos por 1 hora de incubación a 37 ° C), el peróxido de hidrógeno (1 mM durante 1 hora), el PMA (400 ng / ml durante 15 min), anisomycin (10 μ g / ml para 1 hora) o Forskolin (20 μ M durante 30 min). Las células fueron lisadas en 50 mM Tris-HCl pH 7,5, 1 mM EGTA, 1 mM EDTA, 1 mM de sodio orthovanadate, 50 mM de fluoruro de sodio, 1 mM de pirofosfato de sodio, 0,27 M de sacarosa, 1% (v / v) Triton X-100 , 0,1% (v / v) 2-mercaptoetanol. Lisados fueron a 13000 rpm durante 5 min a 4 ° C los sobrenadantes y congelado en nitrógeno líquido y se almacenan a -80 ° C hasta su utilización.

Péptido quinasa ensayo

Para los ensayos in vitro quinasa 1 unidad de actividad se define como la suma de quinasa que catalizaron la fosforilación de 1 nmol de sustrato en 1 min en el péptido RSRMSSYPDRG en un 30 μ M péptido concentración. Para determinar la capacidad de Pim quinasas phosphorylate a péptidos derivados de la mala, cada péptido se utilizó como sustrato a las concentraciones que se indica y se incubaron con 10 mU de quinasa en un volumen de 50 μ l durante 10 minutos a 30 ° C en 10 mM MgCl 2 - 0,1 mM [Γ 32 P]-ATP, 50 mM Tris-HCl, pH 7,5, 10 mM EGTA, 0,1% y 2-mercaptoetanol 2,5 μ M PKI. Las reacciones fueron terminados por manchas sobre el papel de p81, seguido por inmersión en orto-50 mM de ácido fosfórico. Todos los trabajos fueron lavados tres veces en 50 mM de ácido orto-fosfórico para eliminar ATP no incorporado, una vez en acetona y luego se secan y los 32 la incorporación de P se determinó por recuento Cerenkov. Los péptidos son utilizados RSRMSSYPDRG (correspondientes a Ser112), RGSRSAPPNL (correspondientes a Ser136) y RELRRMSDEFEGS (correspondientes a Ser155).

Para determinar la actividad de las quinasas Pim expresado en Hek-293 células, FLAG Pim-quinasa se immunoprecipitated de 50 μ g soluble de la célula lisado utilizando un anticuerpo anti FLAG (Sigma) y ensayados por protocolos estándar [50]. En pocas palabras, immunoprecipitates se lavaron dos veces en NaCl 0,5 M, 50 mM Tris-HCl pH 7,5, 0,1 mM EGTA y el 0,1% (v / v), 2-mercaptoetanol y una vez en 50 mM Tris-HCl pH 7,5, 0,1 mM EGTA y 0,1% (V / v) 2-mercaptoetanol. Fueron precipitados luego resuspendido en 35 μ l de buffer de reacción (que contiene Tris / HCl pH7.5, EGTA, PKI y RSRMSSYPDRG sustrato péptido,), y la reacción se inició con la adición de 10 μ l 50 mM MgAc, 0,5 mM [γ 32 P ]-ATP y se incuba a 30 ° C durante 15 min. Final concentraciones de los reactivos en el ensayo fueron 50 mM Tris / HCl pH7.5, 0,1 mM EGTA 0,1% 2-mercaptoetanol 2,5 μ M PKI (un inhibidor de la PKA), 30 μ M sustrato péptido péptido, 10 mM MgAc y 0,1 mM [32 γ P]-ATP. Las reacciones fueron detenidos por el trasbordo a P81 papel y lavado en 75 mM de ácido ortofosfórico.

Bad fosforilación in vitro

Humanos-1 y Pim Pim-2 fueron clonados con un N-terminal GST-etiqueta y se expresa en las células HEK-293. Murino Pim-3 fue clonado con un N-terminal-Su etiqueta y expresada en un sistema de Baculovirus expresión utilizando células de insecto Sf9 Sf9. Bad murino fue clonado con un N-terminal-GST etiqueta y expresado en bacterias. Todas las proteínas recombinantes fueron purificados mediante técnicas de cromatografía de afinidad estándar de glutatión o Ni-NTA sepharose según corresponda. Recombinante purificada Pim-quinasas (10 mU) fueron incubadas con 2 μ g de Bad recombinante sobre el período de tiempo indicado en 50 mM Tris-HCl, pH 7,5, 10 mM EGTA, 0,1% 2-mercaptoetanol, 2,5 μ M PKI, 10 mM MgCl 2 Y 0,1 mM [γ 32 P]-ATP. Las reacciones fueron detenidos por la adición de SDS carga de amortiguación y las muestras analizadas en un 4-12% Novex gel (Invitrogen). Proteína coloidal fue detectada por tinción de azul y la banda se proceda extirpados, y la suma de 32 P se determinó mediante la incorporación Cerencov contar.

Fosforilación sitio identificación

Las muestras se ejecutan en un 4-12% en gel de poliacrilamida, y el sustrato de la banda fue extirpada, y la suma de 32 P incorporado determinado por contar Cerenkov. Para fosfato sitio cartografía, la proteína se redujo con dithiothreitol, alkylated con iodoacetamide y digerido con tripsina. Los péptidos resultantes se aplicaron a una columna Vydac 218TP5215 C18 equilibrado en el 0,1% y el ácido trifluoroacético columna desarrollado con un gradiente lineal de ácido trifluoroacético acetonitrile/0.1% con un caudal de 0,2 ml / min durante la recogida fracciones de 0,1 ml. Radiactividad 32 P Se registró con un monitor en línea. Fosforilación sitio de la cartografía se realizó básicamente como hemos descrito anteriormente [51]. Identificación de los 32 P etiquetados péptidos se realizó por MALDI-TOF y MALDI-TOF-TOF espectrometría de masas en una Applied Biosystems 4700 utilizando una matriz de 10 mg / ml de ácido alfa-cyanocinnamic en 50% acetonitrile/0.1% trifluoroacético acid/10 mM de amonio Fosfato. Sitios de fosforilación dentro de los péptidos se determinó a través de una combinación de MALDI-TOF-TOF espectrometría de masas y secuenciación de Edman fase sólida. Fase sólida de secuenciación se realizó en un Applied Biosystems Procise 494C acoplamiento después de la péptido covalentemente a un Sequelon arilaminas membrana y por la medición de Cerenkov contar los 32 P radiactividad en libertad después de cada ciclo.

GST-Bad obtiene

Lisados fueron incubados con glutatión-sepharose por 2 horas a 4 ° C. Immunoprecipitates se pildoradas por centrifugación de 1 min a 13000 g y lavados dos veces en 50 mM Tris-HCl, pH 7,5, 500 mM NaCl, 0,1 mM EGTA y el 0,1% 2-mercaptoetanol y una vez en 50 mM Tris-HCl, pH 7,5, el 0,1 MM EGTA y el 0,1% 2-mercaptoetanol. Proteína se eluye en SDS muestra buffer.

Immunoblotting

Extracto soluble de células que se aplicó a 4-12% Novex geles (Invitrogen) y transferida a la membrana de nitrocelulosa y borró usando técnicas estándar. Anticuerpos que reconocen p-Bad (Ser112), p-Bad (Ser 136), pBad (Ser155) y Bcl-X L eran de la tecnología de células de señalización. Un anticuerpo que detecta la proteína total de Bad se planteó en la Organización. La Bandera de anticuerpos fue de Sigma y conjugado HRP secundaria de anticuerpos fueron Pierce (Cheshire, Reino Unido) y blots fueron desarrolladas utilizando el reactivo de mayor ECL (Amersham, Buckinghamshire, Reino Unido).

14-3-3 superposición ensayos

14-3-3 superposición ensayos se realizaron como se describe [52]. En pocas palabras, los extractos de proteínas de la célula o GST pull bajadas fueron separados de 4-12% Novex geles (Invitrogen) y se transferirán a la membrana de nitrocelulosa. Membranas fueron tratadas como para immunoblots. Digoxygenin (DIG)-etiquetados 14-3-3 proteínas se incubaron con las membranas en lugar del anticuerpo primario, seguido de incubación con un segundo anti-DIG peroxidasa de rábano de anticuerpos. Blots fueron desarrolladas utilizando el reactivo de mayor ECL (Amersham, Buckinghamshire, Reino Unido).

Abreviaturas

PIM (integración proviral de MMLV), PKA (AMPc dependiente de la proteína quinasa), República de la Krajina Serbia (p90 ribosomal S6 quinasa), PAK (p21 proteína quinasa activada), PKI (AMPc dependiente de péptido inhibidor de la proteína quinasa), GST (glutation S-transferasa ), ECL (mejora de quimioluminiscencia), IGF (factor de crecimiento tipo insulina), el PMA (forbol 12-myristate 13-acetato), HEK (riñón de embriones humanos), MEDM (Dulbecco modificado águilas del medio).

Contribuciones de los autores

AM estuvo involucrado en todos los aspectos de este estudio y fue responsable de la mayoría de los trabajos experimentales. Espectrometría de masas análisis fue proporcionado por DC y la biología molecular se prestó asistencia por RT. HM JH y supervisó la provisión de proteínas y anticuerpos reactivos. CEJA y AM se encarga de coordinar el estudio y redacción del documento.

Agradecimientos

Nos gustaría dar las gracias al Servicio de Secuenciación (Escuela de Ciencias de la Vida, de la Universidad de Dundee) para la secuenciación del ADN. Esta investigación fue apoyada por el Consejo de Investigación Médica del Reino Unido, Astra-Zeneca, Boehringer-Ingelheim, GlaxoSmithKline, Merck and Co, Pfizer y Merck KGaA.