Journal of Negative Results in Biomedicine, 2006; 5: 5-5 (más artículos en esta revista)

Polimorfismos genéticos y susceptibilidad a la enfermedad pulmonar

BioMed Central
Pauline L Lee (plee@scripps.edu) [1], Carol West (cwest@scripps.edu) [1], Karen Crain (kcrain@scripps.edu) [1], Wang Lei () [leiw@scripps.edu 1]
[1] El Instituto de Investigación Scripps, Departamento de Medicina Molecular y Experimental, 10550 North Torrey Pines Road, La Jolla, 92037, EE.UU.

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons License (http://creativecommons.org/licenses/by/2.0], que permite el uso irrestricto, la distribución y reproducción en cualquier medio, siempre que la obra original sea debidamente citada.

Resumen

Susceptibilidad a la infección por la bacteria Bacillus anthracis, como tiene una base genética en ratones y también puede tener una base genética en los seres humanos. En los escasos casos humanos de ántrax por inhalación, los estudios sugieren que no todas las personas expuestas a esporas de ántrax fueron infectados, sino más bien, las personas con enfermedad pulmonar subyacente, en particular el asma, la sarcoidosis y la tuberculosis, podrían ser más susceptibles. En este estudio, se determinó si los polimorfismos en genes importantes en la inmunidad innata se asocian con una mayor susceptibilidad a enfermedades infecciosas y no infecciosas enfermedades pulmonares, en particular la tuberculosis y la sarcoidosis, respectivamente, y, por lo tanto, podría ser un factor de riesgo de inhalación de ántrax. El examen de 45 polimorfismos no sinónimos en diez genes: p47phox (NCF1), p67phox (NCF2), p40phox (NCF4), p22phox (CYBA), gp91phox (CYBB), DUOX1, DUOX2, TLR2, TLR9 y alfa 1-antitripsina (AAT ) En una cohorte de 95 personas con enfermedad pulmonar y 95 individuos de control no mostró una asociación de estos polimorfismos con una mayor susceptibilidad a la enfermedad pulmonar.

Introducción

Desde octubre de 2001, cuando fue puesto en libertad Bacillus anthracis en los Estados Unidos como un acto de bioterrorismo, se ha producido un mayor interés en determinar si existen factores de riesgo para la infección por inhalación de ántrax. La exposición a esporas de Bacillus anthracis no causa la infección en todas las personas expuestas [1]. Los estudios epidemiológicos de las personas infectadas con ántrax de inhalación han sugerido que un sistema inmune debilitado podrían aumentar la susceptibilidad a la infección por Bacillus anthracis [2]. Algunas de las personas infectadas tenían una historia de enfermedad pulmonar crónica, como el asma, la sarcoidosis, la tuberculosis y [2 - 4]. Los estudios en ratones han demostrado que existe una base genética para el ántrax sensibilidad [5, 6]. Por ejemplo, los macrófagos de ratones C3H son 100000 veces más sensibles a la toxina del Bacillus anthracis que los macrófagos de A / J mice [6]. En el presente estudio se examina si existen polimorfismos genéticos en seres humanos asociada con una mayor susceptibilidad a la enfermedad pulmonar. Identificación de genes asociados con un mayor riesgo de enfermedad pulmonar podría identificar individuos que podrían ser también de una mayor susceptibilidad a la infección por inhalación de ántrax.

El NAD NAD (P) H oxidasas oxidasas (NOX) son una familia de enzimas que son esenciales para la acogida de defensa contra la infección microbiana, revisado por Quinn y Gauss [7]. La central de la enzima NAD (P) H oxidasa es una flavina y heme-que contiene proteína, la más conocida es la fagocitosis gp91phox (CYBB, NOX2) de proteínas. Gp91phox, y una serie de proteínas incluyendo DUOX1 y DUOX2, transmembrana son proteínas que el transporte de electrones y generar especies reactivas de oxígeno (ROS), a expensas de NADH y NADPH. La actividad de las oxidasas son altamente regulado por proteínas accesorias, incluyendo p22phox (CYBA), p47phox (NOXO1, NCF1), p67phox (NOXA2, NCF2), y p40phox (NCF4). Enfermedad granulomatosa crónica (CGD), asociado a graves, recurrentes y crónicas no específicas de las infecciones bacterianas y fúngicas, es más comúnmente causada por mutaciones en p47phox, gp91phox, p67phox, y p22phox que comprometer gravemente la actividad respiratoria ráfaga de los neutrófilos.

Görlach et al fueron los primeros en identificar la presencia de al menos un pseudogen copia de la p47phox (NCF1) de genes en el cromosoma 7q11.23 [8]. Por la construcción de un mapa físico detallado de esta región Hockenhull et al determinar que hubo una copia normal wildtype pseudogen y dos copias de cada cromosoma NCF1 [9]. Heyworth et al elegantemente demostrado que en algunos individuos, uno de los ejemplares de pseudogen NCF1, posiblemente por la recombinación de genes o de conversión, ha vuelto a la normalidad wildtype GTGT secuencia (es decir, pseudowildtype) [10]. Así, individuos con baja frecuencia de este polimorfismo de NCF1, han 2 "wildtype" copias y un pseudogen por copia cromosoma [10]. Por lo tanto, las personas (con 2 cromosomas) pueden tener un pseudogen NCF1: peso copia de una de las ratio 2:1, 1:1 o 1:2. Aunque dos grupos han examinado la asociación de los menores de 1:1 y 1:2 alelos con enfermedad inflamatoria intestinal, las conclusiones están en conflicto debido principalmente a las diferencias en las frecuencias de los alelos de control de la población y el tamaño de la muestra [11, 12]. Otros polimorfismos en p47phox, p67phox y gp91phox, no se han demostrado ser asociados con las enfermedades humanas distintas de CGD. P47phox Recientemente se ha demostrado por la posición de regular la clonación con fines de la severidad de la artritis en ratas [13]. El H72Y polimorfismos en p22phox (CYBA), junto con la reducción de ráfaga respiratoria en neutrófilos humanos aislados [14], pero todavía no se ha demostrado claramente que se asocia con un fenotipo de la enfermedad [15 - 17]. DUOX1 y DUOX2, que se expresan en el epitelio pulmonar, regula H 2 O 2 [18 - 20] y [21] de ácido en la producción de las vías respiratorias, pero no se han demostrado ser asociado con la enfermedad pulmonar. Las mutaciones en DUOX2 han demostrado ser asociados con el hipotiroidismo leve [22 - 24].

TLR2 es el receptor de peptidoglycans, lipoteichoic acid, lipoarabinomannan, mycolylarabinogalactan, y zymosan. Ántrax infección se piensa que es mediado en parte a través de la vía TLR2 desde TLR2 ratones deficientes son resistentes a la infección por la cepa Sterne de Bacillus anthracis y HEK293 células que expresan TLR2, TLR4, pero no, están en condiciones de la señal en respuesta a la exposición al calor-Bacillus inactivada Anthracis [25]. Inactivación y el asesinato de la Mycobacterium tuberculosis también está mediada por TLR2 desde Tlr2-macrófagos de ratones deficientes o macrófagos humanos bloqueado por los anticuerpos anti-TLR2 no para matar la bacteria [26]. Tlr9 y Tlr2 doble knockout mice mostrar una más acusada susceptibilidad a la infección por tuberculosis que solo gen ratones knockout [27]. El TLR2 polimorfismo R753Q [28] y la R677W polimorfismo en los seres humanos [29 - 31] han demostrado ser asociados con aumento del riesgo de infección tuberculosa. El polimorfismo R753Q no se asoció con un aumento generalizado del riesgo de infección, por ejemplo, las personas con R753Q eran menos sensibles a la infección por Borrelia burgdorferi, que causa la Enfermedad de Lyme [32] y R753Q no se asoció con una mayor susceptibilidad a la infección por Staphylococcus aureus [33].

Alfa-1-anti-tripsina (AAT), la deficiencia se ha asociado con una mayor susceptibilidad a las enfermedades pulmonares, sobre todo el enfisema [34, 35]. Aunque más de 70 variantes han sido descritos, sólo unos pocos están asociados con la reducción de la expresión de la proteína AAT y / o reducción de la actividad [35]. Varios estudios han sugerido que la simple heterozigosidad para alelos mutantes de AAT puede predisponer a los individuos con enfermedad pulmonar obstructiva crónica [35 - 37]. El alelo Z (E366K), que ocurre en un alelo de 0.01-0.02 frecuencia en las personas de origen europeo, es el alelo más común asociado con un mayor riesgo de enfisema inducido por el medio ambiente [34, 38 - 40]. Individuos homocigotos del alelo S AAT (E288V) no están en riesgo de enfisema, pero un heterocigoto compuesto de la Z y S alelo o un alelo nulo son de mayor riesgo [39, 41]. Los portadores de la AAT S y Z alelos están excesivamente representados en las personas con cáncer de pulmón [42]

En este estudio, hemos intentado determinar si nonsynonymous normal de las variaciones genéticas identificadas por el Genbank la base de datos o SNP anteriormente descritas en la literatura a estar presentes en la población normal de los genes de p47phox (NCF1), p67phox (NCF2), p40phox (NCF4) , Gp91phox (CYBB), p22phox (CYBA), DUOX1, DUOX2, TLR2, TLR9 la alfa-1 anti-tripsina (AAT) se asocian con una mayor susceptibilidad a la tuberculosis, la sarcoidosis, neumonía recurrente, y la infección micobacteriana atípica.

Materiales y métodos
Los participantes del estudio

Anónimos muestras de sangre de los individuos de control de la construcción europea, no de origen hispano (n = 95) se obtuvieron de Kaiser Permanente [43] o desde El Instituto de Investigación Scripps GCRC sangre programa de dibujo. De un grupo de 31247 participantes en un estudio de Kaiser Permanente Europea, no hispanos origen [43], todas las personas que tenían un historial médico documentado con la hospitalización por enfermedades pulmonares: infección micobacteriana atípica (n = 1), repetidos episodios de neumonía ( N = 5), la sarcoidosis (n = 46), y la tuberculosis (n = 43), fueron seleccionados y se refirió a las enfermedades pulmonares como el grupo (n = 95). Los participantes en el estudio de Kaiser Permanente son miembros de Kaiser Permanente que asista a una de Evaluación Clínica de la Salud y no fueron seleccionados para las enfermedades agudas o crónicas. Todas las muestras se obtuvieron humanos con consentimiento escrito. Aprobaciones de los protocolos que impliquen la utilización de seres humanos se han obtenido de los consejos de revisión institucional de El Instituto de Investigación Scripps y Kaiser Permanente.

P47phox/NCF1 pseudogen: wildtype ratio

La amplificación de la región de p47phox exón 2 por el wildtype GTGT secuencia y el pseudogen delGT secuencia fueron amplificados utilizando primers p47phox/NCF1 Ex2F GCTTCCTCCAGTGGGTAGTGGGATC y p47phox/NCF 161R GGAACTCGTAGATCTCGGTGAAGC y 32 P-etiquetados p47phox/NCF1 Ex2F primer bajo condiciones estándar de PCR de 25 ciclos . Los 32 P-productos etiquetados amplificación de ADN se separaron en un 10% de acrilamida / urea / TBE secuenciación gel. Autorradiografía se utiliza para visualizar el wildtype y pseudogen productos amplificados, que se diferencian por 2 nucleótidos de longitud.

Genotipado de polimorfismos de nucleótido único (SNP) por hibridación alelo específico oligomérica (ASOH)

Para los genes de este estudio, no sinónimos SNPs identificados en Genbank la base de datos de SNP y / o no synonynous SNPs asociados a la enfermedad pulmonar fueron investigados. La amplificación de ADN de las regiones que abarcan los SNPs se ampliaron utilizando los primers que figuran en el cuadro 1. ASOH se realizó mediante hibridación condiciones estándar [44] usando 32 P radiomarcada sondas y lavado temperaturas descritas en la Tabla 1. La genotipificación se realizó siguiendo visualización de la sonda hibridada por autorradiografía.

Estadísticas

La prueba exacta de Fisher se realizó con GraphPad InStat uso de los datos en bruto entró en un 2 × 2 tabla de contingencia. Potencia cálculos se han realizado para dar la probabilidad de encontrar las diferencias entre las frecuencias génicas como estadísticamente significativo, teniendo en cuenta el tamaño de la muestra.

Resultados

Se analizaron 95 individuos de la construcción europea, no hispanos con origen documentado historial médico con hospitalización por la enfermedad pulmonar (46 con sarcoidosis, la tuberculosis con 43, cinco con neumonía recurrente, y una con infección micobacteriana atípica) y 95 individuos de control de la construcción europea, no Origen hispano para las diferencias en las frecuencias de los alelos en los genes que participan en la inmunidad innata.

P47phox / (NCF1)

Examen de la pseudogen: peso copia de la relación de control de los individuos frente a la enfermedad pulmonar no mostró diferencias estadísticamente significativas en las frecuencias de la pseudogen: coeficientes de peso en el grupo de enfermedad pulmonar en comparación con el grupo control (Tabla 2].

P67phox (NCF2), p40phox (NCF4), p22phox (CYBA), gp91phox (CYBB), DUOX1, DUOX2

SNPs en el p67phox (NCF2), p40phox (NCF4), p22phox (CYBA) y gp91phox (CYBB), DUOX1 y DUOX2 genes fueron examinados. Algunos SNPs no ocurrió en una frecuencia lo suficientemente elevada como para ser detectados en nuestra muestra. Ninguna de las frecuencias de los alelos difiere significativamente entre la enfermedad pulmonar y el control de los grupos (Cuadro 3].

TLR2, TLR9, AAT

TLR2, TLR9, y se examinaron los genes AAT. Una vez más, muchos SNPs no ocurrió en la frecuencia lo suficientemente elevada como para ser observados. La mayoría de las frecuencias de los alelos no fue diferente entre las enfermedades de los pulmones y los grupos de control. El TLR2 polimorfismo R753Q, asociadas a la tuberculosis, no fue mostrado a la diferencia entre el control de enfermedades de los pulmones o de grupo. El TLR2 R677W polimorfismo, también asociadas a la tuberculosis, no se observó en ninguno de los dos grupos. R863Q SNP en la TLR9 se ausente de la enfermedad pulmonar grupo que se indica que este polimorfismo no se asoció con un aumento de la enfermedad pulmonar. La AAT S (Glu288Val) y Z (E366K) alelos, asociado a la enfermedad pulmonar obstructiva crónica, examinados y no hay diferencia entre frecuencias de los alelos en el control de enfermedades de los pulmones y de los grupos (Cuadro 3].

Discusión

Dado que sólo un subconjunto de las personas expuestas a esporas de Bacillus anthracis desarrollo de la enfermedad pulmonar, la forma más peligrosa de la infección por ántrax, sería importante identificar los factores que conducen a la susceptibilidad a este tipo de infección. Esto podría permitir identificar a las personas que corren el mayor riesgo y que les proporcione el tratamiento más agresivo al inicio de la infección. La capacidad de los individuos de este modo triage en el caso de un ataque biológico sería valiosa. Además, la comprensión de la predisposición genética podría conducir a una mejor gestión de las personas con infección por ántrax pulmonar.

La genética influye en la resistencia a la infección son muy fuertes. De hecho, las influencias genéticas de resistencia a la infección parecen ser mayores que las influencias genéticas sobre el cáncer o las enfermedades cardiovasculares [45]. En las últimas décadas un número considerable de los polimorfismos se ha demostrado que causa la susceptibilidad a la enfermedad infecciosa en ratones [6] y en humanos [28, 31, 46]. Debido a las infecciones causadas por Bacillus anthracis son raras es imposible examinar polimorfismos candidatos en los pacientes que realmente desarrollado ántrax pulmonar. En lugar de ello, ha sido necesario utilizar sustitutivos infecciones inusuales, como las infecciones micobacterianas, neumonía recurrente, y la tuberculosis pulmonar o examinar enfermedades como la sarcoidosis, que se ha informado en los casos de ántrax por inhalación, para este estudio. El "grupo de las enfermedades pulmonares" en este estudio representan a todas las personas documentadas con hospitalización de las enfermedades pulmonares de una colección de 31247 personas de la construcción europea, no de origen hispano sin seleccionar ningún agudo o crónico problema de salud. Genes candidatos fueron seleccionados sobre la base de su papel en la inmunidad contra la infección crónica, así como su participación en la respuesta inmune innata. Este es un enfoque razonable, ya que los defectos en el sistema inmunológico en general, no aumenta la susceptibilidad a un solo organismo, sino más bien a varios organismos que comparten algunas características en la patogénesis de la enfermedad que los que producen.

Nuestro análisis de los genes de la NAD (P) H oxidasa, p47 (NCF1), p67phox (NCF2), p40phox (NCF4), p22phox (CYBA), y gp91phox (CYBB), así como de otros genes implicados en la inmunidad innata como DUOX1 y 2, TLR2, TLR9 AAT y demostró que no había diferencias entre el control y la enfermedad pulmonar grupo compuesto principalmente de la sarcoidosis y la tuberculosis personas. Es posible, por supuesto, muchos otros polimorfismos que afectan a la susceptibilidad a Bacillus anthracis. Aunque los genes que hemos elegido parecía ser razonable candidatos, hay muchos más genes que codifican productos que se podrían efectuar importantes en el curso de ántrax en los seres humanos. Por ejemplo, se ha sugerido que la susceptibilidad a Bacillus anthracis podría implicar myD88 [25]. Además, la susceptibilidad a la infección por tuberculosis puede ser alterado por variaciones en el gen del receptor de la vitamina D [47]. Del mismo modo, la sarcoidosis se ha demostrado que el estar asociado con alelos en particular BTNL2 [48, 49], IL18 [50], y IFNa [51], y SLC11A1 [52].

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Contribuciones de los autores

Cada autor contribuido sustancialmente al diseño, adquisición y análisis de los datos. PLL supervisado el proyecto y escribió el manuscrito. Cada autor ha leído y aprobado el manuscrito antes de su presentación.

Agradecimientos

Este manuscrito es el número MEM18018. Este trabajo recibió el apoyo de los CDC 5PO1 CI000095 Stein y el Fondo de Dotación. Los autores desean agradecer a Dr Jill Waalen el poder para realizar los cálculos y los Dres. Ernest Beutler, Gary Bokoch, Bruce Beutler, Ulla Knaus, y Bruce Zuraw para sus debates.