Journal of Biomedicine and Biotechnology, 2006; 2006: (más artículos en esta revista)

La evidencia de un biomarcador en genómica humana normal epitelial mamaria línea celular, MCF-10A, que está ausente en los humanos contra el Cáncer de Mama línea celular, MCF-7

Hindawi Publishing Corporation
Brian H. Crawford, AKM A. Hussain, Nathan M. Jideama

Este es un artículo de acceso abierto distribuido bajo la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original esté debidamente citados.

Resumen

Este estudio investigó el uso de amplificación de ADN de huellas dactilares (DAF) para identificar biomarcadores útiles en el esclarecimiento de los factores genéticos que llevan a la carcinogénesis. La amplificación del ADN de huellas dactilares (DAF) se utilizó la técnica de huellas digitales para generar perfiles de un humano normal de células epiteliales mamarias línea (MCF-10A) y un cáncer de mama humano línea celular (MCF-7). Cuando se compara el uno con el otro, un biomarcador de genes polimórficos (262 pares de bases (bps)) fue identificado en MCF-10A, pero no estuvo presente en MCF-7. Este gen fue clonado a partir de la ADN genómico de la MCF-10A línea celular, y sometidos a análisis de bases de datos GenBank. El análisis de la secuencia de nucleótidos marcadores polimórficos (GenBank cuenta: AC079630) muestra que este biomarcador tiene 100% de homología con la secuencia de nucleótidos del cromosoma 12 humano BAC RP11-476D10 (19612-19353 bps). La secuencia de nucleótidos se utilizó para su posible traducción de proteínas producto y el resultado obtenido indicó que el gen codifica para la proteína hipotética XF2620. Con el fin de evaluar los efectos que los 262 bps biomarcador tendría en la morfología de MCF-7 células, se transfectadas en MCF-7 células. No se observan cambios en la morfología de las células transfectadas. Estos cambios incluyen un aumento en la celda de elongación y una disminución de la agregación celular.

INTRODUCCIÓN

ADN "huellas digitales" se ha utilizado para la vinculación del genoma, la variación genética, la población y el pedigrí de análisis, identificación forense, la localización de la enfermedad loci, y la epidemiología [1 - 3]. La variación en la secuencia de nucleótidos del ADN ha sido explotado para la producción característica de huellas dactilares, debido a su plasticidad, la ubicuidad, y la estabilidad [4 - 6].

Las células cancerosas suelen tener cientos e incluso miles de errores genómica, único y los patrones de mutaciones genéticas se encuentran en prácticamente todos los diferentes tumor [7, 8]. A diferencia del clásico enfermedades genéticas, no hay bien definidos correspondencias entre las mutaciones genéticas presentes en el cáncer y las poblaciones celulares características del fenotipo maligno [9].

La forma más común de cáncer entre las mujeres es el cáncer de mama [10]. Aunque es la segunda causa de mortalidad entre las mujeres, la patogénesis de la enfermedad sigue siendo poco clara [11, 12]. La mayoría de mutaciones malignas en humanos fueron identificados por métodos convencionales como de un solo capítulo polimorfismo conformacional (SSCP) y secuenciación del ADN [13]. Otros métodos, como la desnaturalización electroforesis en gel de gradiente, heterodúplex análisis, y métodos de división [14] También se han utilizado. Todos estos métodos son relativamente mucho tiempo, mano de obra intensiva, y procesos secuenciales.

La amplificación del polimorfismo de longitud de los fragmentos de AFLP implica la amplificación enzimática del ADN dirigido por uno o más arbitraria oligonucleótidos para producir una característica del espectro de productos, una parte de lo que podría ser polimórfico. El procedimiento es rápido, independiente del estado de la genética y bioquímica de conocimiento del organismo a prueba, y permite adaptar el número de productos generados y los polimorfismos [15]. Amplificación del ADN de huellas dactilares (DAF) es uno de los mejores avances tecnológicos debidos a la utilización de la más sencilla y relajada condiciones de amplificación y los primers cortos, y que ofrece alta resolución. DAF se basa en el principio de que el ADN de dos fuentes distintas cuenta con diferentes distribuciones de sitios específicos de ADN. El ADN de estos lugares se puede cortar con nucleasas de restricción de la producción de un conjunto único de fragmentos de ADN de todo el genoma del organismo. El DAF técnica se puede lograr la clasificación de estos fragmentos de tamaño utilizando SDS-electroforesis en gel de poliacrilamida [4].

El cáncer de mama y otros tumores malignos gradual resultado de alteraciones genéticas de las células normales de acogida. Genoma inestabilidad promueve un gran potencial para desarrollar cambios genéticos, tales como la pérdida de genes, amplificación de genes, mutación puntual, y las translocaciones cromosómicas [16]. En cuanto al cáncer de mama, la pérdida de heterozigosidad (pérdida de genes) y los cambios en el número de copias de genes causa el desarrollo y progresión de la enfermedad [17, 18].

En la presente investigación, hemos utilizado la técnica de DAF en la identificación de un gen polimórfico presentes en humano normal de células epiteliales mamarias línea, MCF-10, pero está ausente en el cáncer de mama humano línea celular, MCF-7.

MATERIAL Y MÉTODOS
Líneas celulares

Normal humanos células epiteliales de mama (MCF-10A) y humanos células del cáncer de mama (MCF-7) utilizada para este estudio se obtuvieron a partir de la ATCC (Manassas, Va).

Aislamiento de ADN genómico y la generación de huellas dactilares perfil

DNAzol de aislamiento del ADN genómico reactivo (Molecular Research Center, Inc, Cincinnati, Ohio) se utilizó para aislar el ADN genómico de la célula epitelial mamaria línea (MCF-10A) y el cáncer de mama línea celular (MCF-7). Amplificación del ADN se realizó utilizando una solución (25 μ l) con 2 ng de ADN, 0,3 unidades / μ l de AmpliTaq DNA polimerasa (Stoffel fragmento) de Thermus aquaticus (Perkin-Elmer/cetus, Norwalk, Conn, EE.UU.), 200 μ M de cada deoxynucleotide trifosfato (Pharmacia LKB Biotecnología Inc, Piscataway, NJ, EE.UU.), 6 mM MgCl 2 , 10 mM Tris - HCl (pH 8.3), y 10 mM KCl . La solución también contiene 0,3 μ l de DAF primer arbitraria (8-10 nucleótidos de longitud) que bajo el rigor necesario para amplificar los ciclos de polimorfismo de ADN [19]. Debido al hecho de que no había conocido la prueba de que los primers produciría polimórficos productos, DAF 10 primers de cada una de las 4 series (A, B, C y D; un total de cuarenta primers) fueron seleccionados al azar y se utiliza para ambos MCF - 10A y MCF-7 líneas celulares. De estos 40 primers DAF, sólo uno (A25 (GCCCGTGC)) dado los marcadores polimórficos en tres experimentos, dando pruebas de resultados reproducibles. Los restantes 39 primers DAF no dio ninguna polimorfismos. La solución fue sobrecargado con dos gotas de aceite mineral y las muestras fueron amplificadas en un termociclador Ericomp (Ericomp Inc, San Diego, Calif, EE.UU.) el 35 en dos etapas los ciclos de 1 segundo a 96 ° C y 1 segundo a 30 ° C . La calefacción y la refrigeración de las tasas de termociclador fueron 23 ° C / min y 14 ° C / min, respectivamente. 3 μ l de la reacción de amplificación se cargó con 3 μ l de tampón de carga (5 M urea, el 3% ficoll, 0,12% Tris, EDTA 1,12%, 0,02% de xileno cyanol, y el 0,02% Azul de bromofenol). Electroforesis en gel de poliacrilamida [4, 15] se utiliza para separar los fragmentos de amplificación de ADN. Electroforesis se ha ejecutado a 100 V, hasta el tinte frente era de aproximadamente 1 cm a partir del final del gel. Un procedimiento de tinción de plata [15] que detecta el ADN de 1 pg / mm 2 banda de la sección transversal se utilizó para observar el ADN. Los geles fueron preservados permanentemente utilizando el respaldo de poliéster-geles de remojo en el 50% de etanol durante 10 minutos y el secado a temperatura ambiente.

El aislamiento y la clonación de biomarcadores secuencia

La banda se polimórficos extirpados de la húmeda gel de poliacrilamida y sumergido en 20 μ l de buffer TE (10 mM Tris, 1 mM EDTA). La mezcla se calienta durante 20 minutos a 90 ° C y almacenarse a una temperatura de 4 ° C durante 2 días. Dos μ l de la mezcla se utilizó para la DAF reacción de PCR con cebadores arbitrarios DAF, A25. Tres μ l del producto de PCR fue ligated en PCR II y se transforma en un disparo de células competentes (de acuerdo con el procedimiento de clonación TA kit doble promotor (PCR II), Invitrogen Life Tecnología, Carlsbad, California, EE.UU.-versión H). Un color blanco en las placas LB (1,0% tryptone, 50 μ g / ml ampicilina, 0,5% becto-extracto de levadura, 1,0% NaCl , Y el 0,15% de agar) identificó las colonias que contenían el fragmento, que se genera con X-gal, debido a la expresión de América Latina y el Caribe promotor de la PCR II vector. Individual blanco colonias de la banda fueron polimórficos digerido por la enzima de restricción EcoRI y ejecutarse en un 1% en gel de agarosa teñido con bromuro de etidio (0,5 μ g / ml). El gel fue visto a la luz ultravioleta para identificar las bandas que contenía el fragmento. Se prevé que las colonias fueron cultivadas en medio LB (1% tryptone, el 0,5% de extracto de levadura, 1% NaCl , Antibiótico ampicilina (50 μ g / mL) (pH 7,0)) a lo largo de la noche a 37 ° C en agitador eléctrico a 225 rpm. El plásmido de ADN fue purificado por el asistente Plus Miniprep sistema de purificación de ADN (Promega Corporation, Madison, Wisconsin, EE.UU.). El plásmido de ADN purificado fue secuenciado por secuenciador de ADN (ABI Prism, Modelo 3100, Version 3.7) en la Facultad de Medicina Morehouse de Atlanta, Georgia, EE.UU..

Transfección de MCF-7 CELLS

Dos μ g de los aislados 262 bps fragmento de ADN se añadieron a 100 μ l de OPTI-MEM medio. Esta mezcla se combinó con 10 μ l de reactivo CELLFECTIN a 100 μ l OPTI-MEM medio. El combinado se mezcla suavemente mezclados e incubados a temperatura ambiente durante 30 minutos. La mezcla se incuba cuidadosamente superpuesta sobre la MCF-7 células (2 a 3 × 10 5 células en 4 mL de medio de cultivo complementados con suero) y se incubarán durante 24 horas en un CO 2 incubadora [20]. La transfección mezclas se lavaron con 2 ml de suero libre de medio de cultivo sin agentes antibacterianos. A continuación 1,8 ml de suero libre de medio de cultivo se añadió a cada tubo que contiene CELLFECTIN de reactivos de ADN complejos, mezclado suavemente, y superpuesta a las células. Las células fueron incubadas durante 24 horas a 37 ° C en un CO 2 incubadora. El ADN que contienen medio fue reemplazado con 4 ml de medio de cultivo (complementado con suero) y las células fueron incubadas a 37 ° C en un CO 2 incubadora de otras 48 horas. Las células fueron trypsinized y el ADN genómico de la transfectadas MCF-7, untransfected MCF-7 (control), y MCF-10A (de control) las células fueron aisladas utilizando DNAzol de aislamiento del ADN genómico reactivo. Amplificación del ADN de huellas dactilares se realizó tal como se mencionó anteriormente y las células se realizaron con Axiovert-25 microscopio invertido (Software: Axiovision 4,0).

Resultados

La amplificación del ADN de huellas dactilares (DAF) se utilizó la técnica de huellas digitales para generar perfiles de un humano normal de células epiteliales mamarias línea (MCF-10A) y un cáncer de mama humano línea celular (MCF-7). Cuando se compara el uno con el otro, un biomarcador de genes polimórficos (262 bps) y otros fueron identificados en MCF-10A, pero no estuvieron presentes en MCF-7 (Figura 1]. Aunque existen otros genes biomarcadores la actualidad, este estudio se centra sólo en los 262 bps biomarcador. Los otros biomarcadores será sometido a nuevos estudios.

El 262 bps biomarcador fue aislado y eliminado de la húmeda SDS-PAGE gel y ligated en la PCR II vector para obtener una cantidad suficiente de ADN para la secuencia. Se confirmó la espera biomarcador de la digestión EcoRI del vector ligated PCR II (Figura 2]. De las 30 colonias de color blanco, sólo el 8 poseía la espera polimórficos biomarcador, según lo determinado por su movimiento relativo en comparación con el marcador de peso molecular. La secuencia de nucleótidos de los biomarcadores se GCCCGTGCATAACACAAAAGAAATTGTCTAGAAAACACAAAGTACAAGAGCATAGTACTGTTAACACTATTAGCATGTACACAGTCAGTGAAAAAGCATACCCATTAGCCCTTTCTCCCTGGTGTTGGCATTTATTCTACTGCTTATTATAAGTGGTGATTTAGGGCCTGTGTAGGGAATATCAAGAAGTCTCTAAATTTGATAGTCACCAGTATTCAAAACCTTTCCTGAGAATTGACATACTAATTTATACAGCACGGGC.

Los biomarcadores se analizó la secuencia de GenBank base de datos de cuenta y reveló que el gen fue significativamente alineados con la secuencia de nucleótidos del cromosoma 12 humano BAC RP11-476D10 (19612-19353 bps) con un 100% de homología. La secuencia de nucleótidos del gen que se utilizó para su posible traducir las proteínas indicó que el gen codifica para la proteína hipotética XF2620.

Con el fin de evaluar los efectos que los 262 bps biomarcador tendría en la morfología de MCF-7 células, el MCF-7 células fueron transfectadas con los 262 bps biomarcador. No se observan cambios en la morfología de las células transfectadas. Por ejemplo, las células fueron transfectadas más alargada y menos agregados (Figura 3].

DISCUSIÓN

El biomarcador polimórficos con una secuencia de nucleótidos de 262 bps estuvo presente en el ADN genómico de la célula epitelial mamaria línea MCF-10A. Un solo arbitraria y corto oligonucleótido cebador (A25 (GCCCGTGC)) se utilizó en un DAF PCR reacción que produce unos 50 productos de amplificación. La selección de esta cartilla fue aleatorio porque no hay registro de algún otro DAF cartilla que funciona utilizando humanos células epiteliales mamarias. Un análisis detallado de los productos de amplificación demostraron que este gen es polimórfico ausente del ADN genómico del cáncer de mama línea celular, MCF-7. La diferencia entre los genomas del epitelio normal y el cáncer de mama líneas celulares es más probable debido a la supresión de los biomarcadores de genes de la célula de cáncer de mama genoma. La ausencia de este gen en el genoma de MCF-7cells puede contribuir significativamente a su cancerígenos fenómenos. La base de datos GenBank análisis de la secuencia de nucleótidos de los marcadores polimórficos (GenBank cuenta: AC079630) ha puesto de manifiesto que la adaptación de este gen tiene 100% de homología con la secuencia de nucleótidos del cromosoma 12 BAC RP11-476D10 de 19612 bps a 19532.

El análisis de este marcador de GenBank CDS indicó que la secuencia produce una alineación sensiblemente similar a la proteína hipotética XF2620. El XF2620 proteínas pueden encontrarse en el extremo distal del cromosoma 12. En informes anteriores se ha mencionado que el ADN de arquitectura factor HMGA2 del cromosoma 12 participa en un amplio espectro de tumores. Este factor de ADN arquitectónico se encuentra en o cerca del punto de break región del cromosoma 12 [21]. La supresión de nuestra polimórficos biomarcador de cromosoma 12 humano normal de las células epiteliales puede desencadenar la pérdida de control de la célula cuenta con más de la división celular mitótico, por lo tanto la generación de anomalías dentro de la normal de las células. Nos sentimos curiosidad por los efectos que los 262 bps biomarcador tendría cuando transfectadas en el genoma de MCF-7 células. La transfección experimento dio lugar a una mayor elongación y menos agregación de las MCF-7 células. Lo más probable es que la inserción de los 262 bps gen puede haber silenciado algunos de los genes responsables de la tumorigénesis en MCF-7 células.

Tenemos la esperanza de que en futuros estudios, se pondrá a prueba el potencial de nuestro primer DAF en el cáncer de mama humano sólido tejido.

Este trabajo fue apoyado por el NIH / NHLBI Grant No KO1HL03835, el SAM / Subvenciones RISE No R25GM60414 y P20CA91366.