BMC Bioinformatics, 2006; 7: 309-309 (más artículos en esta revista)

En la identificación de silico putativo promotor motivos de White Spot Síndrome Virus

BioMed Central
Hendrik Marcas (hendrikmarks@hotmail.com) [1], Xin Ying-Ren (xinying.ren @ wur.nl) [2], Hans Sandbrink [2], CW Mariëlle van Hulten (mariellevh@hotmail.com) [1] , Just M Vlak (just.vlak @ wur.nl) [1]
[1] Laboratorio de Virología de la Universidad de Wageningen, Binnenhaven 11, 6709 PD Wageningen, Países Bajos
[2] Plant Research International, Postbus 16, 6700 AA, Wageningen, Países Bajos
[3] NCMLS / Radboud University Nijmegen, Departamento de Biología Molecular, Geert Grooteplein 26/28, GA 6525, Nijmegen, Países Bajos
[4] CSIRO Livestock Industries, 306 Carmody Road, St Lucia 4067, Brisbane, Australia

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

White Spot Síndrome Virus, un miembro de la familia Nimaviridae virus, es un gran dsDNA virus que infectan a camarones y otras especies de crustáceos. Aunque se dispone de información limitada sobre el modo de transcripción, los datos anteriores sugieren que la expresión de genes WSSV se produce en forma coordinada y en cascada la moda. Para realizar una búsqueda in silico para conservadas promotor motivos (i) la abundancia de las 4 a 8 nucleótidos motivos en el sentido ascendente de WSSV secuencias de genes en relación con el genoma completo fue determinado, y (ii) un MEME búsqueda se realizó en las secuencias de aguas arriba o bien temprana o tardía WSSV genes, que le fueran asignadas por el análisis de microarrays. Ambos métodos son validados por las alineaciones de determinada empíricamente 5 'extremos de diversos WSSV mRNAs.

Resultados

La información colectiva pone de manifiesto que la región aguas arriba de principios de WSSV genes, que contiene una caja TATA y un iniciador, es similar a Drosophila ARN polimerasa II núcleo promotor secuencias, lo que sugiere la utilización de la maquinaria de transcripción celular para generar principios de transcripciones. La alineación de los 5 'termina de conocer bien establecido finales de genes, incluidos todos los principales genes de proteínas estructurales, identificó un motivo degenerar (ATNAC) que podrían estar involucrados en WSSV fines de transcripción. Para estos genes, sólo uno contenía una caja TATA funcional. Sin embargo, casi la mitad de los genes WSSV tarde, como previamente asignado por el análisis de microarrays, contiene una caja TATA en su región río arriba.

Conclusión

Los datos pueden sugerir la presencia de dos clases de fines de WSSV genes, una explotación de los celulares ARN polimerasa II sistema de síntesis de ARNm y la generación de otros mensajeros de un nuevo virus inducida por la transcripción mecanismo.

Fondo

White Spot Síndrome Virus (WSSV), el tipo de especies de virus de la familia Nimaviridae (whispovirus género), es un patógeno de gran importancia económica en cultivos de camarón penaeid [1, 2]. Estudios histopatológicos en el camarón WSSV infectadas han demostrado que el virus infecta principalmente tejidos de ectodermal y mesodermal origen, tales como el estómago, agallas, corazón, intestino, tejido muscular y el tejido hematopoyético [3 - 5]. Las células infectadas dentro de estos tejidos se caracterizan por la aparición de núcleos homogéneos hipertrofiados marginación y la cromatina [1, 5, 6]. WSSV partículas se han detectado principalmente en los núcleos de las células infectadas, lo que indica que la transcripción, replicación y virion asamblea probablemente se produzcan en el núcleo [5 - 8]. No está claro cómo los viriones son liberados desde el núcleo de una célula infectada, pero esto más probable es que se produce por gemación o por ruptura de la envoltura nuclear y / o la membrana celular.

La circular ds ADN del genoma de tres cepas WSSV, originarios de Taiwán (WSSV-TW), China (WSSV-NC) y Tailandia (TH-WSSV), han sido completamente secuenciados [9 - 11]. El genoma de WSSV-TH tiene un tamaño de 292967 pares de bases que abarca 184 marcos de lectura abierta (ORFs), que se distribuye casi a partes iguales por ambas vertientes [10]. Hasta el momento, ninguna prueba se ha obtenido para la aparición de las transcripciones longitudinalmente. Sólo una cantidad limitada de la WSSV ORFs se podrían asignar una función sobre la base de homología con genes conocidos en las bases de datos públicas [10]. En cuanto a genes implicados en la replicación y transcripción de WSSV, cuatro putativo proteínas funcionales se han anotado: a DNA helicasa (ORF9), una ADN polimerasa (ORF27), un campamento de respuesta a la proteína de unión elemento (ORF66) y una caja TATA proteína de unión (ORF149 ). Por otra parte, varios genes implicados en el metabolismo de nucleótidos, tales como subunidades de un ribonucleotide reductasa, un quimérico thymidylate-timidina quinasa, una thymidylate sintasa, un dUTPase y una endonucleasa se han identificado en el genoma [10, 11]. Aunque presente en varios otros grandes dsDNA virus, no la RNA polimerasa o de otros genes implicados en la transcripción, por ejemplo, un poli (A) polimerasa o mRNA nivelación enzimas, tienen (todavía) se identificaron en el genoma WSSV. Alrededor de 50 o menores de virion proteínas los genes han sido identificados en el genoma [12 - 15].

Tras la infección, la expresión de genes WSSV puede dividirse por lo menos en una primera y una última fase [16], mientras que también de inmediato una primera fase-pueden estar presentes [17]. El mecanismo del cambio entre (inmediato) a principios y finales de WSSV la expresión génica, así como los promotores y secuencias reguladoras implicadas, es en gran parte desconocido. Sin embargo, muchos eucariotas grandes ds ADN de virus> 100 kb tienen una estrategia coordinada y en cascada de moda la expresión de genes [18 - 21]. Baculoviruses y herpesviruses (tanto repetir en el núcleo), así como poxviruses y asfarviruses (ambos replicar en el citoplasma) expresar sus genes antes de principios de la replicación viral se inicia, al tiempo que tarde genes se expresan después del inicio de la replicación del ADN viral. Tanto la reproducción de los virus en el núcleo de acogida utilizar el ARN polimerasa II a principios de la transcripción de genes [19, 22]. Sin embargo, para fines de transcripción de genes, herpesviruses siguen explotando los celulares ARN polimerasa II sistema, al tiempo que tarde la transcripción de baculoviruses se produce una novela de la RNA polimerasa que es, al menos parcialmente, codificadas por los baculovirus genoma [22 - 24]. El virus de replicar en el citoplasma codificar su propia ARN polimerasa que sintetiza los principios, así como fines de mRNAs. Esta es la RNA polimerasa encapsidated dentro de la partícula del virus que permita la iniciación de la expresión génica viral a la llegada en el citoplasma [18, 25].

A pesar de las diferencias en la expresión génica estrategias, por encima de los virus tienen en común que los motivos específicos de nucleótidos que participan en la transcripción de iniciación, de expresión y de expresión cinética de nivel se han identificado en el sentido ascendente de las regiones genes individuales. Bien conocido promotor elementos utilizados por muchos virus son la caja TATA y la secuencia de iniciador, que está situado en o cerca del sitio de iniciación de la transcripción (TIS). Se postula que el promotor conserva motivos desempeñar un papel importante en la regulación de la transcripción de WSSV, y que pueden ser identificados por análisis in silico de las regiones de aguas arriba WSSV genes. Tan importante promotor motivos son excesivamente en el 5 'upstream baculoviruses regiones de los genes [26], se estudió la abundancia relativa de las 4 a 8 nucleótidos motivos en el sentido ascendente de las regiones WSSV genes en comparación con el WSSV completa secuencia genómica. Esta enumeración estrategia fue validada mediante el ensayo de los eucariotas grandes ds ADN virus antes mencionados. A fin de identificar elementos reguladores, la composición de nucleótidos en las regiones de aguas arriba WSSV principios y fines de los genes, las que le fueran asignadas por microarrays [16], se estudia la utilización MEME [27]. MEME es un algoritmo que busca los motivos conservados en un conjunto seleccionado de secuencias, en este caso la subida de las regiones WSSV ORFs. Experimental apoyo a la in silico resultados se obtiene por alineaciones de 5 'termina de conocer WSSV temprana, así como fines de transcripciones. Estos alineamientos TISS incluyen mapas de 5'RACE (Rapid de amplificación de cDNA Ends) en estudios anteriores, así como dos recién determinará TISS de los principales genes de proteínas estructurales ORF112 y ORF160. Polyadenylation de WSSV principios y fines de los genes es estudiado por la adaptación de la poli (A) los sitios. El uso de este enfoque, hemos sido capaces de encontrar más apoyo a la presencia de agrupaciones coregulated de WSSV genes, así como para predecir putativo promotor WSSV elementos que intervienen en la expresión génica de estas agrupaciones.

Resultados
Promotor análisis utilizando el método de enumeración

En la búsqueda de WSSV putativo promotor elementos de regulación, se comparó la abundancia de las 4, 5, 6, 7 u 8 de nucleótidos motivos en los 100 y 200 nt aguas arriba de todas las secuencias de genes WSSV en relación con su presencia en todo el WSSV secuencia genómica. Este método se denomina método de la enumeración en el resto del artículo. Para la validación, esta enumeración método se aplicó en las secuencias del genoma del tipo de especies más ampliamente estudiado gran ds ADN virus se mencionó en la introducción: AcMNPV AcMNPV (Autographa californica Multinucleopolyhedrovirus; Baculovirus), virus herpes humano tipo 1 (HHV1; Herpesvirus), Vaccinia virus (poxvirus) y La peste porcina africana Virus (ASFV; Asfarvirus).

MEME

Los 100 o 200 nt secuencias ascendentes de todos los genes WSSV fueron también estudiados por MEME (Cuadro 2]. Como múltiples clases de genes virales coregulated estará presente dentro de estas secuencias, MEME la configuración de este análisis se conservan para identificar los motivos, independientemente de si se produjo en la parte de arriba de todas las regiones de genes. MEME identificado la caja TATA consenso como motivo de nucleótidos en estas secuencias WSSV aguas arriba (Tabla 2]. Además, este análisis mostró que aguas arriba múltiples secuencias contienen tramos de residuos T (Tabla 2]. Análisis sobre la ubicación y la composición de estas secuencias reveló que estas son en su mayor parte de las señales polyadenylation [32] de la ORFs aguas arriba, y, por tanto, probablemente no funcional como elemento promotor de WSSV. El resultado de la 100 y 200 nt aguas arriba secuencias son muy similares, de acuerdo con los resultados del método de enumeración.

Para un análisis individual de los WSSV temprana o tardía cinética grupo [16] la frecuencia de un motivo específico por cada secuencia se ha fijado en uno, ya que la mayoría de WSSV genes pertenecientes a un grupo se consideraron coregulated. El análisis de los 100 y 200 nt regiones de aguas arriba o bien los primeros o los fines de clase genes identificados el consenso TATA cuadro como elemento promotor putativo (Cuadro 2]. Anteriormente, ya que mostró que el 37 de los 64 principios de genes (58%) y 28 de los 58 genes que agrupan tarde (48%) contienen un consenso TATA casilla [16]. Específicas para la pronta clase, MEME identificado las secuencias de consenso CAACATCA y AGAAT, mientras que para los fines de clase identificó la secuencia consenso AFCC, así como un A-rica región (cuadro 2]. Por otra parte, como la temprana o tardía cinética grupo [16] también podría consistir en subconjuntos de coregulated WSSV genes, un MEME análisis se realizó en un motivo que sólo tuvo que ocurrir en al menos la mitad de las secuencias de aguas arriba o bien el principios de la tarde o los genes. El resultado fue muy similar a los resultados presentados en la Tabla 2. Es interesante señalar que la caja TATA y la AFCC motivo fueron identificados por el método de enumeración de ser altamente enriquecido en las regiones de aguas arriba WSSV ORFs.

Alineaciones TISS de WSSV genes

Para validar tanto en silico métodos descritos anteriormente, se compararon los resultados con las alineaciones de todos los 5 'extremos del WSSV temprana y tardía clase de genes. Para facilitar las comparaciones con otros virus, en estos alineamientos la función de la proteína codificada por el gen se utiliza para determinar su clase, ya sea temprana o tardía. Los primeros genes que codifican las enzimas a menudo que tienen funciones en procesos tales como el metabolismo de nucleótidos, la replicación del ADN, proteínas modificación, la transcripción viral inicio de acogida y respuesta de modulación. Proteínas estructurales virion genes a menudo abarcan una gran parte de finales de los genes virales. Para casi todos los WSSV genes analizados, esta clasificación coincide con los resultados obtenidos por el estudio de microarrays [16].

Polyadenylation

Por diversas WSSV genes, el sitio de polyadenylation ha sido mapeado usando 3'RACE. Hemos ampliado este análisis de la cartografía polyadenylation sitio de ORF30, el colágeno-como ORF de WSSV [40]. Polyadenylation de ORF30 comienza 32 nt después de la traducción codón de parada, 16 nt después de la primera poli (A)-señal (secuencia AATAAA; Fig. 2b] [41].

Fig. 4 muestra una alineación de todos los sitios conocidos polyadenylation de WSSV. Polyadenylation generalmente comienza dentro de 11-19 nt después de un consenso polyadenylation sitio. Típicamente, una región rica T (tramo de aproximadamente doce residuos T) fue identificado 8 nt abajo de la poli (A) in situ (Fig. 4]. No parece haber diferencia entre los sitios de polyadenylation principios y fines de genes (Fig. 4]. Un total de 9 genes WSSV se rechazaron por no-polyadenylated [13, 42]. Con excepción de vp12a (WSSV-TH ORF34), todos estos genes falta un consenso poli (A)-en señal de -50 a 300 nt de su traducción codón de parada. Dos (vp31 y vp13b codificados por WSSV-TH ORF163 y ORF155, respectivamente), sin embargo, contienen la secuencia ATTAAA dentro de esta región, que en los vertebrados es a menudo suficiente para polyadenylation [43], pero al parecer no en invertebrados o artrópodos.

Discusión

En este trabajo, hemos utilizado una nueva enumeración estrategia basada en un modelo propuesto por Brazma et al. [44] para identificar putativo promotor WSSV elementos. Un conjunto de scripts de ordenador ha sido diseñado, que calcula la diferencia de frecuencias motivo de nucleótidos en la parte de arriba de todas las secuencias de genes en comparación con el WSSV completa secuencia genómica. La razón detrás de este análisis es que el promotor motivos son a menudo piensa que el factor de transcripción sitios de unión, que son funcionales aguas arriba de los genes. Los resultados obtenidos con el gran bien estudiados ds ADN virus AcMNPV AcMNPV, HHV1, virus Vaccinia y ASFV (Tabla 1] demuestran que nuestro método es robusto en la identificación de importantes elementos del promotor completamente secuenciado los genomas virales sin conocimiento a priori, ya que estas son a menudo enriquecido aguas arriba en las secuencias de ORFs virales. Por lo tanto, este nuevo método de enumeración puede ser útil en el análisis de recién secuenciado los genomas de los grandes virus DNA ds. Para un análisis más detallado de las regiones de aguas arriba WSSV genes de los principios y finales de grupo, que le fueran asignadas por el análisis de microarrays [16], se utilizó MEME. Los genes de una u otra agrupación podría ser coregulated de mecanismos similares, la utilización de motivos conservados de nucleótidos. Como MEME pueden identificar los motivos que han de producirse en cada secuencia de un conjunto de secuencias presentadas, o en un número seleccionado de secuencias presentada, es muy complementaria a la enumeración método. Otra ventaja de MEME es que puede degenerar identificar los motivos.

La enumeración método identificado varios motivos de nucleótidos (Tabla 1] que también fueron identificados por MEME (Tabla 2] y por los alineamientos de determinado experimentalmente 5 'extremos de WSSV mRNAs (Figs. 1 y 3]. Entre ellos figuran el consenso TATA box, así como el motivo de nucleótidos AFCC. Sin embargo, también otros motivos de nucleótidos que no fueron validados con los otros métodos, por ejemplo, algunos motivos ricos en C o G residuos, son (muy) enriquecido en WSSV aguas arriba y regiones pudieran estar implicados en la transcripción WSSV. De conformidad con los alineamientos se muestra en Figs. 1 y 3, donde la mayoría de putativo promotor elementos se encuentran a menos de 100 nt antes de los ORFs, los motivos de nucleótidos identificado con el método de enumeración son más acusados en los 100 nt antes de los ORFs (Tabla 1 ), Frente a 200 nt. Esto sugiere que, de forma similar a AcMNPV AcMNPV, la mayoría de WSSV promotor elementos se encuentran a menos de 100 nt antes de empezar la traducción codones, que es un reflejo del apretado paquete de genes a lo largo del genoma WSSV. Sería de interés para probar la funcionalidad de las secuencias (a / c) TCANT y ATNAC, que fueron identificados como el consenso de la TISS WSSV temprana y tardía clase de genes, respectivamente (Fig. 3] y otros motivos identificados (Tabla 1 ) A un reportero de genes (por ejemplo, luciferase) ensayo. Para las pruebas finales de los promotores de esta instalación, una co-infección con WSSV debe considerarse que la oferta adicional viral factores de transcripción necesarios para fines de la expresión génica. A falta de un adecuado sistema de células de WSSV, estos genes reportero ensayos se han realizado en los insectos artificiales Sf9 línea celular [17, 33, 45], con todas sus limitaciones a la interpretación de los resultados. Sin embargo, con los últimos acontecimientos relacionados con la diferenciación y el crecimiento de cangrejo de las células madre hematopoyéticas in vitro [46], estos experimentos podrían ser realizadas en cultivos de células de cangrejos de río proporcionar un más cómodo y homóloga sistema.

La identificación de (putativo) promotor elementos proporciona más conocimiento de los mecanismos de la transcripción de WSSV utilizado. La presencia de un cuadro de consenso TATA temprana para la mayoría de los genes, así como una transcripción inicio conservadas motivo similar a la Drosophila iniciador WSSV sugieren que utiliza el anfitrión ARN polimerasa II transcripción maquinaria para la generación de principios de transcripciones, como también propuesto por Chen et al. [47] y Liu et al. [42]. Previo análisis de WSSV fines de genes no pueden revelar fácilmente cualquier aparente elemento dominante de nucleótidos utilizados para WSSV fines de la expresión génica [31]. Usando la nueva agrupación de microarrays disponible [16], podríamos ahora muestran que aproximadamente la mitad de la tarde WSSV putativo genes contienen un consenso TATA box. Esto sugiere que podría explotar WSSV celular ARN polimerasa II sistema no sólo para la pronta, sino también por (parte de) sus fines de mRNA de síntesis, similar a algunos otros virus ADN ds como herpesviruses [22]. Sólo uno de los 8 principales proteínas estructurales virion genes, que se expresan en la fase tardía de la infección viral y lo más probable es co-regulado para garantizar el montaje correcto de la virion, contiene un cuadro de consenso TATA. Alineación de los 5 'extremos de los 8 principales proteínas estructurales de los genes identificados un nuevo consenso transcripción inicio del sitio, ATNAC, aguas abajo de un A / T rica región. El análisis in silico más apoya la observación de que los dos componentes podrían ser los elementos finales de promotor. Esto sugiere una segunda vía para WSSV fines de la expresión génica, similares a los fines de la expresión de genes identificados para la estrategia baculoviruses [23, 24]. Sin embargo, a diferencia de baculoviruses, los genes virales necesarios para este itinerario, tales como la RNA polimerasa o fines de factores de transcripción, no han sido identificados en el genoma WSSV [10, 11]. Estos genes podrían ser, sin embargo, demasiado divergentes de homólogos conocidos que se encuentran sobre la base de homología de aminoácidos.

Las alineaciones de la 3 'extremos de WSSV mRNAs sugieren que no hay diferencia en polyadenylation entre principios y finales de mRNAs. El WSSV polyadenylation características de ambos se asemejan a las clases regulares polyadenylation en mRNAs eucarióticos, que se encuentra típicamente de 10 a 25 nt río abajo de la secuencia AATAAA [41, 43]. También oligo-T se extiende a menudo se presente alrededor de 30 nt río abajo de la poli (A)-señal de los genes eucariotas [32]. Estos datos indican que utiliza el WSSV regular enzimas celulares para polyadenylation de mRNAs. Sin embargo, otras vías indefinido señal de polyadenylation también podría ser utilizado, ya que dos genes WSSV (dUTPase y TDS) se encontraron polyadenylated sin un poli (A)-la señal actual [42, 48].

Conclusión

Utilizando un enfoque combinado de análisis in silico y determinado experimentalmente datos sobre WSSV transcriptomics, más apoyo se encontró la presencia de diferentes clases coregulated de WSSV genes. Las comparaciones con otros grandes ds ADN virus siempre una idea en la transcripción mecanismo de estas clases y putativo promotor motivos implicados. Con el fin de determinar la funcionalidad de estos motivos empíricamente los sistemas de cultivo celular de la gamba se han de seguir desarrollándose.

Métodos
La infección por el virus

La cepa utilizada en este estudio, conocido como WSSV-TH (acc.no. AF369029), se origina a partir de infectados camarón Penaeus monodon obtenidos en Tailandia en 1996 y fue tratado como se describe antes [15]. Cangrejo Orconectes limosus se inyectó por vía intramuscular con WSSV purificado utilizando un calibre de 26 agujas para iniciar la infección. Tres días después de la infección (dpi), el cangrejo se congelaron en nitrógeno líquido y se almacenan a -80 ° C hasta su posterior utilización.

5 'y 3' rápida amplificación de cDNA extremos (5 '/ 3' RACE)

Ambos 5 'y 3' RACE se llevaron a cabo utilizando un comercial de 5 '/ 3' RACE kit (Roche) a raíz de las instrucciones del fabricante. Total RNA se aisló de las agallas de tejidos congelados de tres infectados cangrejo O. limosus (3 cosechada dpi), tal como se describe antes [31]. En caso de la 3 'RACE de ORF30, primer capítulo de cDNA fue sintetizado utilizando la oligo (dT) primer ancla. El cDNA resultante fue amplificado utilizando una cartilla con interés específico (ORF30-CARRERAS-F1: CAGACCCGATTACAGTAGCAG; WSSV-TH ubicación: 48983-49003) y la primer ancla. Para los 5 'RACE de ORF112 y ORF160, el RACE-R1 primers se mencionan a continuación fueron utilizados para la síntesis de ADNc. Este cDNA fue purificado utilizando el Alto puro producto de PCR Purificación Kit (Roche) y un homopolymeric 3 'd (A)-cola fue agregado a la cDNA en una mezcla con un volumen total de 20 μ l, con terminal transferasa y dATPs incluidos en el kit. Esta mezcla (5 μ l) fue utilizado en una PCR, realizada con un oligo (dT) ancla básico y una anidados RACE-R2 cartilla (ver más abajo). Los productos finales de los 5 'y 3' RACE fueron clonados en el pGEM-T fácil vector (Promega) y secuenciados. Por cada 5 'y 3' RACE al menos 3 clones fueron secuenciados. Primers utilizados para 5 'CARRERA: ORF112-RACE-R1: CGCATATTGTTGTTTGTCGTAG (WSSV-TH ubicación 168230-168209); ORF112-RACE-R2: GACGCGTATCTCAAGTATTCC (WSSV-TH ubicación 168184-168164); ORF160-RACE-R1: CTTGTTGGATTCGGAGCAGTG (WSSV - TH ubicación 240137-240117); ORF160-RACE-R2: GACGGATAATATGGGTGACAAG (WSSV-TH ubicación 240111-240090).

Secuenciación del ADN y análisis informático

Plásmido clones llevar RACE productos fueron secuenciados a la empresa BaseClear (Países Bajos), utilizando universal M13 adelante y atrás primers. Secuencia de los datos fueron analizados mediante el paquete de software DNASTAR4.2. Todas las secuencias de datos se editaron y alineados en GeneDoc, versión 2.6.000 [49].

Promotor análisis utilizando el método de enumeración

Un conjunto de scripts de ordenador, formuladas en el ordenador lenguaje de programación Perl (ver [50] para más información), fue diseñado para analizar todos los 4, 5, 6, 7 u 8 de nucleótidos motivo de frecuencias en los 100 y 200 nt aguas arriba de secuencias ( putativo) ORFs los compare con una completa del genoma viral. En caso de WSSV, el genoma de WSSV-TH como anotado por van Hulten et al. [10] fue utilizado para el análisis. Por WSSV y Autographa californica Multinucleopolyhedrovirus (AcMNPV AcMNPV), los genes y las regiones aguas arriba de los genes que están parcial o completamente situada en la regiones homólogas (hrs hrs, regiones genómicas que consta de un gran tándem se repite; para WSSV se trata de 24 genes, para AcMNPV AcMNPV 3 genes) y el propio hrs hrs se excluyeron del análisis para evitar la posibilidad de encontrar falsos motivos, debido a la alta homología de las secuencias hr. Como motivos de nucleótidos con una función reguladora se espera que estén presentes en múltiples regiones río arriba, sólo los motivos que estaban presentes en aguas arriba secuencias de al menos 5 ORFs fueron analizados después de ejecutar los scripts. Scripts fueron utilizados para los siguientes procedimientos: (1) la extracción de aguas arriba de la región ante el seleccionado ORFs, tanto en el + y - capítulo; (2) cálculo de los X-mer motivo de frecuencias de nucleótidos en el sentido ascendente regiones; (3) cálculo de la X-mer motivo de los sucesos de nucleótidos en las dos vertientes del genoma viral (sin hrs hrs); (4) cálculo de la proporción relativa de la misma X-dores entre la parte de arriba y las regiones del genoma viral; (5) de la clasificación relativa coeficientes para cada X-mer de alto a bajo; (6) exclusión de los motivos presentes en menos del 5 regiones río arriba. Adhesión número de genomas fueron analizados AcMNPV AcMNPV [GenBank: L22858 ; NC_001623 ]; Virus herpes humano tipo 1: HHV1 [GenBank: X14112 ; NC_001806 ]; Vaccinia virus [GenBank: M35027 ]; La peste porcina africana de virus: ASFV [GenBank: U18466 ; NC_001659 ]) Y WSSV [GenBank: AF369029 ]. El análisis estadístico se realizó por suponiendo una distribución normal de enriquecimiento de los motivos de nucleótidos de cada uno de los virus analizados. P ≤ 0,05 en caso de que el enriquecimiento de un cierto motivo superior a dos veces la desviación estándar de la media de enriquecimiento.

MEME

El programa de ordenador utilizando Motif Elucidación máxima Expectativa maximización (MEME; disponible en [51]] se utilizó para buscar artículos específicos secuencia de motivos de cada 100 o 200 nt del WSSV noncoding secuencias de aguas arriba del codón de iniciación de traducción. MEME análisis se realizó mediante la secuencia de WSSV-TH anotado por van Hulten et al. [10]. La búsqueda se realizó para los 3 mejores motivos con una longitud de 4-8 nt. En el caso de analizar las secuencias de aguas arriba del WSSV ORFs en general, la ocurrencia de un motivo específico para cada secuencia se ha fijado en cero a uno, pero el motivo tenía que ocurrir por lo menos en 60 regiones río arriba. En el caso de análisis de aguas arriba WSSV secuencias de genes pertenecientes a la temprana o tardía cinética agrupaciones, la frecuencia de un motivo específico por cada secuencia se fijó en uno. El 5 'noncoding regiones se clasifican de acuerdo a la clase de expresión [16]: Temprano (ORF2, ORF8, ORF9, ORF11, ORF12, ORF15, ORF16, ORF23, ORF24, ORF25, ORF29, ORF37, ORF49, ORF53, ORF55, ORF56, ORF58, ORF60, ORF61, ORF66, ORF67, ORF69, ORF70, ORF74, ORF81, ORF85, ORF89, ORF91, ORF92, ORF93, ORF98, ORF99, ORF101, ORF103, ORF107, ORF111, ORF112, ORF115, ORF116, ORF117, ORF125, ORF126, ORF127, ORF131, ORF132, ORF142, ORF145, ORF146, ORF147, ORF152, ORF156, ORF159, ORF160, ORF161, ORF164, ORF165, ORF169, ORF170, ORF171, ORF172, ORF173, ORF177, ORF178, ORF179) y Tardío (ORF1 , ORF3, ORF4, ORF7, ORF10, ORF14, ORF27, ORF28, ORF30, ORF31, ORF32, ORF33, ORF34, ORF35, ORF36, ORF38, ORF39, ORF41, ORF43, ORF44, ORF54, ORF57, ORF65, ORF72, ORF73, ORF75 , ORF76, ORF77, ORF79, ORF80, ORF84, ORF90, ORF94, ORF95, ORF100, ORF109, ORF113, ORF114, ORF118, ORF119, ORF120, ORF121, ORF128, ORF129, ORF130, ORF134, ORF135, ORF136, ORF143, ORF148, ORF151 , ORF153, ORF157, ORF167, ORF168, ORF182, ORF183, ORF184).

Autores de las contribuciones

HM participado en el diseño de la computadora guiones para el método de enumeración y se lleva a cabo la mayor parte de los análisis en los guiones que se utilizaron, realizó el análisis MEME, la infección por el virus, el 5 'y 3' RACE experimentos incluyendo la secuenciación, escribió y / revisado el manuscrito. XYR SA y diseñado y programado la computadora scripts antes mencionados. MCWvH concebido y JMV del estudio, participaron en su diseño y la coordinación y la ayudó a redactar el manuscrito. Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

Esta labor fue apoyada por Intervet International BV, Boxmeer, Holanda. Damos las gracias al Profesor Dr Rob Goldbach de interés continuo y asesoramiento.