Neural Development, 2006; 1: 3-3 (más artículos en esta revista)

El factor de transcripción homeobox Incluso-omiten regula la adquisición de propiedades eléctricas en las neuronas Drosophila

BioMed Central
Edward CG Pim (Edward.Pym @ gmail.com) [1], Tony D Southall (tds29@cam.ac.uk) [2], Christopher J Mee (cjmee@bham.ac.uk) [1], Andrea H Marca (ahb@mole.bio.cam.ac.uk) [2], Richard A Baines (RBaines@bio.warwick.ac.uk) [1]
[1] Grupo de Neurociencias, Departamento de Ciencias Biológicas, Universidad de Warwick, Coventry CV4 7AL, UK
[2] El Gurdon Institute y el Departamento de Fisiología, Desarrollo y Neurociencia de la Universidad de Cambridge, Tennis Court Road, Cambridge CB2 1QN, Reino Unido

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

Si bien los procesos de desarrollo como el pathfinding axón y la formación de sinapsis se han caracterizado en detalle, es comparativamente menos conocido de los mecanismos intrínsecos de desarrollo que regulan la transcripción de genes de canales de iones en las neuronas embrionarias. Primeras decisiones que se adopten, incluyendo la orientación motoneuron axón, son orquestados por una cohorte de factores de transcripción que actúan juntos en una combinatoria. Estos incluyen factores de transcripción-Incluso omitido (Eva), islote y Lim3. El perdurance de estos factores a finales de neuronas embrionarias es, sin embargo, indicativo de que podrían también regulan otros aspectos de la neurona desarrollo, incluida la adquisición de propiedades eléctricas.

Resultados

Para probar la hipótesis de que una combinatoria código factor de transcripción es también capaz de influir en la adquisición de propiedades eléctricas en las neuronas embrionarias que utilizan la genética molecular de Drosophila para manipular la expresión de Eva en determinadas motoneuronas. Nos muestran que el aumento de expresión de este factor de transcripción, en dos Eve-positivas motoneuronas (CAC y RP2), es suficiente para afectar las propiedades eléctricas de las neuronas en estos principios del primer estadio las larvas. En concreto, se observó una disminución tanto en el rápido K + conductancia (I Kfast) y la amplitud de quantal entrada sináptica colinérgica. Se utilizó charybdotoxin farmacológicamente para separar los distintos componentes de I Kfast para mostrar que el aumento de Eva regula específicamente en el Slowpoke (BK Ca 2 +-garse canal de potasio), pero no Shal, componente de esta corriente. Identificación de genes objetivo de Eva, utilizando ADN adenina metiltransferasa identificación, puesto de manifiesto el decidido sitios de unión a slowpoke y nAcR α-96 bis (a los receptores nicotínicos de la acetilcolina subunidad). Verificación mediante PCR en tiempo real muestra que pan-neuronal vísperas de expresión es suficiente para reprimir las transcripciones para ambos slo y nAcR α-96 bis.

Conclusión

Tomados en conjunto, nuestros resultados demuestran, por primera vez, que Eva es suficiente para regular tanto el voltaje y ligando-garse corrientes en motoneuronas, la ampliación de su conocido repertorio de acción más allá de su función ya se caracteriza por la orientación axón. Nuestros datos son también consistentes con un programa común de desarrollo que utiliza un conjunto definido de factores de transcripción para determinar tanto morfológicas y funcionales propiedades neuronales.

Fondo

El desarrollo de propiedades eléctricas en las neuronas embrionarias se debe probablemente a factores intrínsecos y extrínsecos a la persona células. Factores intrínsecos será determinado por el linaje clonal de las neuronas individuales [1], mientras que la exposición a factores externos, tales como la actividad sináptica, neuroglia derivada de factores y modificaciones sensoriales, probablemente la forma final eléctrico fenotipo [2 - 5]. De este modo, la combinación particular de cada uno de los conductances expresadas por las neuronas es probablemente un producto no sólo de la expresión de genes regulados, sino también de actividad que dependen de los mecanismos de influencia que, junto función a través de canal de distribución subcelular, densidad relativa y post-translacional modificaciones [6, 7].

Una cuestión clave que sigue sin resolverse, sin embargo, es cuánto circuito tuning surge de la determinación genética en lugar de actividad que dependen de mecanismos. Recientes estudios de simulación indican que predominan los factores extrínsecos teniendo en cuenta que distinguir la actividad de la red pueden surgir de muy dispares de las distintas combinaciones conductances [8]. Sin embargo, estos análisis se basan en las neuronas que están ya los componentes funcionales de las redes. En comparación, en las primeras etapas de su desarrollo, las neuronas embrionarias son en gran parte privados de factores extrínsecos como la actividad sináptica y la información sensorial. Es en esta fase relativamente temprana de desarrollo eléctrico que la determinación genética es probable que predominan para garantizar, como mínimo, la expresión de un conjunto predeterminado de canal iónico proteínas. Sólo después de una neurona tiene la capacidad de contribuir a una red puede operar con otros, en gran medida los factores extrínsecos, comenzar a dar forma a la mezcla final de los canales iónicos expresó.

Una gran cantidad de estudios de motoneuron pliego de condiciones, en una serie de animales de gusanos a los mamíferos, ha puesto de manifiesto que la subclase identidad está dictada, en parte, por una combinatoria código de factores de transcripción [9]. Por ejemplo, en el embrión de Drosophila, los aproximadamente 36 motoneuronas en cada hemi-abdominal segmento de expresar una mezcla de estereotipados identificado factores de transcripción que son conservadas evolutivamente con los mamíferos [10 - 14]. Motoneuronas que predominantemente innervate ventral y lateral de los músculos expresar la LIM-homeodominio factor de transcripción de genes y lim3 islote junto con Hb9, mientras que motoneuronas proyecto para que los músculos dorsales expresar el factor de transcripción de genes-incluso saltan (vísperas) [9, 14, 15]. Teniendo en cuenta que motoneuron axón orientación combinatoria se encuentra bajo control de un conjunto de factores de transcripción, este estudio trata sobre si la adquisición de propiedades eléctricas, por lo menos en el desarrollo temprano, podría ser igualmente influenciada por estas mismas proteínas reguladoras.

Se utilizó la expresión génica orientados a aumentar el nivel de Eva, a sólo dos positivos Eva-motoneuronas (CAC y RP2), y demuestran que esto es suficiente para obtener reducciones tanto en el voltaje-gated K + actual y la acetilcolina (ACh)-garse corrientes sinápticas. Atribuimos la reducción de las corrientes de K + a una reducción en el actual transportadas por SLO. Se identificaron los sitios de unión para Eva utilizando ADN adenina identificación metiltransferasa (DamID). Nuestro análisis identificó un grupo de genes objetivo putativo, que incluye los de codificación para el voltaje-gated K + canal SLO y ligando-garse nicotínicos ACh nAcR subunidad α-96 bis. Que Eva es capaz de transcriptionally represión de estos genes objetivo es verificado por PCR cuantitativa (QRT-PCR). Nuestros resultados muestran que un factor de transcripción, que se sabe que son necesarios para la correcta elección de axonal pathfinding, también es suficiente para influir en la adquisición de propiedades eléctricas en las neuronas, lo que indica que tanto morfológicas y funcionales en el desarrollo embrionario neuronas son controladas por mecanismos de regulación común.

Resultados
El aumento de Eva altera las propiedades eléctricas en motoneuronas

El CAC motoneuronas y RP2 expresar el factor de transcripción Eva, que es necesario para la orientación adecuada axón durante la embriogénesis temprana [15]. Esta observación forma parte del cuerpo de evidencia que sustenta la hipótesis de que una combinatoria código de factor de transcripción expresión orquesta axonal pathfinding y objetivo elección de motoneuronas [9, 16]. Es notable, sin embargo, que la víspera de expresión puede ser detectada después de estos procesos anteriores han resuelto [17], lo que indica que también puede regular los aspectos adicionales de desarrollo de neuronas. Un aspecto más evidente en los últimos tiempos el desarrollo neuronal es la adquisición de propiedades eléctricas.

Para probar esta hipótesis, manipulado la expresión de la víspera en motoneuronas CAC y RP2 (utilizando RN2-O GAL4) y se utiliza todo el parche de células grabaciones para determinar las consecuencias. Nuestra elección de motoneuron se guió por el hecho de que aCC/RP2 endógena expresar vísperas [18] y la manipulación de su expresión, por lo tanto, modificarse en consecuencia electrofisiología si este factor de transcripción contribuye a la fijación de propiedades eléctricas en estas neuronas. La sobreexpresión de la víspera, en aCC/RP2, es suficiente para perturbar de tipo salvaje propiedades eléctricas. De la tensión-gated conductances examinados, sólo el pico rápido K + conductancia (I Kfast) se redujo significativamente (78,6 ± 4,0 frente a 62,3 ± 8,4 pA / pF, medido a +45 mV, p ≤ 0,05), mientras que Kslow I, I Na y Ca no fueron afectadas (Figura 1a, b]. Análisis de la actual tensión (IV) para las parcelas I Kfast no muestran cambios obvios en la activación, como cabría esperar si la reducción de los picos de amplitud de esta corriente se debió a un cambio de voltaje de la dependencia de la activación (Figura 1c]. Control de las grabaciones se hicieron desde RN2-O / + (que son idénticos a los controles alternativos de Cantón-S de tipo salvaje y RN2-O GAL4/UAS-GFP; ECG Pim y RA Baines, datos no publicados).

Dos productos genéticos se sabe que contribuyen a I Kfast en el centro de las neuronas en Drosophila: Shal y SLO [19, 20]. Para determinar cuál de estos componentes se ve afectada por la sobre expresión de la víspera, utilizado charybdotoxin (ChTX), que es un bloqueador selectivo de SLO tanto en Drosophila neuronas y músculo [21]. En presencia de ChTX (200 nM), en Kfast de tipo salvaje aCC/RP2 se redujo en un 22% (87,9 ± 4,6 frente a 61,2 ± 6,0 pA / pF, p ≤ 0,05; Figura 1c, d]. La eliminación de extracelulares de Ca 2 +, la afluencia de que se requiere para activar SLO, se tradujo en una reducción similar (36%, 55,8 ± 3,2 pA / pF), en consonancia con el bloqueo de ChTX sólo el SLO mediada por componente de I Kfast (datos no muestra). Tras más de la expresión de las vísperas, la adición de ChTX no está en condiciones de reducir aún más la magnitud del pico Kfast I (62,3 ± 8,4 frente a 65,4 ± 4,8 pA / pF; Figura 1c, d]. La incapacidad de ChTX a afectar I Kfast en estas condiciones es coherente con la reducción de la conductancia de la presente, debido a la sobre-expresión de la víspera, se debe a una disminución en la actual llevada principalmente por SLO y no de Shal.

El aumento de Eva altera potencial de acción disparando a motoneuronas

Para probar la forma de expresión de la víspera podrían afectar a la producción orgánica, se determinó la excitabilidad intrínseca de membrana (es decir, capacidad para disparar potenciales de acción (AP)) de inyección de corriente constante. Nuestra predicción, sobre la base de lo observado y cambio específico en I Kfast después de más de expresión en vísperas de aCC/RP2, es que estas motoneuronas sería más excitables. El potencial de membrana de las neuronas individuales aCC/RP2 se mantiene en -60 mV de inyección de hyperpolarizing actual (normal en reposo potencial de membrana es -43,5 ± 1,9 mV [22]] y luego utilizan inyecciones de corriente constante despolarizante (10 pA/500 ms) para inducir la AP disparando. Excitabilidad se determinó contando AP dispararon. Esta medida pone de manifiesto que el cambio en I Kfast es, en efecto, asociado a un pequeño pero significativo aumento de la excitabilidad en aCC/RP2 (19,6 ± 1,0 frente a 1,6 ± 24 AP, 10 pA/500 ms, p ≤ 0,05; Figura 2]. El potencial de membrana inducido por esta corriente de inyección (medido por la presencia de 1 mM tetrodotoxin (TTX) para eliminar disparando AP) no fueron significativamente diferentes entre las dos condiciones (-33 ± 4 frente a -36 ± 2,5 mV, experimental frente a control, p > 0,05, datos no presentados). Por ello, no es evidente cambio en la resistencia de entrada que podría explicar el aumento de excitabilidad debido a despolarizante actuales inyecciones. Además de ChTX (200 Nm), un bloqueador de I kslo, de tipo salvaje aCC/RP2 también es suficiente para inducir un aumento comparable en la excitabilidad de membranas (19,6 ± 1,0 frente a 22,5 ± 0,9 AP, 10 pA/500 ms, p ≤ 0,05; Figura 1d].

El aumento de Eva postsináptica regula la sensibilidad a neurotransmisores excitatorios

También medido a la entrada sináptica aCC/RP2 después de más de la expresión de las vísperas en sólo estas neuronas y observó un descenso significativo en la amplitud del potencial de acción que dependen de las corrientes sinápticas (89,2 ± 4,1 frente a 76,0 ± 2,5, PA, p ≤ 0,05; Figura 3a]. La mayoría de parsimonious explicación de este efecto, dado que la víspera de expresión es totalmente postsináptica, es que la reducción de la sensibilidad postsináptica a ACh. Motoneuronas de Drosophila primera estadio las larvas de recibir totalmente excitación sináptica colinérgica [23]. Para probar esta predicción, que mide espontánea en miniatura (mini) las corrientes sinápticas, que son el resultado del potencial de acción independiente de la liberación presináptica de interneuronas colinérgicas (es decir, la liberación que persiste en presencia de 1 μ M TTX). Análisis de los ministerios muestra una disminución significativa en la amplitud en aCC/RP2 en vísperas que es más-expresó en comparación con los controles (8,32 ± 0,26 frente a 7,53 ± 0,22, PA, p ≤ 0,05; Figura 3b]. Probabilidad acumulativa de las parcelas, que mejor muestran la distribución de mini amplitudes, mostró un marcado cambio de izquierda, lo que indica que la gran mayoría de los ministerios registrada exposición reducida amplitud después de más de la expresión de las vísperas (Figura 3c]. Esta reducción es predictivo de una disminución de la sensibilidad postsináptica de ACh, un efecto que es coherente con una reducción funcional de los receptores colinérgicos.

Los niveles de Eva son importantes para el establecimiento de propiedades eléctricas

Teniendo en cuenta que el exceso de expresar víspera es suficiente para disminuir tanto me Kfast y mini amplitud en aCC/RP2, se pregunta si la reducción de vísperas expresión daría lugar a efectos opuestos a estas dos características eléctricas. La remoción completa de vísperas de aCC/RP2, aunque deseable, no es posible sin alterar significativamente la morfología celular y, posiblemente, como una consecuencia indirecta, propiedades eléctricas [18] (ECG también Pim y RA Baines, observaciones no publicadas). Para eludir esto, se utilizó una sensible a la temperatura vísperas alelo (vísperas 1 D 19) utilizado anteriormente para remover de la función Eva [15]. Nos permite vísperas 1 D 19 / CYO embriones, mantenerse a 20 ° C (temperatura permisiva) a escotilla a la primera estadio las larvas (de aCC/RP2 tiempo que han desarrollado su morfología) y luego se trasladó a unos 30 ° C (temperatura restrictiva), mientras que el resto se mantuvieron a 20 ° C (ver Materiales y métodos para más detalles). No hemos podido utilizar homocigotos vísperas 1 D 19 larvas como estos no escotilla a cualquier temperatura (AR Baines, observación personal).

La comparación de ambos I Kfast y mini amplitud en estadios jóvenes segundo (aproximadamente 18 h después de incubar a 30 ° C ó 30 horas a 20 ° C) muestra que ambos se incrementaron en larvas que se desarrollaron a 30 ° C (parcial Eva knock-down) en relación con los mantiene a 20 ° C (de tipo silvestre Eva; Figura 4]. En comparación, me Kslow, que no fue afectada por la víspera de expresión (véase más arriba), no fue afectado por Eva knock-down. Kslow que se mantiene sin cambios, junto con el hecho de que la capacitancia celular también fue invariable (datos no presentados), sirve para demostrar que el desarrollo de aCC/RP2 no era desproporcionada influencia de la temperatura de desarrollo. Examen de las propiedades eléctricas en el medio silvestre de tipo similar mostraron las larvas no dependientes de la temperatura efectos (AR Baines, datos no publicados). De este modo, llegamos a la conclusión de que, si bien la sobre expresión de vísperas es claramente suficiente para reducir Kfast I quantal colinérgicos y corrientes, una retirada parcial de Eva resultados en el fenotipo contrario, lo que indica que el nivel de función Eva es un determinante crítico para el desarrollo de estas dos propiedades eléctricas en aCC/RP2.

Identificación de sitios de unión para Nochevieja

Para identificar los genes objetivo de Eva, que utilizaron una técnica denominada DamID. DamID es un método establecido para determinar los sitios de unión de ADN de la cromatina o proteínas asociadas a [24 - 26]. Objetivo sitios identificados por DamID Se ha demostrado que coincidan con los objetivos trazados por el chip-chip [26] o la cartografía a polytene cromosomas [27]. Estamos atados una Escherichia coli adenina metiltransferasa a Eva. Expresión de esta proteína de fusión en los resultados locales de metilación del ADN que se limita a unas pocas kilobases en torno a sus sitios de unión. Estos sitios son posteriormente puesto de manifiesto por el corte con la metilación de ADN específicos de las enzimas de restricción y hibridadas a microarrays [24, 25]. El uso de suelo de baldosas arrays que abarcan todo el genoma euchromatic (TD Southall, Choksi S, E de Wit, Van Steensel B AH y Brand, datos no publicados), nuestro análisis identificaron 2411 picos DamID individuales en el genoma y los genes 1268 (en posesión de uno o más picos dentro de 2 kb transcripcional de su unidad) como posibles blancos directos de Eva. Utilizando una red basada en conjunto de herramientas, GOToolbox [28], hemos realizado pruebas estadísticas para determinar Gene Ontología (GO) anotación [29] el enriquecimiento en 819 miembros de nuestra lista vinculados con anotaciones. Uso de "proceso biológico" (GO: 0008150) como la más amplia clasificación, generamos una lista de clases excesivamente de los genes. Figura 5 muestra la parte superior excesivamente grupos, que incluyen orientación axón (GO: 0007411), el desarrollo de neuronas (GO: 0048666) y el corazón de desarrollo (GO: 0007507), todos los cuales se espera de conocer la función y el patrón de expresión de Eva.

Nuestro análisis electrofisiológicos de Eva función implica slo y uno o más genes que codifican los receptores de ACh como objetivos de Eva. Satisfyingly, nuestro análisis identificaron dos slo y los receptores nicotínicos de la acetilcolina (nAChR) nAcR subunidad α-96 bis como Eva-que contienen sitios de unión dentro de 2 kb, que, como tal, puede considerarse como putativo blancos directos de Eva (Figura 6]. Por el contrario, no putativo de sitios de unión se identificaron dentro de los 2 kb de shal, el producto de lo que también contribuye a I Kfast. Otros funcionalmente pertinentes canal iónico genes identificados incluyen agitador (no contribuye a I Kfast en aCC/RP2; RA Baines, datos no publicados) y Shab (I contribuye a Kslow en la unión neuromuscular, pero desconocido dentro de la contribución del sistema nervioso central (CNS) [30]].

Para demostrar la especificidad en la identificación de genes, analizamos los sitios de unión para otros dos, que no guardan relación, factores de transcripción, Prospero y Asense. Análisis de Prospero vinculante demuestra que es capaz de obligar a un plazo de 2 kb de slo pero, sobre todo, a una ubicación distinta a la que se encuentra para Eva. Ninguna de estas sitios de unión se encontraron para Prospero en nAcR α-96 bis. Por el contrario, el análisis de Asense muestra no vinculante dentro de los 2 kb de cualquiera de genes (datos no presentados). De este modo, junto con estos controles adicionales, llegamos a la conclusión de que Eva-DamID identifica tanto slo y nAcR α-96 Aa lo más específico putativo abajo objetivo genes; una identificación que es totalmente coherente con nuestra electrofisiología.

Eva regula la expresión de slo y nAcR α-96 Aa

Nuestra identificación de ambos slo y nAcR α-96 bis como objetivos de Eva, que requiere que ambos de estos genes se expresan en aCC/RP2. Para mostrar esta directamente, que se utilizó en situ de RNA sondas para etiquetar las transcripciones de los dos genes (Figura 7 bis, b]. La tinción de ambos genes fue evidente en alrededor de 14 embrionario (datos no presentados) y de la etapa 15 de tinción para ambos slo (Figura 7] y nAcR α-96 A bis (Figura 7b] está claramente presente en el CAC y RP2 motoneuronas.

Para verificar que slo y nAcR α-96 Aa están regulados por Eva, expresó el exceso de vísperas pan-neuronally (1407 utilizando GAL4) y se utiliza QRT-PCR, que es un método cuantitativo más que utilizar RNA in situ de sondas, para determinar los niveles de mRNA para cada objetivo de genes. Todos los valores se normalizaron a RP49 niveles de mRNA para tener en cuenta las diferencias en el material de partida. Nuestra predicción, sobre la base de la actividad conocida de Eva como todo, un represor de la traducción [18], se observó una reducción en la expresión de ambas transcripciones. Medición de slo mRNA aislado de finales de etapa embrionaria 17 CNS mostraron una reducción significativa después de más de la expresión de las vísperas en comparación con idénticas mediciones efectuadas de los controles (1407 GAL4 / +) (5,15 ± 0,4 veces la disminución, p ≤ 0,01). En comparación, ningún cambio significativo en shal ARNm se observó (Figura 7c]. La sobreexpresión de la víspera también es suficiente para reducir significativamente la abundancia de ARNm para los nAChR subunidad nAcR α-96 Aa (2,78 ± 0,7 veces la disminución, p ≤ 0,05). Expresión de la nAcR β-64 CAIS subunidad B, el producto proteico de que no se encuentra junto con nAcR α-96 Aa funcionales en los receptores colinérgicos [31], no se vio afectado (Figura 7d]. Por lo tanto, QRT-PCR confirma que ambos slo y nAcR α-96 Aa están regulados por Eva, que, junto con la presencia de Eva-sitios de unión en estos genes y el efecto de sobre-expresión en las propiedades eléctricas, indica que están directa objetivos de este factor de transcripción.

El RP motoneuronas exposición diferentes propiedades eléctricas a aCC/RP2

Trabajos anteriores ha demostrado que la aCC/RP2 motoneuronas, que son a la vez positivos víspera, exhiben casi las mismas propiedades eléctricas [4]. Estamos motivados que otros motoneuronas que no expresan víspera podría exponer diferentes propiedades eléctricas de aCC/RP2. Para probar esto, caracteriza la isl, Hb9 y lim3 positivo motoneuronas r p1, 3, 4 y 5 (en adelante denominado el RPS), identificados con lim3-GAL4 para conducir UAS-GFP (nls) [32]. Curiosamente, todos de la RPS expuestos casi las mismas propiedades eléctricas, por lo que, a pesar de que fueron capaces de identificar RP neurona que fue grabado por el tinte de etiquetado, no fuimos capaces de separar cada tipo de neurona RP sobre la base del análisis de propiedades eléctricas. A pesar de que no se podían diferenciar unos de otros, las características eléctricas de la RPS diferían notablemente de los de aCC/RP2 (Figura 8]. En concreto, la exposición RPS redujo significativamente pico I Na, I Kfast y yo kslow, pero que no ha habido cambios en Ca I en comparación con aCC/RP2. En comparación, la excitabilidad de membrana y la amplitud del potencial de acción que dependen de las corrientes sinápticas no fueron significativamente diferentes (datos no presentados). Así, dos grupos de motoneuronas (aCC/RP2 y RPS) que difieren en su morfología y factor de transcripción expresión también difieren en sus propiedades eléctricas. Sin embargo, a pesar de que la tensión subyacente-gated conductances muestra grandes diferencias, la producción potencial de acción de estas motoneuronas parece ser similar, quizás indicativo de nuevos mecanismos de regulación.

La sobreexpresión de la víspera en RP motoneuronas resultados alterados en las propiedades eléctricas

Una cuestión importante planteada por nuestros resultados es la forma universal de los efectos de un exceso de expresar vísperas son? En concreto, víspera de expresión puede afectar a otras motoneuronas de la misma manera que aCC/RP2 o es su capacidad para influir en las propiedades eléctricas de células de tipo específico? Para probar esto, expresó el exceso de vísperas en la RPS (utilizando lim3-GAL4) que no suelen expresar este represor transcripcional. Nuestros resultados muestran claramente que el exceso de expresión en vísperas de la RPS en efecto, modificar sus propiedades eléctricas, pero que los cambios observados no recapitular los cambios observados después de más de expresión en aCC/RP2. Por lo tanto, expresión de la víspera en el RPS es suficiente para producir un aumento significativo en I Na, Ca y yo Kslow (Figura 8b]. Quizá más en particular, me Kfast, que se reduce por un exceso de expresión en vísperas de aCC/RP2, no se vería afectada por la expresión ectópica en vísperas de la RPS. Por el contrario, expresión de la víspera en la RPS, similar a la observada en aCC/RP2, es suficiente para aumentar la excitabilidad de membranas (18,5 ± 0,98 frente a 23,75 ± 1,0 AP, 10 pA/500 ms, p ≤ 0,05, datos no presentados) y para reducir la amplitud del potencial de acción que dependen de las corrientes sinápticas (93,24 ± 2,0 frente a 74,08 ± 1,42 pA, p ≤ 0,001, datos no presentados). Dado que los cambios de voltaje-gated corrientes observadas en la RPS difieren de los de aCC/RP2, llegamos a la conclusión de que la capacidad de víspera para regular las propiedades eléctricas de células es de tipo específico.

La sobreexpresión de la isla o Hb9 en aCC/RP2 resultados alterados en las propiedades eléctricas

Nuestros resultados son consistentes con un vínculo entre la determinación de la morfología y la determinación de propiedades eléctricas a través del factor de transcripción Eva. Para probar si otros factores de transcripción demostrado influir en la morfología neuronal regular también propiedades eléctricas que expresó isl ectópica o Hb9 en aCC/RP2 (utilizando RN2-O GAL4), y se caracteriza por las consecuencias propiedades eléctricas. Cabe señalar que, aunque la sobre expresión de una u otra isl o Hb9, similar a la víspera, ya ha sido demostrado que modifique axonal trayectoria en motoneuronas en etapas anteriores [14, 16], no hemos visto alteraciones evidentes en el centro de morfología dendrítica en virtud de estos condiciones (datos no presentados). Expresión de una u otra isl o Hb9 en aCC/RP2 dado lugar a una alteración importante a la normalidad propiedades eléctricas (Figura 9]. Expresión ectópica de isl es suficiente para aumentar la I Na y disminución I Kfast y yo Kslow con ningún cambio a I Ca (Figura 9]. En comparación, expresión ectópica de Hb9 dado lugar a una disminución significativa en I Na y el aumento de ambos I Kfast y yo Kslow pero una vez más que no ha habido cambios a I Ca (Figura 9].

Los efectos acumulativos de cambios específicos a determinados densidades de corriente en la excitabilidad de membrana siguientes errores de expresión o de isl Hb9 son más coherentes. Ni el factor de transcripción afectados intrínseco en la excitabilidad de membrana aCC/RP2 (datos no presentados). La conclusión general que podemos extraer de este conjunto de datos es que el efecto de sobre-expresión de isl o Hb9 (y, de hecho, víspera) es de tipo celular específico, que es totalmente predictivo para una combinatoria código de regulación de las propiedades eléctricas neuronales.

Discusión

La aparición de un comportamiento apropiado depende de la maduración de los circuitos neuronales. Para que esto ocurra el constituyente neuronas no sólo debe desarrollar un determinado patrón de ramificación dendrítica y la conectividad sináptica, sino que también debe expresar una mezcla de estereotipos canal iónico genes que, juntos, establecer la excitabilidad de membranas. Trabajo previo en Drosophila ha puesto de manifiesto que motoneuron axonal pathfinding está determinada por una combinatoria código de factor de transcripción de expresión, incluida Eva, Islet y Hb9 [14 - 16, 18, 33]. En el presente estudio, muestran que al menos uno de estos factores de transcripción, fundamental para el desarrollo morfológico, es también suficiente para afectar la adquisición de propiedades eléctricas. Es bien sabido que la morfología celular y propiedades eléctricas contribuye de forma importante a la diversidad en la señalización neuronal observada en el SNC. Con este telón de fondo es gratificante que determinados factores de transcripción son claramente capaces de regular estas dos facetas, lo que sugiere que cada uno se rigen por mecanismos comunes de desarrollo.

Nuestro electrofisiología demuestra claramente que el exceso de expresión en vísperas de aCC/RP2 se traduce en una baja regulación de ambos pico I Kfast y amplitud de colinérgica ministerios. I Kfast es un compuesto de al menos dos conductances codificados por shal tradicional y SLO [19, 20, 34]. Además de ChTX indica que el efecto de Eva en I Kfast es a través de una reducción en el SLO mediada por los componentes de esta corriente. Esta conclusión se ve reforzada por dos enfoques complementarios: DamID y QRT-PCR, la última de las cuales muestra que slo está específicamente reprimido por Eva shal mientras que se mantiene sin cambios. Que tanto DamID y QRT-PCR identificar slo como un objetivo de Eva represión indica que la regulación de este canal iónico gen es directa (es decir, no se producen indirectamente a través de intermediarios desconocido). Regulación transcripcional de slo es relativamente complejo [35], con al menos cinco promotores caracteriza: C 0 y C 1, que la unidad de expresión en las neuronas; C 1b y C 1c, expresión que impulsan a mediados de intestino, y C 2, que las unidades de expresión en los músculos y tráquea. Cada promotor da lugar a distintas variantes de empalme. Queda por determinar cómo Eva regula la expresión de cada uno de los empalmes variantes. La familia de canales de slo que es miembro, BK Ca 2 +-garse canales de potasio, se activan por la despolarización de membrana durante el potencial de acción y disparos, por lo tanto, contribuir a la post-hiperpolarización [36]. De acuerdo con nuestros datos, kslo Se ha demostrado que regular la excitabilidad, tanto a través de la duración y la frecuencia de potencial de acción disparando [37] y también para modular la liberación sináptica [38].

Además de la disminución de pico I Kfast, el exceso de expresión en vísperas de aCC/RP2 es suficiente para disminuir la amplitud del potencial de acción excitatorios que dependen de las corrientes sinápticas. Análisis de los ministerios espontánea pone de manifiesto una reducción similar, lo cual es indicativo de la reducción de la sensibilidad postsináptica a ACh. Nuestros análisis indican que la expresión de nAcR α-96 bis, una subunidad nAChR, es regulada negativamente por Eva. A diferencia de SLO, sin embargo, no hemos sido capaces de utilizar la farmacología adicionales para corroborar aún más el presente Reglamento. Para mostrar la especificidad, no obstante, hemos utilizado QRT-PCR para analizar los niveles de mRNA para un segundo nAChR, nAcR β-64 B, una subunidad que no se encuentra en el mismo complejo que nAcR α-96 bis [39]. Hemos visto no una alteración importante en nAcR β-64 B mRNA niveles, lo que nos permite concluir que, provisionalmente, Eva actúa selectivamente sobre nAcR α-96 bis. Este reglamento, que se desprende de DamID, QRT-PCR y electrofisiología, una vez más es probable que sea directo.

Hay, sin embargo, una advertencia que debe tenerse en cuenta en la interpretación de nuestros datos. Se trata de que los cambios que hemos observado después de más de la expresión de las vísperas puede ser el medio de efectos directos e indirectos. Consideramos que los efectos indirectos es probable que surjan a través de dos fuentes principales. La primera posibilidad sería que los cambios que se derivan de mecanismos de compensación homeostático que se sabe que son activas en Drosophila motoneuronas [4, 22]. Tales mecanismos homeostático son capaces de ajustar la relativa amplitud pico de membrana específicos conductances (más notable I Na y K) para mantener la coherencia en el potencial de acción disparando [4, 40]. De este modo, los cambios en la excitabilidad de membrana mediado por la víspera de expresión puede ser contrarrestado, al menos en parte, por regulación homeostática. Los efectos observados en el potencial de acción disparando después de más de expresión en vísperas de aCC/RP2 están en consonancia con la conocida homeostático mecanismos que actúan en estos dos motoneuronas; una disminución en la exposición a la excitación sináptica resultados en un aumento compensatorio en excitabilidad al fuego potenciales de acción [ 4]. Los cambios en las propiedades eléctricas que están asociados con esta respuesta (es decir, una disminución en Kfast I) no son, por comparación, en consonancia con la regulación homeostática conocido que predicen un aumento significativo en I Na, I Kfast y yo Kslow. Así, mientras que la regulación homeostática puede contribuir a las variaciones observadas en la excitabilidad de membrana, parece poco probable que tales mecanismos pueden enteramente cuenta de los cambios observados en la membrana específicos en conductances.

Una segunda posibilidad que podría dar como resultado indirecto en el cambio a la excitabilidad de membrana es una alteración en la conectividad sináptica de las motoneuronas en vísperas que es más-expresó. Teniendo en cuenta el papel para documentado en vísperas axonal pathfinding, es concebible que las alteraciones en las propiedades eléctricas puedan surgir como consecuencias secundarias de cambios morfológicos. Tendemos a esta posibilidad de descuento por dos razones. En primer lugar, todas las motoneuronas se llenaron durante nuestras grabaciones y no obvia perturbación en el medio silvestre tipo de morfología se señaló. Por supuesto, nuestro nivel de análisis no han detectado cambios sutiles en finas ramificaciones dendríticas. En segundo lugar, Landgraf et al. [15] muestran que misexpression de vísperas es suficiente para perturbar sólo axón pathfinding, pero no como objetivo final el reconocimiento en motoneuronas (que sólo se retrasó). Así, aunque el exceso de expresión en vísperas de las motoneuronas ventral es suficiente para desorientar sus axones a los músculos dorsales, estos errores se corrigen en el momento de la eclosión.

Además de nuestra propia experiencia, hay un precedente para el factor de transcripción misexpression resultado alterado en la excitabilidad de membranas. Por ejemplo, la expresión de lox1, un homólogo de la Drosophila los genes sexo-peines reducido y antennapedia, sanguijuela en las neuronas es suficiente para aumentar el tamaño de la AP [41]. De acuerdo con un principio básico de un código de combinatoria, estos autores informan del tipo de células efectos específicos - sólo discretos grupos de células que presentan una mayor amplitud del potencial de acción. En el ascidian, Halocynthia roretizi, motoneuronas, que expresan el factor de transcripción HRlim disponer de un conjunto de propiedades comunes, incluida la expresión de los canales de sodio gen TuNa2 [42]. Expresión ectópica de HRlim es suficiente para conducir TuNa2 de expresión en las células que normalmente no expresan bien.

Una cuestión importante planteada por nuestro examen de las consecuencias de la víspera de expresión en diferentes subpoblaciones motoneuron es la universalidad de sus efectos. Nuestros datos son compatibles con un modelo en el que la transcriptome de determinados tipos de células es un factor determinante de la naturaleza de la regulación. Comparación de los efectos producidos por un exceso de expresión en vísperas de aCC/RP2 en comparación con los producidos en la RPS muestra diferencias en consonancia con esta hipótesis. Cualquiera que sea el mecanismo exacto, esta aparente dicotomía de acción firmemente implica un contexto que dependen de modo de regulación. Esta conclusión no es demasiado sorprendente si tenemos en cuenta que Eva, Isl Hb9 y forma parte de un código de combinatoria motoneuron especificación [9] y que la especificación neuronal de otras propiedades, por ejemplo, dFMRFa expresión y furnin 1 de expresión, es también el complejo y combinatoria no combinatoria de control [33]. Por lo tanto, las propiedades eléctricas de las membranas neuronales es más probable dictada por una actividad combinada de una serie de factores de transcripción, que nuestros datos indican incluye Eva, Islet y HB9. La alteración de este equilibrio dentro de las neuronas probablemente resultará en una igualmente amplia gama de efectos en ambos aparatos eléctricos y señalización de las propiedades.

Conclusión

Los procesos por los cuales las neuronas adquirir sus singulares características eléctricas son, actualmente, no especialmente bien entendido. Nuestro estudio es importante porque demuestra que un factor de transcripción que se sabe que son esenciales para orientar las decisiones axón es también capaz de influir en la adquisición de determinadas propiedades eléctricas en la misma motoneuronas. Sobre la base de esta observación, es nuestra predicción de que otros miembros de la combinatoria código (Lim3, Islet, y así sucesivamente) actuará a través de la regulación transcripcional de nuevas series de canal iónico genes, la expresión particular de que se cuenta para la única eléctrica características que se observa entre motoneuronas. Ahora será de importancia para determinar cómo influye en la víspera la expresión de canales de iones genes cuando se expresa en otros, no endógena vísperas expresar motoneuronas. Nuestros resultados indican claramente que los efectos que observamos en aCC/RP2 no se recapitulan cuando es víspera ectópica expresada en el r p1 ,3-5 motoneuronas, quizás indicativo de que más co-factores que podrían ser necesarias. Presumiblemente, estos co-factores que también podrían ser de células de tipo específico.

Materiales y métodos
Fly existencias

Las moscas se mantuvieron en agar jugo de manzana complementado con la levadura a 25 ° C. De tipo salvaje (WT) se Cantón-S. 1407 GAL4 (homocigotos segundo cromosoma) se utilizó para expresar UAS transgenes en todas las neuronas CNS. RN2-O GAL4 (homocigotos viable segundo cromosoma) se utilizó para expresar selectivamente UAS transgenes en el CAC y RP2 [22, 43]. Lim-3 GAL4 se utilizó para conducir a la expresión r p1 ,3-5 motoneuronas [32]. UAS-en vísperas TM6 / P [(color de rosa + l (3))], fue re-equilibrio en TM3 un balanceador de las buenas prácticas agrarias. UAS-islote fue proporcionado amablemente por Thor Stephan [14] y UAS-dHb9 fue proporcionado amablemente por James Skeath [44]. Para eliminar una función Eva sensible a la temperatura alelo, vísperas 1 D 19, se utilizó [15]. Se aparearon las hembras se les permitió sentar, y los embriones para desarrollar, a 20 ° C (temperatura permisiva), La primera resultante estadio las larvas (que fueron todos vísperas 1 D 19 / CYO acto:: GFP) o bien fueron puestos a 30 ° C (restrictiva temperatura) durante aproximadamente 18 h o mantenidas a 20 ° C. Las grabaciones se hicieron desde aCC/RP2 a los jóvenes las larvas de segundo estadio. Homocigótica vísperas 1 D 19 embriones no escotilla incluso a la temperatura permisiva.

Electrofisiología

Todas las grabaciones se realizaron en los jóvenes estadio las larvas de primero, 1 a 4 h después de su nacimiento, a temperatura ambiente (22 a 24 ° C). Plenario de células grabaciones (corriente y voltaje clamp) se lograría con gruesas paredes de vidrio borosilicato electrodos (GC100TF-10; Harvard Aparatos, Edenbridge, Reino Unido), pulidos a fuego resistencias de entre 15 y 20 M Ω. Las células fueron identificadas inicialmente basado en posición ventral en el nervio del cordón y absoluta identificación se determinó después de la grabación de etiquetado con rodamina de azufre (0,3%; Molecular Probes, Eugene, Oregón, EE.UU.), que fue incluido en el parche de solución salina. Las grabaciones fueron hechas utilizando una Axopatch-1D amplificador controlado por pClamp 8.1 (AXON Instruments, Foster City, CA, EE.UU.). Sólo las células con una resistencia de entrada> 1 G Ω fueron aceptadas para su análisis. Las huellas fueron filtradas a 2 kHz y la muestra a 20 kHz. Para resolver mejor las corrientes de Na +, en una línea de fuga resta de protocolo se utilizó (P / 4). Corrientes se muestran los promedios de cinco ensayos para cada celda. Excitabilidad de membrana se determinó a través de inyección de corriente despolarizante (10 pA/500 ms) de un potencial de membrana mantenido (VM), de -60 mV. VMS se mantuvieron a -60 mV de la inyección de una pequeña cantidad de hyperpolarizing actual. Entrada resistencia, la cual fue determinada por la inyección de 0,5 pA hyperpolarizing actual, se mantuvo sin cambios estadísticamente en todas las bases genéticas prueba (WT = 7,2 ± 0,9 G Ω). Para determinar el efecto de la expresión génica en las propiedades eléctricas analizamos el pico de conductancia para cada curso analizado (I Na a -15 mV, Ca a 0 mV, y yo Kfast y yo Kslow a +45 mV).

Soluciones

Exteriores solución salina para la disección y análisis actual de sujeción de la excitabilidad constaba de los siguientes (en mm): 135 NaCl, 5 KCl, 4 MgCl 2 6H 2 O 2, CaCl 2 2H 2 O 5, N-Tris [hidroximetil] metil - 2-ácido aminoethanesulfonic (TES), 36 de sacarosa. Para el aislamiento de las corrientes de K +, la siguiente solución se ha utilizado (en mm): 135 NaCl, 5 KCl, 4 MgCl 2 6H 2 O 2, CaCl 2 2H 2 O 5, TES, 36 de sacarosa y 1 μ M TTX (Alomone Labs, Jerusalén, Israel). Para el aislamiento de Ca 2 + corrientes, la siguiente solución se ha utilizado (en mm): 50 NaCl, KCl 6, 50 tetraethylammonium de vinilo (TEA), 50, BaCl, 10 4-AP, 10 HEPES, 10 de glucosa, 10 MgCl 2 6H 2 O, y 1 μ M TTX. Para el aislamiento de las corrientes de Na +, la siguiente solución se ha utilizado (en mm): 100 NaCl, 5 KCl, 50 TEA, 10 4-AP, 10 HEPES, 10 de sacarosa, y el 0,5 CaCl 2 2H 2 O. Todas las soluciones fueron pH 7,15.

Interior parche de solución consistió (en mm): 140 K + methylsulfonate (KCH 3 SO 3), 2 MgCl 2 6H 2 O 2, EGTA, 5 KCl, y 20 HEPES, pH 7,4. Al grabar las corrientes de Na +, CsCl 2 fue sustituido por KCH 3 SO 3.

Plásmido para la construcción DamID

El pUASTNDam vísperas de construir se hizo mediante amplificación por PCR de cDNA vísperas de un embrión de Drosophila biblioteca de cDNA y la inserción en pUASTNDam [45] utilizando BGL II y no me sitios. La víspera cDNA fue amplificado utilizando los siguientes primers: delantero (5'-GGGAGATCTGATGCACGGATACCGAACCTACAAC-3 ') e invertir (5'-GTACGCGGCCGCTTACGCCTCAGTCTTGTAGGGCTTG-3'). Transgénico que contiene las moscas pUAST-Ndam-víspera se generaron como hemos descrito anteriormente [46], salvo que el ADN fue preparada con Qiagen (Crawley, Reino Unido) miniprep kit.

Preparación de Dam-ADN metilado

Etapa 17 embriones (16 a 22 horas después de puesta de huevos (AEL)) han sido recogidos de UAS-Dam (control) y UAS-Dam vísperas de las moscas. ADN genómico se aisló a partir de embriones utilizando el kit Qiagen DNeasy. Embriones (50 mg) fueron parte homogeneizada en 180 μ l de buffer fosfato salino-, y luego 4 μ l de RNasa A (100 mg / ml) se añadió a la izquierda y se incuba durante dos minutos para eliminar los ARN de la muestra. La digestión del ADN y amplificación por PCR se realizó tal como está descrita anteriormente [45].

DamID análisis

Para mapa sitios de unión en un genoma escala, que utilizan todo el genoma 375000 característica arrays suelo de baldosas, que comprende 60-mer oligonucleótidos espaciados a unos 300 bp intervalos, diseñado contra el módulo de 4,0 genoma de la Drosophila [45]. El control y experimental muestras fueron etiquetadas y hibridizada costumbre a estas matrices. Las matrices fueron escaneadas e intensidades extraído (Nimblegen Systems, Madison, WI, EE.UU.). Dos réplicas de la víspera-Dam Dam versus sólo se realiza la comparación. Iniciar sesión 2 ratios de cada terreno se normalizaron mediante una mediana de centrar la normalización. Ratios fueron normalizados a través de un promedio de dos diapositivas. Picos se identificaron. Un pico de investigación fue el algoritmo utilizado para identificar regiones del genoma obligado por Eva, con los parámetros de la siguiente manera: pico de altura umbral ≥ 1,8 veces el diario de cambio, además de en torno a las sondas (aproximadamente 1200 pares de bases) que poseen un valor ≥ 1,4 log - veces el cambio (los scripts de Perl para su análisis disponibles bajo petición). GO anotación sobre-representación análisis se realizó a través GOToolbox [28]. Parámetros para la representación de más de las búsquedas incluyen: proceso biológico, especificidad = 3, Hipergeométrica verificación, y corrección de Bonferroni de p-valores.

Hibridación in situ e inmunohistoquímica

Hibridación in situ se realizó tal como está descrita anteriormente [45], utilizando una temperatura de hibridación de 65 ° C. Los primers utilizados para generar las sondas de RNA son los siguientes: SLO-para, GAAGGACTTTGATTTCGAGAAGAC; SLO-revT7, CAGTAATACGACTCACTATTATCAAGAGTTATCATCCTTGTTGGA; als-para, ACAACATTCAAGACTGCTAACTGG; als-revT7, CAGTAATACGACTCACTATTACTGATGTTGCAGTTGCTGTTG.

La inmunohistoquímica se realizó después de que el protocolo in situ utilizando un anticuerpo a Eva 1:5000 [17] y desarrollado utilizando 3,3 '-Diaminobencidina (DAB).

La extracción de RNA y PCR en tiempo real

Detalles de la PCR en tiempo real método se describen en [47]. PCR primers (adelante y atrás en los primers 5 'a 3' de orientación) es el siguiente: rp49, CCAAGGACTTCATCCGCCACC y GCGGGTGCGCTTGTTCGATCC; víspera, CAATCCGCTCCATCAGTTCC y CCGCAATCACAGTTGTCGTC; nAcR β-64 B, TCCTGGCATCCAACGTTTCG y TTTCGGGCAATCGCAAGTCG; nAcR α-96 bis, CAGCGAGAACACCTTATAGC y GTACAACGCCGAGGAAATAC; SLO, CGTTTGCGTCCGCAAGGAGCCGGACC y GGAAGTCCTTCAGGAAATGCGACACGG; shal, ATGGCCAACGTGGTGGAGACGGTGCCGTGTGG y TTCGCTGGCGCAGGACTTGAGCGTGTAGCC.

Cada reacción figura 5 μ l de PCR Master Mix (3 mM MgCl 2, dNTPs, Taq polimerasa; Biogene, Cambridge, UK), 500 nM adelante y atrás primers, 1 μ l de cDNA, y la dilución de 1:1000 SYBR Gold (Biogene) hasta 10 μ l con PCR de calidad del agua. PCR se realizó con un LightCycler de Roche (Roche, Lewes, Reino Unido). Después de un primer paso de desnaturalización a 94 ° C durante 60 s, la temperatura se inició en bicicleta. Cada ciclo constó de desnaturalización a 94 ° C durante 0 s, hibridación a 54 ° C durante 5 s para la víspera, 57 ° C para los receptores de Nach, 60 ° C durante slo y 65 ° C durante shal y elongación a 72 ° C durante 10 S. Determinación de rp49 se realizó a todas las temperaturas. La señal fluorescente fue adquirido al final de cada paso de hibridación (F2/F1 canales, fluorimeter ganancias regulado el 1 de F1, 1 para F2 y F3 para 1). Un total de 30 ciclos se realizó. La autenticidad de los productos PCR se verificó mediante fusión de análisis de la curva y la presencia de una única banda de tamaño molecular adecuado por electroforesis en gel de agarosa. Cuantificación relativa de un determinado gen, expresado como variación veces más de control, se calculó a partir de la determinación de la diferencia entre el CT de la prueba genética y de que el calibrador de genes (rp49). Ct valores utilizados fueron los medios de tres repeticiones. Los experimentos se repitieron al menos cinco veces.

Estadísticas

Electrofisiología y QRT-PCR datos fueron comparados utilizando un no-t "pareada prueba. Los resultados fueron considerados significativos a p ≤ 0,05. Todos los valores mostrados son media ± SE.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Autores de las contribuciones

ECGP realizado electrofisiología, los datos analizados, y escribió el documento. TDS DamID realizadas in situ y protocolos, y analizó los datos. CJM realizó PCR. AHB diseñado la investigación y escribió el documento. RAB realizado electrofisiología, destinados a la investigación, analizaron los datos, y escribió el documento. Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

Nos gustaría agradecer a los Dres J Jaynes, FUJIOKA M, J S Skeath y Thor para proporcionar las moscas. Este estudio fue financiado por donaciones del Wellcome Trust (RAB, AHB), el BBSRC (RAB) y la MRC (AHB).