PLoS ONE, 2006; 1(1): (más artículos en esta revista)

Rho cinasa el papel de la miosina en el reclutamiento de la corteza Ecuatorial mitótico de las células Drosophila S2 es de miosina regulador luz cadena de fosforilación

Biblioteca Pública de la Ciencia
Sara O. Dean, James A. Spudich [*]
Resumen
Fondo

Miosina II para la contratación ecuatorial corteza es uno de los primeros eventos en el establecimiento de cytokinetic anillo contráctil. En Drosophila S2 células, que anteriormente mostró que la miosina II ha sido contratado para el surco con independencia de F-actina, y que Rho1 y Rok son esenciales para esta contratación [1]. Rok phosphorylates varias proteínas celulares, incluyendo la miosina de cadena ligera reguladora (RLC).

Metodología / Principales conclusiones

En este sentido, expresar el estado de fosforilación imitan las construcciones de la RLC en S2 células para examinar el papel de la participación de fosforilación RLC Rok en la localización de la miosina. Fosforilación de la RLC se requiere para la miosina a la localización ecuatorial corteza durante la mitosis, y el papel esencial de Rok en esta localización y de la citocinesis es mantener la fosforilación de la RLC. La capacidad de regular el estado de fosforilación RLC espacio-temporal no es esencial para la localización de la miosina. Por otra parte, el papel esencial de Citron en la citocinesis no es la fosforilación de la RLC.

Conclusiones / Importancia

Llegamos a la conclusión de que la Rho1 vía conducente a la miosina localización para el futuro cytokinetic surco es relativamente sencillo, donde sólo se necesita Rok, y sólo es necesario para mantener la fosforilación de la miosina RLC.

Introducción

Citocinesis supone la creación de una miosina II que contiene anillo contráctil en el surco de división de las células. La colocación de este anillo contráctil está controlada por el pequeño GTPase Rho1/RhoA [2], [3], que tanto estimula la formación de filamentos de actina en el surco localizado por la activación de proteínas formin [4] y el anillo de contracción mediante la activación de Rho-cinasa (ROK) y Citron quinasa, lo que puede phosphorylate la miosina II regulador luz cadena (RLC) [5] - [7]. Rok directamente phosphorylates miosina II RLC en treonina 18 y serina 19 en células de mamífero [8] (T20 y S21 en Drosophila [9]] y suprime su dephosphorylation de inactivar la fosfatasa miosina [10]. Fosforilación en esos lugares se ha demostrado in vitro para estimular la miosina II, la actividad motora y en algunos casos para promover la miosina II en la polimerización de filamentos gruesos bipolar [11] - [13]. La importancia de Rok RLC en la regulación de la fosforilación in vivo se ha demostrado mediante un fosfato imitar RLC en el que los aminoácidos 20 y 21 se han cambiado a glutamates. Expresión de RLCE20E21 puede rescatar de larvas de letalidad en las moscas mutantes Rok [14]. Además, la fosforilación de la RLC en las células del ala pupal es Rok-dependientes [14]. En C. elegans, Rok controla el ritmo de contracción surco, y su función es que antagoniza por una fosfatasa específica para la RLC [15]. Por lo tanto, es evidente que el RLC es un importante objetivo para Rok contráctil en la regulación de eventos tanto in vitro como in vivo.

Rok activación puede dar lugar a RLC estimular la fosforilación de miosina II de motor afectan a la producción de fuerza y división durante la citocinesis. Sin embargo, recientemente se concluyó que las dos Rho1 y Rok no sólo son esenciales para la división celular, sino también para la acumulación inicial de miosina II en la división surco S2 de Drosophila células [1], lo que sugiere que la fosforilación de la RLC pueden estar involucrados en la contratación de miosina II del surco. No hay precedente para RLC fosforilación de miosina II que afectan a la localización de células del córtex. Royou et al. mostró que la expresión de RLCE20E21 podría restablecer la miosina localización de la corteza de Rok-inhibido embriones durante la expansión axial [16], y Chodagam, et al. informó de que la expresión de RLC-E20E21 restablece el ciclo celular depende de contratación de miosina II de la corteza de la Drosophila en embriones mutantes de CP190, una proteína que interactúa con centrosomes durante la mitosis y se une a microtúbulos in vitro [17]. Sin embargo, Jordania y Karess informó de que no phosphorylatable RLC está correctamente localizada en Drosophila huevo cámaras [9], lo que sugiere que los distintos acontecimientos que afectaron a celulares miosina II pueden ser regulados de manera diferente. Por lo tanto, queríamos poner a prueba específicamente para la importancia de RLC fosforilación en la localización de miosina II de la corteza ecuatorial de las células durante la mitosis, donde junto con la actina y otras proteínas que forma un anillo cytokinetic. Por otra parte, hemos querido evaluar la importancia relativa de Rok inducida por la fosforilación de miosina II regulador luz cadena de miosina II en la localización y la citocinesis en comparación con la fosforilación de otros conocidos Rok sustratos, como PTEN [18], Lim quinasa [19], y MTC proteínas [20], [21]. Mostramos aquí que la fosforilación de la RLC se requiere para la miosina II localización a la corteza ecuatorial durante la mitosis y que el papel esencial de Rok en la miosina II para la localización y la citocinesis es mantener la fosforilación de la miosina RLC.

Resultados
RLC fosforilación es necesaria para la contratación miosina II a la división surco

Aunque fosfato-RLC se ha detectado en los surcos cytokinetic de células de mamífero [22], [23], a nuestro conocimiento de su presencia no ha sido verificado en los surcos de dividir las células Drosophila. Por lo tanto, lo primero que analizarse para detectar la presencia de fosforilados RLC en dividir Drosophila S2 células de la tinción de estas células con un anticuerpo específico para T20S21-RLC fosforilados [24]. Fosfato-RLC se detectó en la corteza ecuatorial de anafase temprana a través de telofase (Figura 1].

A continuación, tres construcciones destinadas a comprobar si la fosforilación de la RLC es necesaria para la contratación miosina II a la división surco. En Drosophila embriones RLCA20A21 y RLCE20E21 Se ha demostrado que la función no phosphorylatable y fosfato imitar mutantes, respectivamente [14], [16]. Por lo tanto, diseñó un wildtype construir RLCT20S21-GFP, no phosphorylatable construir RLCA20A21-GFP, y un fosfato imitar construir RLCE20E21-GFP en el que 300 pares de bases en la región de codificación de cada RLC secuencia genética fueron sustituidas por no endógena a los codones para permitir que las agotamiento de la endógeno RLC utilizando dsRNA diseñados contra la secuencia endógena codón (Figura S1]. El agotamiento de la RLC endógeno es necesario debido a la naturaleza filamentosa funcional de miosina II motores. En presencia del endógena RLC, el mutante proteínas se co-ensamblar con la endógeno RLCs pesados en las cadenas de miosina resultante en los filamentos de miosina II que contienen una mezcla de wildtype y mutante RLCs. Figura 2A muestra que RNAi tuvo éxito en agotar sólo los endógenos RLC y que permita la expresión de mutantes de GFP quimérico proteínas. Dilución serie de experimentos confirmaron que la endógeno RLC se expresó en menos de un 5% los niveles de control (datos no presentados).

En las células de tipo salvaje, el agotamiento de RLC se traduce en una citocinesis defecto, según lo medido por un aumento en las células multinucleadas (Figura 2B]. Expresión de las buenas prácticas agrarias de etiquetado de tipo salvaje versión de la cadena de reglamentación luz, RLCT20S21-GFP, agotado en las células de la endógeno RLC rescatado la citocinesis defecto (Figura 2B], y RLCT20S21-GFP normalmente se contrató a la división surco (Figura 2C, La película de S1]. Sin embargo, la expresión de GFP-RLCA20A21 no phosphorylatable proteína no rescate la citocinesis defectos causados por el agotamiento de la RLC endógeno (Figura 2B]. Esto se espera, simplemente porque la activación de la miosina II motor dominio de fosforilación de la RLC se espera que sea necesaria para la contracción del surco. Por lo tanto, para probar específicamente para la miosina II localización defectos que usamos en vivo de células microscopía para filmar las células que expresan tanto el RLC-GFP construye y mRFP-α-tubulina en las células en anafase la transición y la citocinesis. Es importante destacar que, en presencia de la endógeno RLC, de expresión de GFP-RLCA20A21 no causar un defecto citocinesis (Figura 2B] y RLCA20A21-GFP está debidamente contratado para la corteza ecuatorial (datos no presentados). Esto demuestra que la RLCA20A21-GFP está debidamente dobladas, se asocia con la miosina II pesada cadena, y, presumiblemente, forma parte de la miosina bipolar filamentos gruesos que contienen tanto de tipo salvaje y formas mutantes de la RLC. Por otra parte, esto demuestra que RLCA20A21-GFP no causar un efecto negativo dominante en la citocinesis. Tras el agotamiento de la endógeno RLC, sin embargo, RLCA20A21-GFP no se contrató a la corteza ecuatorial, y las células no alargar en anafase ni contrato (Figura 2C, la película de S2], similares a las células agotadas de miosina II pesada cadena, Rho1, Rok o [1], [25]. Aproximadamente dos tercios de estas células filmado ruffling de membrana expuestos durante anafase, como se muestra en la Figura 2C y la película de S2. Estos datos sugieren que la fosforilación de la RLC es necesaria para la contratación de miosina II de la división surco de dividir las células Drosophila.

Por el contrario, expresión de la fosfato-RLCE20E21 imitar las buenas prácticas agrarias no induce un defecto citocinesis al agotamiento de la RLC endógeno (Figura 2B]. Además, el fosfato imitar RLCE20E21-GFP está debidamente contratado para la corteza ecuatorial, y el surco células normalmente después de agotamiento de la RLC endógeno (Figura 2C, la película de S3]. A pesar de algunas variaciones en las células ejemplo se muestra en la Figura 2C, el examen de muchas células de cada tipo puso de manifiesto que la RLCT20S21-GFP y las células que expresan el RLCE20E21 de las células que expresan GFP no muestran diferencias significativas en el calendario entre el inicio y anafase furrowing inicio (p = 0.15), la cantidad de tiempo que se tarda en completar furrowing (p = 0,10), ni la distribución de RLC-GFP durante la citocinesis. Sin embargo, el fosfato imitar RLCE20E21-GFP se acumula en la corteza durante interfase y metafase en mayor medida que el wildtype RLCT20S21-GFP (véase, por ejemplo, Figura 2C].

La única función esencial de Rho-cinasa en la citocinesis es el mantenimiento de fosforilación RLC

Con el fin de comprobar si Rok desempeña funciones múltiples facetas esenciales en la miosina II localización, hemos probado si la expresión de fosfato imitar RLCE20E21-GFP podría rescate Rok agotamiento. Como control, RLCT20S21 expresando GFP-S2 células mostraron una significativa citocinesis defecto a Rok agotamiento (Figura 3A] y también mostró una significativa falta de localizar la miosina a la corteza ecuatorial de la célula mitótica (Figura 3B, la película S4]. Expresión de la fosfato-RLCE20E21 imitar las buenas prácticas agrarias, sin embargo, salvaron la citocinesis defecto en Rok agotado las células (Figura 3A]. Además, las células de Rok agotado pero expresando RLCE20E21-GFP contratación miosina II normalmente a la corteza ecuatorial durante la mitosis (Figura 3B, la película de S5]. Así, a pesar de sus muchos objetivos potenciales, la única función esencial de Rok de miosina II localización es mantener la fosforilación de la RLC. RLCE20E21-GFP no fue capaz de rescatar Rho1 agotamiento (Figura 3A], en consonancia con los datos que muestran que Rho1 activa múltiples proteínas fundamentales para la citocinesis además de Rok, incluidos diáfano [26] y Citron [27].

Citron quinasa no es esencial para RLC fosforilación durante la citocinesis

Ambos Rok Citron y se activan por Rho1, se encuentran en los surcos división, y se ha demostrado que la phosphorylate RLC [5] - [7]. Sin embargo, si bien Rho1 Rok y el agotamiento de inducir una rápida citocinesis fracaso, agotamiento Citron resultados sólo en una tarde cytokinetic defecto en la membrana que forma vesículas en la telofase midbody [28] - [31]. Sorprendentemente, la expresión de GFP-RLCE20E21 no retiran la citocinesis defectos causados por el agotamiento de Citron en células S2 (Figura 3A], y de fosfato RLC se encuentra en el surco de división Citron agotado las células tarde en la citocinesis, cuando uno sospecha que podría tener para Citron ser necesario para mantener a la RLC fosforilados (Figura 4]. Estudios anteriores mostraron que la expresión de RLC-E20E21 podría rescatar el fenotipo aproximado ojo de Drosophila Citron mutantes que indica un papel in vivo para Citron en RLC fosforilación [28]. Sin embargo, nuestros resultados muestran que la fosforilación de la RLC no es la función esencial de Citron durante la citocinesis de las células S2, de nuevo haciendo hincapié en que los distintos acontecimientos que afectaron a celulares miosina II podrá regularse un poco diferente.

Un papel que pueden desempeñar diferentes para Citron es sugerido por nuestras observaciones de la tinción de anticuerpos en las células telofase tardía. Encontramos que en las células que expresan GFP-RLC [32], RLC-GFP se encuentra en el midbody de todos los fines de telofase células que indican la miosina II está presente allí en todos los fines de telofase células. Sin embargo, sólo el 43% y el 37% de estas células con la mancha anti-fosfato-RLC o un anticuerpo anti-miosina II pesada cadena de anticuerpos [33], respectivamente (n = 30 células). Por lo tanto, unión de los anticuerpos debe ser inhibido en algunos fines de células telofase probablemente debido a un cambio estructural a finales de los surcos. Curiosamente, hemos encontrado que al agotamiento de Citron, anti-fosfato-RLC tinción de anticuerpos se encuentran en casi todos los fines de telofase S2 células (97%, n = 30 celdas) (Figura 4]. El aumento de la tinción de anticuerpos en las células Citron agotado en comparación con las células normales sugiere que el agotamiento Citron resultados en un cambio estructural a finales de los surcos que permite obligar a los anticuerpos que son algo normal excluidos de los surcos. Por lo tanto, Citron puede ser importante para mantener la integridad estructural de la tarde midbody.

Discusión

Hemos demostrado que la miosina II RLC localizada en el surco división es fosforilados y que esta fosforilación es necesaria para la correcta contratación de miosina II de la corteza ecuatorial. Si bien ese papel fue sugerido por estudios anteriores que muestran que Rok es esencial para la miosina II a la localización ecuatorial corteza de dividir las células Drosophila S2 [1], esta es la primera demostración directa de que la fosforilación RLC buen estado regula la contratación de miosina II a la ecuatorial corteza.

Las células que expresan el fosfato imitar RLC no muestran un defecto citocinesis. Por lo tanto, dephosphorylation de la RLC en telofase tardía no debe ser necesario para completar la citocinesis. Además, localizado RLC regulación de la fosforilación en el surco no debe ser necesario para la contratación miosina II. En lugar de ello, antes de la "fosforilados" miosina II pueden ser reclutados para el surco. De este modo, la amplia opinión de que la miosina II se acumula en la corteza ecuatorial porque cortical de flujo más probable es incorrecta. De acuerdo con el modelo de flujo cortical, localizada activación de la miosina II en el motor ecuatorial corteza provoca tensión en esa región de tal manera que el contenido de la corteza del flujo hacia el centro de la célula resultante de la acumulación de proteínas división surco. Sin embargo, fosfato imitar RLC debe ser igualmente activa en toda la corteza, y sin embargo, se acumula en el ecuador. También argumentando en contra del modelo de flujo cortical es nuestra observación de que la F-actina no es necesaria para la contratación miosina II [1].

Curiosamente, hemos demostrado que el papel esencial de Rok en la citocinesis es el mero mantenimiento de la fosforilación de miosina II RLC, como lo demuestra el salvamento de todos los Rok agotamiento citocinesis fenotipos de expresión de fosfato imitar RLC. Esto es especialmente interesante porque Rok También se ha demostrado que los lípidos phosphorylate fosfatasa PTEN [18], que desempeña un papel en la citocinesis en Dictyostelium [34] y Lim quinasa que phosphorylates Cofilin [35], una proteína esencial citocinesis [36]. Rok puede contribuir a la miosina II RLC fosforilación de dos maneras: a través de la fosforilación de la RLC y de reprimir la actividad de la miosina fosfatasa de la fosforilación de su subunidad MB [10]. Nuestros resultados son coherentes con Rok participar, ya sea en papel. Sin embargo, Hickson et al. han demostrado que Rok es importante para desencadenar la aparición de furrowing incluso en ausencia de MB [25]. Además, el agotamiento de cualquier otra conocida cadena de miosina quinasa luz en combinación con Rok MB agotamiento y no induce un defecto furrowing [25]. Por lo tanto, es probable que Rok participa en la miosina localización durante la mitosis fosforilantes directamente por el RLC.

Sorprendentemente, encontramos que Citron quinasa no es ni necesaria para RLC fosforilación durante la citocinesis ni fosfato pueden imitar RLC rescate la citocinesis defecto Citron inducida por agotamiento. En lugar de nuestros resultados sugieren que Citron puede ser importante para mantener la integridad estructural de la tarde midbody. El papel de Citron en el mantenimiento de la estructura de fines de los surcos es coherente con el fenotipo de Citron mutantes en los que la membrana de las vesículas finales de los surcos de manera espectacular [28] - [31]. Anteriormente, la fosforilación de la RLC ha sido la hipótesis a ser importante para este papel de la regulación de la interacción de la RLC con anillin, una proteína que une F-actina, membranas, y de fosfato RLC miosina II [28]. Sin embargo, debido a imitar fosfato RLC no puede rescate Citron agotamiento, el papel de Citron a finales de los surcos no se va a RLC fosforilación.

Este estudio demuestra claramente el papel de RLC fosforilación en la regulación de miosina II localización en Drosophila. Nuevos estudios deberían ayudar a dilucidar el mecanismo molecular de las células que diferenciar entre fosfato y la no-fosfato-RLC miosina II y, concretamente, contratar al ex ecuatorial a la corteza de una célula en mitosis. Aunque fosfato RLC miosina II tiene una mayor actividad motora, esta actividad no es probable que participe en la regulación de miosina II de contratación para el surco porque F-actina no se requiere para esta contratación [1]. Curiosamente, bipolar formación de filamentos gruesos de la miosina algunos IIs está regulada por la fosforilación RLC, y en Dictyostelium estudios han demostrado claramente que la formación de filamentos gruesos bipolar es necesaria para la miosina II localización para el surco en que el sistema [37]. Curiosamente, fosfato imitar RLC que contienen miosina II parece ser el exceso de acumulado en la corteza de la interfase y células en metafase de una manera similar a Dictyostelium miosina II que es constitutivamente montados en los filamentos gruesos [37], [38]. Más estudios serán necesarios para demostrar si la formación de filamentos gruesos desempeña un papel en la miosina II en la localización de las células eucariotas superiores.

Materiales y Métodos
Plásmido de construcción y de cultivo celular

Plásmidos para la expresión de GFP-RLC se crearon construcciones de la siguiente manera: El plásmido pCasper-sqh-sqh-gfp [39], fue digerido con SpeI y Noti enzimas de restricción para liberar un fragmento de la RLC de genes (llamados sqh) codificación de los sitios de fosforilación. El fragmento fue subcloned en pBluescript (Stratagene) y Quikchange Mutagénesis (Stratagene) se utilizó para mutar los sitios. El fragmento fue entonces subcloned atrás en el digerido pCasper-sqh-sqh-gfp plásmido para crear plásmidos pCasper-sqhA20A21-gfp y pCasper-sqhE20E21-BPA. La alternativa codón secuencia de fragmentos de ADN fue sintetizado por ADN 2,0 (Menlo Park, CA) y contiene un 5 'SrfI sitio y un 3' AgeI sitio. Los fragmentos sintetizados que figura la región de codificación del gen sqh de P82 hasta el final del gen a Q174, así como cinco aminoácidos de la región entre enlazador sqh y las buenas prácticas agrarias (ver información de apoyo, la figura S1]. pCasper-sqh-gfp construcciones fueron digeridos con SrfI y AgeI enzimas de restricción y los fragmentos fueron sintetizados en el ligated plásmidos para crear plásmidos pCasper-sqhT20S21alt-GFP, pCasper-sqhA20A21alt-GFP, y pCasper-sqhE20E21alt-BPA.

Drosophila S2 células se mantuvieron en placas de Schneider en la Drosophila los medios de comunicación (Gibco) complementado con un 10% al calor de SFB inactivado a 27 ° C. El SDP-α-tubulina / RLC-GFP estables las líneas celulares fueron creados por la co-transfección del plásmido pUbp-mRFP-α-tubulina [1] y pCasper-Sqhalt-GFP plásmidos Cellfectin utilizando el reactivo (Invitrogen). Transfectadas establemente células fueron seleccionados con 1 mg / ml G418 (Life Technologies) durante tres semanas antes de eliminación de drogas de la cultura.

La interferencia del ARN

Alrededor del 5 × 10 5 células fueron chapados en los distintos pozos de 24 y placas de cultivo de tejidos y tratados con 10 μ g de dsRNA durante cinco días, tal como está descrita anteriormente [40]. Plantillas para la transcripción de dsRNA se generaron por PCR con el promotor T7 secuencia ascendente de las siguientes secuencias: RLC (5'CATCAACTTCACCATGTTCC3 'y 5'TTACTGCTCATCCTTGTCC3'); Rok (5'GAGAACACTCAAAAGCTGAAAAAG3 'y ACAGTTCCTTCTGTAGCTGGTTTT3'); Rho1 (5'TTTGTTTTGTGTTTAGTTCGGC3 ' y 5'ATCAAGAACAACCAGAACATCG3 '); Citron (5'TTCAACCTCTGGAAGTTATCGG3' y 5'GTGAAACCGTTGGTGATATGC3 ')

Inmunoticción y microscopía de fluorescencia

S2 células fueron fijadas en formol al 3% y permeabilized en 0,1% Tritón X-100 en PBS. Las células fueron teñidas con 1 μ g / ml DAPI (sondas moleculares) para visualizar el ADN, así como con los siguientes anticuerpos primarios: 1:1000 Dm1 α anti-α-tubulina (Sigma), 1:500 anti-fosfato-RLC [24], 1:500 y anti-miosina II pesada cadena [33]. Para imágenes en vivo de células, las células fueron chapados en la celda de imágenes de las cámaras (Ciencia Aplicada) y que se les permita establecerse en el cubreobjetos durante 30 minutos. Las imágenes fueron tomadas con un Zeiss Axiovert 200 epifluorescente microscopio invertido equipado con un 100 × lente objetivo. Las imágenes fueron tomadas cada 20 segundos.

Immunoblotting

S2 células fueron zadas y los niveles de proteína se cuantificaron utilizando el reactivo Bradford (BioRad). La dilución de serie el control de lisados celulares, así como RNAi tratados lisados celulares fueron cargados en cada gel y separados por SDS-PAGE electroforesis. Las proteínas se transfirieron a membranas de nitrocelulosa, las membranas fueron bloqueadas en el 5% de leche descremada, y probaron con 1:2500 dilución de un anti-RLC anticuerpos proporcionados por Tsien Hsu (Universidad Médica de Carolina del Sur), seguido por 1:5000 dilución de cabra - anti-IgG de conejo-HRP-anticuerpo (Pierce bioquímicos). Las señales se han desarrollado con reactivos ECL (Amersham) y cuantificarán mediante ImageQuant (Amersham).

Apoyo a la Información

Damos las gracias a Tsien Hsu (Colegio Médico de Carolina del Sur), Luke Alphey (Oxford University), y Dan Kiehart (Duke University) para ofrecer la amabilidad de anticuerpos, y Roger Karess (Centre de Genetique Moleculaire, Gif-sur-Yvette, Francia) para el RLC-GFP construir.