PLoS ONE, 2006; 1(1): (más artículos en esta revista)

GATA factor de transcripción necesarios para la inmunidad a bacterias y hongos patógenos

Biblioteca Pública de la Ciencia
Samantha Kerry, Michael TeKippe, Nathan C. Gaddis, Alejandro ABALLAY [*]
Resumen

En la última década, Caenorhabditis elegans se ha utilizado para diseccionar varias vías genéticos implicados en la inmunidad, sin embargo, poco se sabe sobre los factores de transcripción que regulan la expresión de efectores inmunes. C. elegans no parecen tener un homólogo funcional de los principales inmune factor de transcripción NF-κ B. En este sentido, ponen de manifiesto que el que intestinal factor de transcripción GATA ELT-2 es necesaria para ambos la inmunidad a la Salmonella enterica y la expresión de un tipo C-gen lectina, CLEC-67, que se expresa en las células intestinales y es un buen marcador de S. enterica infección. También se encontró que ELT-2 es necesaria para la inmunidad a Pseudomonas aeruginosa, Enterococcus faecalis, y Cryptococcus neoformans. La falta de inhibición inmune de DAF-2, que regula negativamente la FOXO factor de transcripción DAF-16, rescata la hypersusceptibility a los agentes patógenos fenotipo de ELT-2 (RNAi) animales. Nuestros resultados indican que el ELT-2 es parte de un multi-agente patógeno vía de defensa que regula la inmunidad innata independientemente de la vía de señalización DAF-2/DAF-16.

Introducción

El estudio de inmunidad innata recibido renovada atención cuando los primeros paralelismos entre mamíferos y Drosophila melanogaster inmunidad se descubrieron (revisado en [1] - [3]]. Desde entonces, diversos invertebrados modelo de sistemas se han utilizado para diseccionar altamente conservadas por la respuesta inmune sin las complicaciones de la inmunidad adaptativa. El genéticamente tractable nematodo Caenorhabditis elegans, que se ha utilizado durante décadas para estudiar los mecanismos de una serie de procesos biológicos, se ha convertido en un bien establecido de invertebrados modelo para el estudio de la patogénesis microbiana y la inmunidad innata (revisado en [1], [4] -- [7]]. C. elegans se ha desarrollado mecanismos para reconocer y responder a potenciales patógenos inducible utilizando un sistema inmunológico que contiene muchos altamente conservadas por efectores, incluyendo anti-proteínas bacterianas, lysozymes, lipasas, y C-tipo lectinas [8]. Además, conserva vías de señalización se han vinculado a C. elegans inmunidad, incluido el CED-3, TGF-β, PMK-1 MAP quinasa, y DAF-2 vías (revisado en [1], [6], [9]], lo que sugiere que, a pesar de la gran brecha entre la evolución y los nematodos mamíferos, algunos de los mecanismos subyacentes de la inmunidad pueden ser similares.

A pesar de las similitudes, también hay características de la respuesta inmune de C. elegans que lo distinguen de los mamíferos y otros invertebrados. Aunque los receptores Toll, primero estudió en Drosophila melanogaster y posteriormente estudió en los mamíferos, están altamente conservadas en todas estas especies, no parecen desempeñar un papel en la C. elegans la respuesta inmune [10]. En concreto, el único nematodo del receptor Toll homólogo, Tol-1, se expresa en el nematodo del sistema nervioso y está implicado en conductas de evitación bacteriana, en lugar de en la activación de genes antimicrobianos [10], [11]. En consonancia con la falta de Toll-like receptor-mediada por la inmunidad, no hay pruebas de una NF-κ B homólogo en C. elegans. NF-κ B-como factores de transcripción son fundamentales en la regulación de la respuesta inmune con peaje, ya que el control de la expresión de genes clave implicados en la inmunidad innata en muchos organismos (revisado recientemente en [12]]. Por lo tanto, existe una clara necesidad de determinar con exactitud los factores de transcripción que participan en la modulación de la respuesta inmune de nematodos, algunos de los cuales también pueden desempeñar importantes funciones de inmunidad en los mamíferos.

Recientemente, Shapira et al. [13] demostraron que el factor de transcripción intestinal ELT-2 regula la inmunidad intestinal al patógeno humano p. aeruginosa. En este sentido, muestran que la interrupción de ELT-2 causas nematodos para convertirse en hypersusceptible a Salmonella enterica mediada por asesinato y que ELT-2 upregulates la expresión de CLEC-67 que es un marcador de S. enterica infección por C. elegans. Nuestros resultados también sugieren que el ELT-2 es parte de un multi-agente patógeno vía de defensa que regula la inmunidad innata, no sólo a S. enterica y Pseudomonas aeruginosa, sino también a los Gram-positivas bacteria Enterococcus faecalis y los hongos patógeno Cryptococcus neoformans. También muestran que ELT-2 funciones en C. elegans inmunidad independientemente de la vía de señalización DAF-2/DAF-16. Estos datos indican que el ELT-2 es un regulador importante de una conservadas C. elegans respuesta inmune a los patógenos.

Resultados
ELT-2 RNAi animales son hypersusceptible a S. enterica mediada por asesinato

El tracto digestivo de C. elegans es un interfaz entre el sistema inmune y los posibles agentes patógenos bacterianos. Esto es especialmente importante en el caso de bacterias como el patógeno humano S. enterica que es capaz de establecer una infección persistente por el C. elegans intestino [14], [15]. Además, varios conocidos efectores de la C. elegans sistema inmunológico se expresan en las células intestinales. Debido a este vínculo entre el intestino y la inmunidad, que trató de identificar factores de transcripción intestinal que podrían modular C. elegans la respuesta inmune.

Más de 900 funcional factores de transcripción se prevé que se perforará en el C. elegans genoma [16]. Para identificar genes que codifican factores de transcripción que participan en la regulación de efectores inmunes expresada en la C. elegans células intestinales, los candidatos fueron seleccionados sobre la base de los siguientes criterios: i) los genes que se sabe están expresadas en el intestino (141 candidatos), ii) genes expresados durante la edad adulta (10 de los 141 candidatos), y iii) los genes que regulan sólo intestinal o funciones para las que una función en la edad adulta no ha sido informado (7 de los 10 candidatos). De los siete candidatos, cinco fueron elegidos para su posterior análisis en función de la disponibilidad de RNAi clones [17]. Por lo tanto, para determinar si el candidato seleccionado los genes juegan un papel en C. elegans inmunidad, hemos utilizado RNAi de inhibir su expresión y la prueba de susceptibilidad genética de estos animales a ablated S. enterica. Los resultados mostrados en la Tabla 1 demuestran que sólo la ablación de RNAi ELT-2 resultados consistentes en una mayor susceptibilidad de C. a S. elegans enterica.

El aumento de la susceptibilidad de ELT-2 (RNAi) para los animales S. enterica (Tabla 1 y Figura 1A] indica que ELT-2 pueden estar involucrados en la regulación de una respuesta inmune a este agente patógeno. Sin embargo, también es posible que ELT-2 (RNAi), los animales están enfermos debido a un mal funcionamiento del intestino. ELT-2 es un elemento crucial GATA factor de transcripción que participan en la diferenciación intestinal [18] - [22] y ELT-2 knockouts exhiben una gut-parto obstruido (Gob) fenotipo que da lugar a la detención en fase de larvas L1 y la posterior muerte, al parecer de inanición [ 18]. Por lo tanto, para estudiar si ELT-2 ablación de RNAi hace que los animales enfermos, primero ensayaron la vida útil de ELT-2 RNAi nematodos. Figura 1B muestra que, si bien ELT-2 RNAi animales exhiben una reducida vida útil en comparación con los animales control, sobrevivir al menos ocho días, lo que indica que el hambre no es una causa de la muerte.

Para probar si ELT-2 (RNAi), los animales son más susceptibles a S. enterica mediada por asesinato si se tiene en cuenta su reducida vida útil en E. coli, la mortalidad relativa de ELT-2 (RNAi), los animales alimentados con S. enterica se utilizó para evaluar la susceptibilidad a S. enterica mediada por el asesinato de ELT-2 RNAi animales. La medida relativa de mortalidad se tienen en cuenta los cambios en la vida debido a una modificación general en aptitud en lugar de un defecto en la inmunidad innata contra S. enterica. La mortalidad relativa de ELT-2 (RNAi), los animales se calculó tal como se describe en Materiales y métodos y decidida a ser 2,4 (Cuadro 2]. El relativo de mortalidad obtenidos es comparable a la relativa mortalidad de los animales que carecen de CED-3-mediada por la inmunidad [23] y mayor que la mortalidad relativa de los animales que carecen de p38/PMK-1 [24], que es crucial para la C. elegans inmunidad [25] - [28], lo que indica que el ciclo de vida abreviada de la ELT-2 (RNAi), los animales infectados por S. enterica no es simplemente una consecuencia de ser enfermizo.

Curiosamente, dentro de las 24 horas, ELT-2 (RNAi), los animales muestran distensión de los intestinos llenos de E. coli que claramente contrasta con la falta de distensión intestinal lúmenes de control de animales (Figuras 1C y 1D]. Esta distensión intestinal no se observó a 20 minutos de exposición al E. expresando DSred coli (datos no presentados), lo que indica que la distensión intestinal de ELT-2 (RNAi) los animales es causada por la proliferación de E. coli en lugar de por una estructura intestinal anormal. Esto no es sorprendente dado que la proliferación de E. coli es una causa de muerte en C. elegans [29], que E. coli crecido en los medios de comunicación ricos mata a C. elegans [30], y los animales inmunocomprometidos que son asesinadas por E. coli [31]. Además, después de 24 horas de exposición al E. coli que expresan DSred, ELT-2 RNAi animales expuestos la colonización intestinal de la bacteria; DSred fluorescencia estuvo presente en el ELT-2 RNAi nematodo intestino, incluso después de tres de una hora-las transferencias en fresco nonfluorescent E. placas coli (datos no presentados). Esto indica que E. coli que expresan DSred es capaz de colonizar persistentemente ELT-2 RNAi animales, que es de interés, como E. coli no suelen colonizar el intestino de nematodos en un persistente de moda [14].

Para asegurarse de que la distensión intestinal y E. coli colonización no son causados por un bloqueo que no se ve o la incapacidad de los músculos intestinales para pasar las bacterias a través del intestino, la defecación de ELT-2 (RNAi) expuestos a los nematodos E. coli se midió. Como se muestra en la Figura 1E, la defecación de ELT-2 (RNAi), los animales no es significativamente diferente de control de vectores animales. En efecto, si bien no difieren significativamente, existe un ligero aumento en la defecación de ELT-2 (RNAi) animales. En conjunto, estos resultados indican que el ELT-2 (RNAi), los animales no presentan el fenotipo Gob observado en ELT-2 knockouts, que no mueren por inanición, y que están inmunocomprometidos animales muertos por la reproducción de bacterias capaces de colonizar su intestino .

ELT-2 controles de expresión CLEC-67 que es un marcador de C. elegans respuesta inmune a S. enterica

Para proporcionar una prueba más del papel de ELT-2 en la inmunidad innata, se estudió su participación en la expresión del gen CLEC-67, que codifica un C-tipo lectina. Tradicionalmente, C-tipo lectinas funcionar como mediadores solubles que se unen específicamente los hidratos de carbono, lo que resulta en agente patógeno que las opsonization. Un informe reciente muestra que un C-tipo lectina de codificación de genes cuyo producto posee actividad antimicrobiana es upregulated en las células de Paneth la colonización microbiana, lo que indica que las lectinas son parte de un primitivo mecanismo de inmunidad innata [32]. Además, los genes de codificación de C-tipo lectina dominios se han encontrado para ser upregulated en C. elegans por un patógeno humano oportunista [33], un nematodo de patógenos específicos [34], y una toxina bacteriana [28], lo cual indica que se conservan los marcadores de C. elegans inmunidad.

Se decidió utilizar CLEC-67 como marcador de C. elegans inmunidad a S. enterica porque es coherente upregulated de este agente patógeno en varios perfiles de expresión experimentos realizados en nuestro laboratorio, ya que éste se expresa en el intestino (Figura 2A], y debido a que su región promotora contiene un sitio de unión GATA (A / T GATA A / G) . Como se muestra en la Figura 2B, el CLEC-67 upregulation de S. enterica observado en nuestra microarrays fue confirmada por QRT-PCR. Figura 2B muestra también que cuando ELT-2 expresión es ablated de RNAi, CLEC-67 es downregulated en comparación con el control de vectores, lo que indica que ELT-2 regula la expresión de este efector de C . elegans inmunidad a S. enterica. Para garantizar que las diferencias en el patrón de expresión CLEC-67 no se deben a defectos en intestinal ELT-2 (RNAi), los animales, que mide la expresión de seis genes de limpieza intestinal en ELT-2 (RNAi) y el control de vectores expuestos a los nematodos S . enterica (Figura 2C]. La expresión de cada uno de estos genes es inferior a dos veces diferentes de control de vectores, así dentro del margen de error del ensayo, y mucho menos que ver las diferencias en la expresión de CLEC-67. Por lo tanto, el cambio en el patrón de expresión CLEC-67 se debe a cambios en ELT-2, y no a cambios inespecíficos intestinal en la expresión génica.

ELT-2 es necesaria para la correcta C. elegans inmunidad a una variedad de patógenos microbianos

Para determinar si ELT-2 es parte de un sistema inmune específico para S. enterica o si es necesario para la inmunidad a los agentes patógenos en general, ELT-2 (RNAi), los animales estaban infectados con el Gram-negativos de patógenos bacterianos p. aeruginosa [35], los Gram-positivas patógeno bacteriano E. faecalis [30], y los hongos patógenos C. neoformans [36] tal como se describe. Por todos estos patógenos, ELT-2 (RNAi), los animales muestran un aumento de la mortalidad en comparación con el control de vectores animales (Figura 3]. Estos datos indican que la ablación de RNAi ELT-2 aumenta C. elegans susceptibilidad a diferentes tipos de bacterias y hongos patógenos.

El DAF-2/DAF-16 similar a la insulina que regula la vía de la longevidad en C. elegans recientemente se ha vinculado a la inmunidad contra las bacterias. DAF-16 es un FOXO factor de transcripción, que regula una amplia variedad de genes necesarios para la longevidad, el estrés-respuesta, el desarrollo y la inmunidad [37], [38], y es regulada negativamente por el DAF-2 [39]. Por lo tanto, daf-2 mutantes mayor exposición DAF-16 la actividad y son más resistentes a diferentes bacterias patógenas [31], [40], [41]. Dado que nuestros datos indican que el ELT-2 regula un multi-agente patógeno respuesta inmune, se estudió si el factor de transcripción es necesaria para los efectos de la DAF-2 en la inmunidad a los agentes patógenos. En primer lugar, se estudió si daf-2 (e1370) mutantes eran más resistentes a los hongos patógenos Cryptococcus neoformans y, a continuación, si la ablación de RNAi ELT-2 reduce el fenotipo de resistencia daf-2 (e1370) animales. Como se muestra en la Figura 4, daf-2 (e1370) mutantes son más resistentes no sólo a S. enterica y E. faecalis, como se indica anteriormente [40], sino también a Cryptococcus neoformans, lo que indica que DAF-2 regula la respuesta inmune a los patógenos en general. Por otra parte, este aumento de la resistencia a la C. neoformans depende de DAF-16 como función daf-2 (e1370); daf-16 (RNAi), los nematodos han aumentado la mortalidad en comparación con el daf-2 (e1370) mutantes (Figura 4D].

Para resolver si el DAF-2 vía regula el sistema inmunológico de los nemátodos a través de ELT-2, RNAi se utilizó para ablate ELT-2 en el daf-2 (e1370) los animales que fueron expuestos a S. enterica, E. faecalis, y C. neoformans. Visiblemente, el daf-2 (e1370); ELT-2 (RNAi) nematodos parecen similares a ELT-2 (RNAi), los animales, siendo más delgada, más transparente y más salvajes de tipo nematodos o daf-2 (e1370) mutantes. Sin embargo, el daf-2 (e1370); ELT-2 (RNAi), los nematodos son mucho más resistentes a todos los patógenos probados que ELT-2 RNAi animales (Figura 4]. Curiosamente, daf-2 (e1370); ELT-2 (RNAi), los animales han aumentado la resistencia a E. faecalis en comparación con el daf-2 (e1370) los animales, lo que indica que ELT-2 puede suprimir las defensas inmunitarias específicas para E. faecalis que suelen ser inhibida por DAF-2. Control de experimentos indican que el daf-2 (e1370); daf-16 (RNAi), los animales tienen una mayor susceptibilidad a todos los agentes patógenos en comparación con el daf-2 (e1370) (Figura 4D y datos no presentados).

Discusión

Nuestros resultados sugieren que el factor de transcripción GATA ELT-2 regula un C. elegans inmunidad innata DAF-2/DAF-16 de forma independiente y que regula la expresión de CLEC-67 que es un marcador de C. elegans inmunidad a S. enterica infección. Anteriormente, ELT-2 ha sido vinculado al desarrollo intestinal, pero su papel en la inmunidad innata se desconocía. Desde DAF-16 no parece ser necesario para la inmunidad a bacteriana [40] y por hongos patógenos (Figura 4C], el ELT-2 requisito para una buena inmunidad a las bacterias y hongos patógenos descritos aquí ofrece una de las primeras evidencias que indican que un C. elegans factor de transcripción es necesaria no sólo para la expresión de la inmunidad relacionada con los genes, sino también por la supervivencia en presencia de agentes patógenos. De acuerdo con nuestros resultados, un documento publicado este manuscrito mientras se preparaba indica que ELT-2 es necesaria para la inmunidad a Pseudomonas aeruginosa [13].

Las más conocidas de mamíferos factor de transcripción GATA es GATA-3, que regula el desarrollo de CD4 + células T en un fenotipo Th2 [42]. Sin embargo, desde C. elegans no tiene inmunidad adaptativa, nuestros datos indican que los factores de transcripción GATA también están involucrados en la respuesta inmune innata. Esto también está apoyado por otros modelos de invertebrados, donde GATA vinculante elementos se han encontrado en los promotores de los genes importantes en defensa de las respuestas D. melanogaster [43] - [45], los gusanos de seda Bombyx mori [46], y el mosquito Aedes aegypti [47]. GATA factores de transcripción son evolutivamente conservados en una amplia variedad de eucariotas y son la mayoría de los casos involucrados en el desarrollo celular y la diferenciación [48]. Gatas 4-6 Humanos, que son las más similares a C. elegans ELT-2, están involucrados en el desarrollo del intestino y tejido cardíaco. Además, humanos GATA-4 se ha demostrado que el estrés cardíaco regular las respuestas [49] - [51], lo que indica que GATA-4 puede tener más de una función de desarrollo en los mamíferos.

Desde C. elegans no parece haber funcional NF-κ B-como factores de transcripción, ELT-2 puede ser una ancestral factor de transcripción necesario para sobrevivir a las infecciones microbianas en un ancestro común de los nematodos y vertebrados. La única otra C. elegans factor de transcripción, DAF-16, conocido por regular la expresión clásica de efectores inmunes, no se requiere para la defensa a patógenos bacterianos. Mostramos aquí que como DAF-16, ELT-2 parece regular la expresión de efectores inmunes. Además, parece ser necesario para sobrevivir en la presencia de bacterias Gram-negativas, Gram-positivas bacterias y hongos patógenos. La falta de inhibición inmune de DAF-2 rescates, total o parcialmente, a los agentes patógenos hypersusceptibility fenotipo de ELT-2 (RNAi), los animales que sugiere que ambos ELT-2 (RNAi), los animales no tienen defectos de desarrollo que los hacen más susceptibles a los agentes patógenos y que ELT-2 actos aguas arriba o independientemente de la vía DAF-2/DAF-16. Los hechos que la ablación de RNAi ELT-2 se traduce en un aumento de la susceptibilidad a agentes patógenos y que la ablación de RNAi DAF-16 (Figura 4] o mutaciones en el daf-16 [40] no afecta la susceptibilidad a agentes patógenos argumentan a favor de la segunda posibilidad. Tomados en conjunto, nuestros resultados indican que DAF-16 y DO-2 son dos de los principales factores de transcripción que regulan dos vías independientes necesarios para C. elegans inmunidad innata a patógenos microbianos.

Materiales y Métodos
Microbianos y nemátodos cepas

Los siguientes fueron utilizados: Escherichia coli OP50 [52], Salmonella enterica serovar typhimurium SL1344 [53], Enterococcus faecalis OG1RF [54], Cryptococcus neoformans H99 [55], y Pseudomonas aeruginosa PA14 [35]. C. elegans se utilizan cepas salvajes de tipo N2 y daf-2 (e1370). Estas cepas fueron obtenidas a partir de la Caenorhabditis Centro de Genética y mantenida en nuestro laboratorio.

Los animales transgénicos

Para generar el Pclec-67:: GFP construir, la región genómica 520 a 20 pb aguas arriba del CLEC-67 PCR fue amplificado utilizando los siguientes primers generados por PCR Primer Diseño para el C. elegans promotor:: GFP fusiones ( http://elegans.bcgsc.bc.ca/promoter_primers/ ): TCGTTTCTAATGCTCTCGGAA y TGGGTCCTTTGGCCAATCCCGGGGCGTTTTATGCGGGTTTGTTTA. La secuencia gfp fue amplificado de pPD95.79 (Addgene, Cambridge, MA) por PCR con cebadores las siguientes: CCCGGGATTGGCCAAAGGACCCAAAG y CCGCTTACAGACAAGCTGTGACCG. Estos productos de PCR fueron mixtos y un PCR con cebadores el exterior se llevó a cabo para fusionar el promotor y las buenas prácticas agrarias secuencias. El producto de PCR lineal de esta reacción se inyectó a 10 ng / μ l en N2 animales para crear la línea transgénica. El coinjection marcador pRF4 se inyectó a 50 ng / μ l. Los animales transgénicos fueron anestesiados con un 10% de azida sódica solución y visualizar utilizando un Leica MZ FLIII estereomicroscopio de fluorescencia.

C. elegans asesinato ensayos

C. elegans de tipo salvaje N2 animales y daf-2 mutantes se mantiene como hermafroditas a 15 ° C, modificados cultivados en placas de agar NG y alimentados con E. OP50 coli cepa, tal como se describe [52]. Las culturas se cultiven en Luria-Bertani (LB) caldo y placas de agar, excepto C. H99 neoformans y E. faecalis OG1RF que se cultiva en la levadura peptona dextrosa (YPD) y el cerebro-corazón perfusión (BHI) medio, respectivamente. Todos los agentes patógenos se cultivaron a 37 ° C, excepto C. neoformans que se cultivó a 30 ° C. Patógeno utilizado para el césped C. elegans asesinato ensayos fueron preparados por la difusión de 10-20 μ l de una cultura de la noche a la mañana las cepas bacterianas modificadas en medio agar NG (0,35% de peptona) a 3,5 cm de diámetro placas de Petri. C. neoformans y E. faecalis fueron chapados en BHI con 50 μ g / ml de gentamicina selección. Las placas fueron incubadas durante la noche antes de la siembra con adultos jóvenes RNAi animales, creado como se ha descrito anteriormente. El asesinato ensayos se realizaron a 25 ° C y los animales fueron trasladados una vez al día para las placas nuevas, hasta no más progenie eran evidentes. Los animales se anotó en los horarios indicados y considerados muertos a falta de respuesta al tacto.

C. elegans ensayos de la defecación

RNAi animales fueron trasladados a título individual, ya sea directamente desde las placas RNAi (tiempo 0) o después de 24 horas de exposición al E. OP50 coli modificada por NGM placas con el 0,35% de peptona. Los animales fueron transferidos inicialmente por separado para limpiar las placas LB agar durante 10 minutos para eliminar el exceso de bacterias, luego fue trasladado a una nueva placa de agar LB y que se les permita defecar durante 2 horas a 25 ° C. Los animales fueron luego eliminados, y las placas se incubaron durante la noche a 37 ° C. Cantidad de defecación fue determinado por el recuento de colonias de E. coli en cada plato. Los datos se normalizaron a la media de colonias de control de vectores para cada experimento.

C. elegans ensayos de envejecimiento

Modificado NGM placas que contienen 0,35% de peptona y 100 μ g / ml 5-fluorodeoxyuridine FUdR [56] fueron chapados con E. coli OP50 césped y permitir que se incuba a 37 ° C durante la noche. Jóvenes adultos RNAi animales fueron sembradas en estas placas, y anotó que se indican para C. elegans asesinato ensayos. Como FUdR inhibe el crecimiento de la progenie, la transferencia diaria de los nematodos es innecesario.

Interferencia por ARN

Se utilizó el ARN de interferencia para generar la pérdida de función RNAi fenotipos de la alimentación de los gusanos con E. coli cepa HT115 (DE3) expresando doble hundidos ARN que es homóloga a una meta de genes [57], [58]. En resumen, E. coli albergar la adecuada vectores se cultivaron en LB caldo que contiene la ampicilina (100 μ g / ml) y tetraciclina (10 μ g / ml) a 37 ° C durante la noche. Las bacterias fueron chapados en NGM placas con 100 μ g / ml ampicilina y 10 mM isopropílico β-D-thiogalactoside (IPTG) para inducir la doble expresión de ARN hundidos, y se dejan crecer la noche a la mañana a 37 ° C.

Grávidas los adultos se les permitió poner sus huevos en RNAi-expresando el césped de bacterias por 6-12 horas. Los huevos se permitió a desarrollar en los adultos jóvenes en RNAi o control de los vectores de placas a 25 ° C ni a 15 ° C en los experimentos con daf-2 (e1370). UNC-22 RNAi se utilizó como control positivo para la creación de la pérdida de función fenotipos. Cepas bacterianas expresar doble hundidos ARN para inactivar el C. elegans genes se han descrito [17]. El clon identidad fue confirmada por secuenciación. RNAi mediada por la ablación de ELT-2 resultados en los animales que a pesar de ser generalmente más pequeñas y más delgado que el control de sus homólogos, hacer sobrevivir a la edad adulta y no morir de inanición (Figura 1B].

Los análisis estadísticos

Animal supervivencia se representará gráficamente como una escalera curva utilizando el PRISM (versión 4.00) programa de ordenador. Curvas de supervivencia se consideran significativamente diferentes a las de control cuando los valores P <0,05. Prisma utiliza el producto limitar o método de Kaplan-Meier para calcular la supervivencia de las fracciones y la prueba de rango logarítmico, lo que equivale a la de Mantel-Heanszel prueba, para comparar curvas de supervivencia. El tiempo para el 50% de los nematodos a morir (hora de la muerte 50, TD 50) se calculó utilizando el software Prism (versión 4.01) utilizando un no-análisis de regresión lineal de supervivencia proporciones utilizando la ecuación: Y = inferior + (Arriba-abajo) / (1 +10 (LogEC 50-X) * Pendiente Hill)), donde Arriba se ha fijado en 100, de fondo se fija en 0, X es el tiempo en días y Y es el porcentaje de nematodos vivos en el momento X. En este ejemplo, TD 50 es equivalente a 50 CE. La mortalidad relativa de ELT-2 RNAi animales se calculó utilizando la ecuación: (TD 50 de control de gusanos en S. enterica / TD 50 de ELT-2 RNAi gusanos en S. enterica) / (TD 50 gusanos en el control de E. coli / TD 50 de ELT-2 RNAi en E. coli).

La microscopía confocal

Modificado NGM placas con el 0,35% de peptona se chapados en la noche a la mañana con las culturas de E. OP50 coli que lleva el plásmido pDSred Express (Invitrogen) y permitió a incubar la noche a la mañana. Control de vectores o ELT-2 RNAi adultos jóvenes nematodos Se sembró en estas placas y que se les permita alimentar a 25 ° C. En los horarios indicados, los animales fueron retirados de las placas y se colocan en portaobjetos de microscopio con un 2% de agarosa almohadillas en el 10% azida sódica solución. A cubreobjetos se encuentre por encima de la almohadilla de agar, y selló con esmalte de uñas claras. Las imágenes fueron capturados en las ampliaciones se indica mediante una Leica TCS SL microscopio confocal Leica Confocal y software (versión 2,61 Build 1537) (Leica Microsystems Heidelberg GmbH). Las imágenes de tamaño y ajustado por el brillo y el contraste en Adobe Photoshop.

ARN aislamiento

Grávidas N2 nematodos adultos se zadas utilizando una solución de hidróxido de sodio y cloro, lavado, y los huevos en la noche a la mañana sincronizado S basal medio líquido a temperatura ambiente. Sincronizado L1 animales fueron sembradas en placas de NGM modificados con el 0,35% de peptona que contienen S. enterica o E. OP50 coli, e incubadas a 25 ° C hasta alcanzar los nematodos etapa de jóvenes adultos (aproximadamente 24-30 horas). Los animales fueron recopilados por el lavado de las placas con M9 buffer, y el ARN extraído por medio de reactivo Trizol. Las muestras fueron nuevamente purificada mediante un kit de QIAGEN RNeasy residual y ADN genómico eliminadas mediante tratamiento DNasa (sin ADN kit Ambion Inc Austin TX). La concentración de ARN se determinó mediante espectrofotometría y las muestras fueron diluidas a 10ng/ul RNasa libre en el agua. Un mínimo de dos aislamientos de ARN se realizó para cada experimento.

Cuantitativas PCR en tiempo real (QRT-PCR)

QRT-PCR se realizó utilizando la Applied Biosystems Taqman Uno-Paso PCR en tiempo real utilizando SYBR protocolo de fluorescencia verde (Applied Biosystems) en un Applied Biosystems 7900HT PCR en tiempo real de máquinas en 96 y placa de formato. Primers fueron diseñados utilizando Aceprimer versión 1.2 ( http://elegans.bcgsc.bc.ca/aceprimer/aceprimer.shtml ). Cada independiente ARN preparación se midió por lo menos dos veces por QRT-PCR. Dentro de cada experimento, un mínimo de duplicar los pozos se ha ejecutado para cada conjunto de cebadores. Los datos correspondientes a cada gen se normalizaron para la limpieza de genes, ama-1, la gran subunidad de C. elegans RNA polimerasa II. Una vez normalizada, la diferencia entre pliegue SL1344 y OP50 muestras se determinó utilizando trazado y PRISM.

Damos las gracias a Erica Kintz de asistencia técnica. Damos las gracias al Centro de Genética Caenorhabditis para todas las cepas utilizadas en este estudio.