Journal of Molecular Signaling, 2006; 1: 7-7 (más artículos en esta revista)

Agonista mediada la internalización de M 2 mAChR es β-arrestin-dependientes

BioMed Central
Kymry T Jones (gt0008b@mail.gatech.edu) [1], Maria Echeverry (maceg09@yahoo.com) [2], Valerie A Mosser (vamosser@yahoo.com) [4], Alicia Gates (agates @ msm. edu) [3], una Darrell Jackson (darrell.jackson @ umontana.edu) [4]
[1] Escuela de Biología, Georgia Institute of Technology, Atlanta, GA 30332 EE.UU.
[2] Laboratorio de Parasitologia (301), Facultad de Medicina, Universidad Nacional de Colombia, Bogotá, Colombia
[3] Departamento de Anatomía y Neurobiología, Instituto de Neurociencias, Facultad de Medicina Morehouse, Atlanta, GA 30310 EE.UU.
[4] Departamento de Biomédicas y Ciencias Farmacéuticas, Universidad de Montana, Missoula, MT 59812 EE.UU.

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

Los receptores de acetilcolina muscarínicos (mAChRs) someterse agonista-promovió la internalización, pero las pruebas sugieren que el mecanismo de internalización es β-arrestin dependientes ha sido contradictoria y confusa. Estudios anteriores utilizando heterólogo de expresión de tipo salvaje o dominante-negativo formas de β-arrestins han informado de que agonista-promovió la internalización de los mAChRs M 2 es una β-arrestin-y clathrin-independiente fenómeno. Con el fin de eludir las complicaciones asociadas con la presencia de endógeno β-arrestin que pueda haber existido en estos estudios anteriores, hemos examinado agonista-promovió la internalización de la M 2 mAChR en fibroblastos de embriones de ratón (MEFs) derivados de β-arrestin que los ratones knockout la falta de expresión, ya sea uno o los dos isoformas de β-arrestin (β-arrestin 1 y 2).

Resultados

En silvestres tipo MEF transitoriamente las células que expresan los mAChRs M 2, 40% de la superficie M 2 mAChRs se sometió a la internalización y ordenada en compartimentos intracelulares siguientes agonista estimulación. En contraste, M 2 mAChRs no someterse a la internalización y la clasificación en compartimentos intracelulares en el MEF β-arrestin doble knockout células siguiente agonista estimulación. En las células doble knockout, ya sea expresión de β-arrestin 1 ó 2 isoformas como resultado el rescate de agonista-promovió la internalización. Estimulación de M 2 mAChRs dado lugar a una estable co-localización con las buenas prácticas agrarias de etiquetado β-arrestin endocítica dentro de las estructuras en varias líneas celulares; el compartimiento en que β-arrestin localizado está decidido a ser el endosoma temprano. - Agonista promovió la internalización de los mAChRs M 2 es moderadamente positivo rescatado en MEF β-arrestin 1 y 2 doble knockout células que expresan exógenos arrestin mutantes que son defectuosos en forma selectiva la interacción con clathrin (β-arrestin 2 Δ LIELD), AP-2 (β-arrestin 2 - F391A), o ambos clathrin/AP-2. Expresión de un truncado carboxi-terminal de la región de β-arrestin 1 (319-418) derogó totalmente agonista-promovió la internalización de M 2 mAChRs en el medio silvestre MEF tipo de células.

Conclusión

En resumen, este estudio demuestra que el agonista-promovió la internalización de los mAChRs M 2 es β-arrestin-y clathrin-dependiente, y que el receptor estable co-localiza con β-arrestin a principios de endosomal vesículas.

Fondo

Los receptores de acetilcolina muscarínicos pertenecen a la superfamilia de las proteínas G, junto receptores (GPCRs) que se expresan en una gran variedad de tejidos y se clasifican en cinco subtipos (M 1-M 5 mAChR). M 1, M 3, 5 y M son los mAChRs selectiva unida a proteínas G q mientras M 2 y M 4 mAChRs están vinculados a G i / G 0 proteínas [1, 2]. M 2 mAChRs son los principales muscarínicos subtipo en el corazón cuando su estimulación conduce a la regulación de la contractilidad miocárdica [3]. Al igual que con otros GPCRs, M 2 mAChR actividad está estrechamente regulada por la desensibilización y la internalización. Estos mecanismos de regulación son típicamente asociados con los receptores de fosforilación, ya sea seguido por el reciclado o la baja regulación [4 - 9].

Desensibilización es un proceso complejo que involucra agonista que dependen de la fosforilación en serina específicos / treonina residuos de G-proteína-quinasas del receptor acoplado (GRKs), seguida de β-arrestin vinculante. Dos ampliamente expresada isoformas de β-arrestin (1 y 2) se sabe que están involucrados en una disociación entre los receptores de sus afines G-proteínas así atenuante de señalización del receptor [10, 11]. Típicamente, los agonistas inducida por fosforilación facilita la internalización del receptor, que sirve para bien o hacia abajo resensitize de regular los receptores insensibilizados [12]. β-arrestins han demostrado para facilitar la internalización de interactuar directamente con la subunidad β 2 de la clathrin-AP2 (adaptador de proteínas 2) complejo y clathrin propia [11, 13]. Por lo tanto, β-arrestins puedan inducir a los receptores de secuestro de interactuar directamente con la maquinaria endocítica. Muchos receptores como el prototypic β 2-adrenérgicos2 AR) internalizar en un clathrin y β-arrestin de manera dependiente. Por lo tanto, β-arrestin facilita clathrin endocitosis mediada por [11, 13].

Además de desensibilización y la internalización, β-arrestins se sabe que juegan un papel en otros procesos celulares que incluyen el tráfico intracelular y la señalización [12]. Asociación de β-arrestin con agonista de los receptores de ocupados se ha demostrado para iniciar la señalización intracelular de funcionamiento como sitio de reunión para los componentes de señalización como Src, JNK3, y ERK1 / 2 [14 - 17]. Por lo tanto, β-arrestin-receptor complejos pueden conducir a la retención citosólicas y la activación de las moléculas de señalización siguientes mediada por los receptores de señalización en la superficie celular. El papel fisiológico de este proceso incluyen la disminución de la proliferación celular y la regulación de citoesqueleto reordenamientos de restringir el espacio de activación de ERK el citosol [16, 18]. Informes recientes también han sugerido que β-arrestins puede funcionar en post-endocítica etapas para regular los receptores de la clasificación. Se ha demostrado que los receptores de exposición diferencial afinidades de β-arrestin y, por tanto, se clasifican en dos grupos [19]. Clase A receptores (incluidos los β 2 AR y los receptores dopaminérgicos) se cree que interactúan con β-arrestin en la membrana plasmática, pero inmediatamente después de desvincularse de localización a clathrin revestido con piscinas. De ahí que los receptores de introducir principios de endosomes carece de β-arrestin y son típicamente resensitized y rápidamente reciclado [20]. En contraste, los receptores de Clase B (vasopresina V-2 R, angiotensina-AT 1A R, y los receptores neurotensin) estable asociado con β-arrestin a fin de que β-arrestin / receptor complejos permanecen intactos y son internalizados en juxtanuclear endosomal compartimentos [21]. Esta interacción puede persistir durante períodos prolongados de tiempo. Esta asociación estable pueden dictar la cinética de los receptores de reciclaje, ya que en R 1A y 2 R V reciclar muy lentamente [20, 21]. A consecuencia funcional de β-arrestin asociación también pueden facilitar a los receptores de baja regulación.

El papel de β-arrestins en la regulación del tráfico de la M 2 mAChRs ha sido contradictoria y confusa. Los informes han demostrado que la fosforilación de GRK2 en serina / treonina residuos en el tercer bucle intracelular de H 2 mAChRs reclutas β-arrestin y conduce a la desensibilización del receptor y su posterior internalización [7].

Si β-arrestin está involucrado directamente en agonista-promovido endocitosis de M 2 mAChRs sigue sin estar clara. De hecho la sobre expresión de β-arrestin ha informado a aumentar agonista-promovió la internalización de los mAChRs M 2, pero no de M 1 o M 3 mAChRs [22]. Por otra parte, Claing et al. han demostrado que M 2 internalizar los mAChRs en un dynamin-y β-arrestin de manera insensible cuando se expresa en células HEK293 [23]. Otros han informado de que el Arf6 GTPase (ADP-ribosylation factor 6) facilita la M 2 mAChR entrada en primaria vesículas, que se funden con clathrin derivados de principios de endosomes [24, 25]. Estos datos no necesariamente excluye β-arrestin como un ente regulador en agonista-promovido endocitosis de los mAChRs M 2. Por lo tanto, a aclarar si agonista-promovió la internalización de M 2 mAChRs arrestin es dependiente, utilizado fibroblastos de embriones de ratón (MEFs) derivados de β-arrestin null ratones que carecen de expresión de uno o los dos isoformas (β-arrestin 1 y 2) y su littermates tipo salvaje como el control de las células [26]. Aquí mostramos que agonista-promovió la internalización de los mAChRs M 2 es β-arrestin dependientes y M 2 mAChRs forma complejos estables con β-arrestin en las primeras endosoma. Por otra parte, demostrar que agonista-promovido la internalización de los mAChRs M 2 es clathrin-dependiente. Estos resultados sugieren que la β-arrestin desempeña un papel importante en la regulación de M 2 mAChR actividad.

Resultados

Para determinar si el MEF las células utilizadas en este estudio expresaron mAChRs endógeno, se realizó RT-PCR encaminadas a la detección de mRNA de codificación M 1, M 2 y M 4 mAChR subtipos. Como controles positivos, hemos utilizado después del cerebelo de rata para el tejido M 2 mAChR mRNA y postnatal en ratas tejido cortical de la M 1 y M 4 mAChR mRNA. RT-PCR análisis demostraron claramente que MEF tipo silvestre, así como MEF doble knockout células (MEF KO1 / 2) no se expresan mRNA encoding M 1, M 2, M 4 o mAChR subtipos (Fig. 1]. En consecuencia, radioligand vinculante ensayos también confirmó que el MEF tipo silvestre, así como KO1 MEF / 2 no expresar los mAChRs en cualquier nivel detectable (datos no presentados). Por lo tanto, llegamos a la conclusión de que MEF células no expresan los mAChRs endógeno.

Para examinar si ectópica expresó mAChRs M 2-agonistas someterse promovió la internalización en MEFs, transfectadas transitoriamente MEF tipo salvaje y las correspondientes β-arrestin null células con un plásmido de codificación de una bandera de etiquetado porcina M 2 mAChR. Tras 24 horas de transfección, MEF tipo silvestre, MEF KO1, KO2 MEF, y MEF KO1 / 2 células fueron estimuladas con 1 mM carbachol por 1 h a 37 ° C. El número de receptores restantes a la superficie celular se midió utilizando una concentración de saturar el ligando hidrofílico [3 H]-NMS. Aproximadamente el 40% de la superficie M 2 mAChRs fueron internalizados en el medio silvestre tipo MEF, mientras que las células M 2 mAChRs en KO1 y MEF MEF KO2 células fueron internalizados en un 33% y 42%, respectivamente. En contraste, M 2 mAChRs no se internalizan en KO1 MEF / 2 (Figura 2A]. Estos resultados demostraron que expresó exógena M 2 mAChRs someterse agonista-promovido por la internalización MEF tipo salvaje y las células β-ya sea arrestin isoforma era suficiente para el secuestro. A fin de evaluar si los mAChRs M 2 fueron localizados, se utilizó la microscopía confocal de inmunofluorescencia en MEF tipo salvaje o KO1 MEF / 2 transitoriamente las células que expresan una bandera de etiquetado M 2 mAChR en la ausencia o presencia de carbachol. Como se indica en la Figura 2B, difuso de células superficiales de localización de los mAChRs M 2 se observó antes de carbachol Además en ambos fenotipos MEF. Tras la adición de agonistas, M 2 mAChRs en MEF tipo salvaje redistribuidos en las células discretas vesículas intracelulares dispersos en la célula, mientras que M 2 mAChRs expresada en KO1 MEF / 2 células se mantuvo en la superficie celular (Figura 2B]. El patrón difuso se indica en el MEF KO1 / 2 representa la superficie de células membrana plasmática localización ya que la ausencia de detergente lleva a un idéntico patrón de coloración como se ha visto en células sin tratamiento (datos no presentados). La bandera de etiqueta se encuentra en la N-terminal del receptor y es accesible a exógena añadido de anticuerpos, incluso en ausencia de detergente.

Para determinar si la selectividad entre β-arrestin isoformas en su capacidad de mediar agonista-promovió la internalización de los mAChRs M 2, se examinaron agonista promovió la internalización en KO1 MEF / 2 células que expresan co-M 2 mAChR y la bandera de etiquetado β-arrestin 1 y / ó 2 (Fig. 3A]. Western Blot confirmó que el análisis de etiquetado BANDERA β-arrestins se expresaron (Fig. 3B]. Las células fueron tratadas con 1 mM carbachol de 1 h y el grado de internalización del receptor se evaluó a través de [3 H]-NMS. MEF KO1 / 2 de nuevo con las células β-arrestin 1, β-arrestin 2, o ambas isoformas exhiben M 2 mAChR la absorción del mismo modo (Fig. 3A]. Estos datos sugieren que no sólo es agonista-promovió la internalización de M 2 mAChR β-arrestin-dependientes, sino también no hay selectividad entre β-arrestin isoformas (Figura 2A y 3A]. Para evaluar si estimulado y interiorizado M 2 mAChRs co-localizar con β-arrestin 1 o 2, de nuevo con etiquetas GFP-β-arrestin 1, 2, o ambas isoformas de abanderamiento de etiquetado M 2 mAChRs en KO1 MEF / 2 y evaluaron las células su localización por microscopía de inmunofluorescencia. Internalizado M 2 mAChRs se mantuvo asociado con β-arrestin 1-GFP (datos no presentados) o β-arrestin 2-GFP (Fig. 4] en compartimentos intracelulares tras 30 minutos de estimulación con 1 mM carbachol. Para determinar si este fenómeno se produce en otros tipos de células que expresaron M 2 mAChRs en HeLa, COS-7, la aorta de rata y células musculares lisas (RASMCs). Como se observa en KO1 MEF / 2 células, interiorizado M 2 mAChRs sigue siendo co-localizada con β-arrestin 2-GFP en HeLa, COS-7, y RASMCs (Fig. 5]. Estos resultados demuestran que agonista-promovido la internalización de la M 2 mAChR es β-arrestin-dependiente, y que internalizado M 2 mAChRs estable asociado con cualquiera de β-arrestin isoforma en múltiples líneas celulares.

Anteriormente, el secuestro de M 1, M 3, 4 y M mAChRs ha demostrado ser a la vez β-arrestin y clathrin-dependientes [23, 27]. En contraste M 2 mAChR secuestro se informó de que en gran medida β-arrestin y clathrin-independiente [22, 28]. Para resolver si la β-arrestin dependientes de la internalización se observó en MEFs es independiente de clathrin, expresada en KO1 MEF / 2 células mutantes arrestin que fueron defectuosos en forma selectiva la interacción con clathrin (β-arrestin 2 Δ LIELD), AP-2 (β arrestin-2-F391A), o ambos clathrin/AP-2 (β-arrestin 2 Δ LIELD/F391A) [29]. Expresión de cualquiera de las β-arrestin 2 Δ LIELD o β-arrestin 2-F391A mutantes rescatadas agonista-promovido M 2 mAChR internalización (Fig. 6A]. Sin embargo, la internalización es sólo moderadamente rescatado por la expresión transitoria de un β-arrestin 2 mutantes defectuosos en ambos clathrin y AP-2 interacción (Fig. 6A]. Estos resultados indican que el β-arrestin dependientes de la internalización de M 2 mAChR puede incluir un componente que es independiente de las interacciones entre clathrin y AP-2.

Estudios recientes de Santini y compañeros de trabajo [30] mostró que agonista mediada por la activación de los β 2 AR es aún capaz de inducir el reclutamiento en las piscinas clathrin recubierto en células que expresan proteínas mutantes arrestin que eran defectuosas en vinculante con clathrin o AP-2, aunque en un menor grado. Expresión de la truncada COOH-terminal región de β-arrestin 1 (319-418), que contiene una clathrin sitio de unión del receptor pero carece de carácter vinculante, inhibe completamente la β 2 AR mediada por la agrupación de clathrin recubierto piscinas [31]. Por lo tanto, nos llevó a cabo experimentos con el truncado β-arrestin 1 (319-418) para determinar si agonista-promovió la internalización de la M 2 mAChR en MEFs se verían afectados. La expresión transitoria de la truncada β-arrestin 1 (319-418) inhibe completamente el agonista-promovió la internalización de la M 2 mAChR MEF en las células de tipo salvaje (Fig. 6B]. De este modo, se podría argumentar que el agonista-promovió la internalización de M 2 mAChR en un clathrin que dependen de vía. Sin embargo, como se indica anteriormente, expresión de una arrestin 2 mutante que era defectuosa en la interacción con ambos clathrin y AP-2 sólo moderadamente antagoniza el agonista-promovió la internalización de M 2 mAChR en KO1 MEF / 2 células (Fig. 6A]. Se podría argumentar que este arrestin mutante, deficiente en clathrin/AP-2 vinculante, fue todavía capaz de interactuar con clathrin/AP-2, aunque en un grado significativamente reducido. Por lo tanto, es razonable concluir que el agonista-promovió la internalización de los mAChRs M 2 se clathrin-dependiente.

Sobre la base de las conclusiones descritas más arriba, buscamos la identidad de las estructuras endosomal a la que β-arrestin localizado siguientes M 2 mAChR activación. Se realizó co-localización con marcadores análisis de los primeros endosoma, los primeros endosomal autoantígenos-1 (EEE-1) y el receptor de transferrina (TfnR), en combinación con β-arrestin 1-GFP. β-arrestin 1-GFP y la bandera-M 2 mAChRs se co-expresado en células HeLa, y las células fueron estimuladas con 1 mM carbachol durante 30 minutos. Nuestros resultados muestran que el β-arrestin 1-GFP significativamente co-localizada con la AEMA-1 y TfnR (indicado por las flechas en la Fig. 7]. β-arrestin 1-GFP no se observó a estar asociada con la AEMA-1 o TfnR en unstimulated células HeLa (Fig. 7]. Estos resultados indican que, una vez que M 2 son los mAChRs internalizado a través de un β-arrestin vía dependientes, siguen siendo co-localizada con β-arrestin en clathrin derivados de principios de endosomes. Para hacer frente a si otros subtipos de receptores muscarínicos estable asociado con β-arrestin en endosomes, expresó su co-HA-etiquetados M 1, M 3, M 4, 5 y M mAChRs con β-arrestin 2-GFP MEF en las células de tipo salvaje y evaluaron β-arrestin localización mediante microscopía confocal (Fig. 8]. La parte superior derecha inserción en cada marco de la figura muestra la localización de los receptores muscarínicos subtipo de una pequeña sección de la celda co-expresión de β-arrestin 2-GFP. Superposición de imágenes indican co-inmunoticción de los mAChRs (rojo) con β-arrestin 2-GFP (verde) y su grado de co-localización (amarillo). A falta de carbachol, β-arrestin 2-GFP es difusa localizada en el citosol de las células que expresan M 1 - M 5 mAChR subtipos (Fig. 8, 0 min). Tras 30 minutos de estimulación carbachol células que expresan sólo BANDERA humanos de etiquetado M 2 mAChRs expuesto β-arrestin 2-GFP localización en compartimentos intracelulares, como se indica por flechas indicando la superposición y la correspondiente superposición de imágenes (Fig. 8, 30 min); en otras células que expresan receptores subtipos, β-arrestin 2-GFP se mantuvo difusamente distribuidos. Por lo tanto, sólo las células que expresan el pabellón de etiquetado M 2 mAChR subtipo exhibió una interacción estable con β-arrestin a sitios intracelular en comparación con los otros subtipos muscarínicos.

Discusión

En el presente estudio, hemos investigado el papel de β-agonistas en arrestin-promovió la internalización de los mAChR M 2, que ha sido previamente informado de que β-arrestin independiente. En estudios anteriores, heterólogo de expresión de tipo salvaje y dominante-negativo formas de arrestins se utilizó para evaluar la función de estas proteínas [22, 32]. Lamentablemente, dichos estudios son difíciles de interpretar debido a las complicaciones asociadas con las proteínas endógenas. En un intento por aliviar estas complicaciones, que utilizaron fibroblastos de embriones de ratón (MEFs) derivados de β-arrestin knockouts endógena en la que expresó β-arrestin 1 y 2 se han eliminado genéticamente [26]. Estas células nos proporciona una oportunidad única para evaluar si β-arrestin proteínas están involucradas en el proceso de agonista-promovió la internalización de los mAChRs M 2. Aquí, nos muestran que promovió-agonista de la endocitosis M 2 mAChR es β-arrestin-y clathrin-dependiente.

Ambos β-arrestin 1 y 2 isoformas se informó a formar complejos de alta afinidad con el agonista-M 2 activado mAChR [33], lo que sugiere que o bien isoforma es capaz de mediar agonista-promovió la internalización del receptor. En corroboración con estos resultados, se observó que no selectividad entre β-arrestin isoformas en la mediación-agonista promovió la internalización de los mAChRs M 2. Tal vez, esta falta de selectividad entre β-arrestin 1 y 2 puede explicar por qué utilizar un exceso de expresión de una única forma mutante de β-arrestin no bloquear completamente el agonista-promovió la internalización de los mAChRs M 2. Curiosamente, nuestros estudios revelaron que más β-arrestin se mantuvo estable asociada con la M 2 mAChR en juxtanuclear endosomes durante largos períodos de tiempo siguientes agonista de la exposición. Dado que las células MEF no endógena expresar mAChRs, comparamos nuestras observaciones en un fisiológicamente relevantes línea celular (RASMCs) y dos modelos de líneas celulares (HeLa y COS-7). Similar hallazgo se observó también en estas células. Un examen más detenido de β-arrestin post-endocítica tráfico reveló que M 2 mAChR estimulación llevado a la redistribución en arrestin Tfn y del EEE-1 positivos compartimentos, marcadores de los primeros endosoma. De acuerdo con nuestros hallazgos, Delaney et al. han informado de que estimuló M 2 mAChRs internalizar de manera tal que rápidamente se fusiona con clathrin derivados de principios de endosomes [25].

M 2 mAChRs seguir la pauta general utilizado por la mayoría de GPCRs en la medida en que están internalizados a través de un β-arrestin que dependen de mecanismo. Además, el estable unión de β-arrestin activado con H 2 mAChRs en microcompartments sigue el paradigma de otra clase B GPCRs. Implicaciones de estos hallazgos es que β-arrestin pueden dictar el tráfico intracelular y / o señalización de la M 2 mAChRs. Desde β-arrestin se ha convertido en un versátil adaptador de andamios y proteínas, su función en la regulación de M 2 mAChR que dependen de la actividad celular puede ser significativo. Se ha demostrado que el β-arrestins interactuar con el tráfico de maquinaria como Arf6, RhoA, NSF, y una variedad de proteínas de señalización como ASK1, JNK3, y ERK1 / 2 [34]. Estable β-arrestin / receptor complejos, como demostrado por los receptores de clase B, parece que reorientar los complejos de señalización para el citoplasma lo que la activación frente al citoplasma de las metas, mientras que la prevención de ERK translocación al núcleo [15, 16, 35]. El papel fisiológico de este proceso puede ser a participar en la reorganización del citoesqueleto de actina y quimiotaxis [18, 36]. Con respecto al tráfico intracelular, los patrones de β-arrestin vinculante para activar los receptores parecen modular los receptores de reciclaje y / o degradación [37]. Clase A son los receptores de típicamente resensitized y posteriormente reciclados, mientras que la clase B se someten a los receptores lento reciclaje y / o baja regulación. M 2 mAChRs Se ha demostrado que someterse lento reciclado a la membrana plasmática a la eliminación agonista [38]. ¿Qué función o funciones β-arrestin juega en M 2 mAChR reciclado y / o deterioro es actualmente desconocido. La consecuencia funcional de estable β-arrestin / M 2 mAChR complejos de lo que queda por determinar.

Estudios anteriores han sugerido que M 2 mAChR internalización no proceder a través de una β-arrestin / clathrin mediada vía [22, 23, 28]. Por ejemplo, Delaney y compañeros de trabajo [25] informó anteriormente de que M 2 mAChRs internalizado por un clathrin-vía independiente basado en la utilización de un dominante negativo K44A dynamin-1 mutante. Sin embargo, expresión de una N-terminal supresión dynamin-1 mutante N272 que carece de todo el GTP vinculante de dominio, a diferencia de K44A dynamin, mucho más inhibida agonista-promovido M 2 mAChR internalización [39]. Por lo tanto, nos llevó a cabo experimentos con mutantes arrestin que fueron deficientes en forma selectiva la interacción con clathrin, AP-2, o ambos clathrin y AP-2, para determinar si agonista mediada la internalización de los mAChRs M 2 se clathrin-dependiente. Expresión de arrestin mutantes defectuosos en la interacción con cualquiera de clathrin (β-arrestin 2 - Δ LIELD) o AP-2 (β-arrestin 2-F391A) no antagonizar M 2 mAChR internalización. Por otra parte, la sobre expresión de un dominante negativo arrestin mutante que era defectuosa en la interacción con ambos clathrin y AP-2 sólo modestamente antagoniza M 2 mAChR internalización en KO1 MEF / 2 células. Por lo tanto, es razonable concluir que estos datos corroboran estudios previos que indican que M 2 mAChR internalización es clathrin-independiente. Sin embargo, Santini y compañeros de trabajo [30] han informado de que arrestin mutantes con problemas de carácter vinculante para clathrin o AP-2 todavía capaz de mostrar la contratación de β 2 a clathrin AR-revestido piscinas, aunque a un menor grado. Por lo tanto, puede ser prematuro concluir que M 2 mAChR internalización es β-arrestin-dependiente pero clathrin/AP-2-independent. Expresión de la truncada carboxi-terminal de la región de β-arrestin 1, que contenía la interacción clathrin sitio, se ha demostrado que abrogar completamente β 2 AR mediada por la agrupación de clathrin recubierto piscinas [31]. Exógenos expresión de este mutante bloquear completamente agonista-promovió la internalización de M 2 mAChRs en MEFs tipo salvaje. En conjunto, estos resultados indican que el agonista-promovió la internalización de los mAChRs M 2 es β-arrestin-dependiente y lo más probable clathrin/AP-2-dependent. Sin embargo, no podemos descartar que el C-terminal de la región arrestin 1 es la interacción con otro factor, independiente de clathrin/AP-2 que pueden ser responsables de mediar la internalización de la M 2 mAChR. De hecho los estudios anteriores han demostrado que la Arf6 GTPase regula-agonista promovido endocitosis de la M 2 mAChR [24, 25]. Se ha demostrado que β 2 AR estimulación conduce a la activación de Arf6 GTPase, lo que facilita la endocitosis del receptor [40]. Es posible que el secuestro de M 2 mAChR requiere la activación de Arf6 GTPase por un β-arrestin mediada vía, que puede ser un componente importante de agonista-promovió la internalización de la M 2 mAChR. Esto corrobora los estudios anteriores, lo que indica un papel crítico para Arf6 GTPase en la mediación promovido agonista-M 2 mAChR internalización [24].

El diferencial de la trata de β-arrestin con los mAChRs a endosomes parece ser subtipo específico. Hay cinco subtipos denominado muscarínicos M 1-M mAChR 5 mAChR. M 1, M 3, 5 y M mAChRs pareja a proteínas G q activar y fosfolipasa que mAChR M 2 y M 4 mAChR pareja a G i / o para inhibir adenylyl ciclasa y activar los canales de K + [1, 2]. Como se muestra en la Figura 8, estimulado subtipos de lado muscarínicos M 2 de mAChRs son secuestradas en endocítica vesículas que carezcan de β-arrestin. Se ha demostrado que mAChR M 1, M mAChR 3, 4 y M mAChR requieren arrestin β-agonistas en la mediación promovido por la internalización [23] por lo que no descartan la posibilidad de que arrestin ha sido contratado para la membrana plasmática después de la estimulación y, a continuación, desvincula rápidamente de los receptores. Es posible que carbachol puede inducir a los receptores de conformaciones que no podrá promover estable β-arrestin asociaciones con los otros subtipos mAChR. Sin embargo, la adaptación de la secuencia de la M 2 y M 4 mAChR (utilizando el T-café programa) reveló que los subtipos de alta exposición secuencia similitudes; curiosamente, la secuencia diferencias radican en el tercer bucle intracelular, específicamente en los residuos 293-313 en el M 2 mAChR. Como se describe de Pals-Rylaarsdam y otros, un grupo de serina y treonina lugares en las posiciones 307-311 someterse agonista promovido fosforilación, lo cual es necesario y suficiente para β-arrestin interacción [6]. Este sitio puede ser importante para la designación de estable la interacción con β-arrestin. M 2 mAChR secuencias de abajo de esta página web a 348-368 también difieren significativamente de la M 4 mAChR lo que sugiere que un motivo adicional pueden estar involucrados.

Conclusión

En resumen, los datos presentados en este estudio demuestran que la promovió-agonista de la endocitosis M 2 mAChR subtipo se produce a través de un itinerario arrestin dependientes en células MEF. Exógena expresó β-arrestin proteínas se mantuvo estable asociada con la M 2 mAChR momento de la entrada en principios de endosomal compartimentos. La falta de estabilidad β-arrestin interacción con otros subtipos mAChR sugiere un papel único de β-arrestin en la regulación de la actividad de la M 2 mAChR subtipo.

Métodos
Materiales

[3 H] - N-methylscopolamine (SMN) (81-84 Ci / mmol) fue adquirido de Amersham Corp (Buckinghamshire, Inglaterra). Dulbecco's modificó Eagle's Medium (DMEM), F-10, la penicilina y la estreptomicina, suero fetal bovino, las enzimas de restricción y LipofectAMINE 2000 se compraron de Invitrogen (Carlsbad, CA) EX-GEN fue adquirido de Fermentas (Hanover, MD). El anti-FLAG M2 anticuerpo monoclonal de ratón anti-M1 BANDERA anticuerpos fueron adquiridos de Sigma-Aldrich (St. Louis, MO); ratón anticuerpos contra β-arrestin 1 y 2 fueron adquiridos de Santa Cruz (Santa Cruz, CA). El anti-HA.11 anticuerpo monoclonal fue adquirido de Covance de Investigación de Productos (Berkeley, California) en la enseñanza secundaria conjugado HRP-anticuerpos fueron adquiridos de Jackson Immunoresearch Laboratories Inc (West Grove, PA). Carbachol, atropina y todos los demás reactivos fueron adquiridos de Sigma-Aldrich. Dr Neil Nathanson (Universidad de Washington) la amabilidad de siempre y construir la expresión de la especie porcina BANDERA-etiquetados M 2 mAChR [32]. HA-etiquetados M 1, M 3, M 4, 5 y M mAChRs fueron adquiridos a partir de cDNA UMR Resource Center (Universidad de Missouri). Arrestin mutantes, β-arrestin 2 - Δ LIELD, β-arrestin 2-F391A, β-arrestin 2 Δ LIELD/F391A, truncado y carboxilo terminal región de β-arrestin 1 (319-418) fueron amablemente proporcionados por el doctor Jeffrey Benovic ( Thomas Jefferson University) [30, 31]. El MEF tipo silvestre, β-arrestin 1 y 2 solo knockouts, β-arrestin 1 y 2 doble knockout células, y construye para BANDERA-etiquetados β-arrestin 1 y 2 fueron amablemente proporcionados por el doctor Robert Lefkowitz (Duke University Medical Center) [26]. Constructores de codificación β-arrestin 2-GFP y β-arrestin 1-GFP eran generosos regalos de doctor Stefano Marullo y han sido descritas previamente [41].

Cultivo de células y transfección transitoria

HeLa, MEF de tipo silvestre, MEF individuales y dobles de β-arrestin eliminatorias, RASMCs, y COS-7 se mantuvieron las células en DMEM complementado con un 10% de suero fetal bovino (SFB), 100 UI / ml penicilina, y 100 μ g / ml estreptomicina a 37 ° C con 5% de CO 2. Por inmunocitoquímica, células HeLa se cultivaron en cubreobjetos de vidrio a una densidad de 120000 células / así en seis platos y así transfectadas con EX-GEN o LipofectAMINE 2000, de acuerdo con el protocolo del fabricante por medio de 1 μ g de DNA /. Por ligando vinculante ensayos, las células fueron MEF chapada a 80000 células / pocillo en placas de 24 y así transfectadas con EX-GEN o LipofectAMINE 2000, de acuerdo con el protocolo del fabricante por medio de 1 μ g de DNA /.

Radioligand vinculante de ensayo

La internalización del receptor fue determinada mediante la medición de la unión de la membrana impermeable antagonista muscarínico [3 H] - N-methylscopolamine ([3 H]-NMS) a células intactas tal como está descrita anteriormente [42]. En pocas palabras, 24-42 h después de transfección, MEF células cultivadas en las 24 placas fueron bien tratados o no tratados con 1 mM carbachol durante 60 min a 37 ° C. Las culturas se lavaron dos veces con 1 ml de helado de PBS, y que estén etiquetados con 720 FMOL de [3 H]-NMS en 1 ml de PBS durante 4 horas a 4 ° C. Uniones no específicas se determinó como el obligado radiactividad en la presencia de 1 μ M de atropina. Etiquetados células fueron lavadas dos veces con 1 ml de helado de PBS, solubilized en 0,5 ml de 1% Tritón X-100 y en combinación con 3,5 ml de líquido scintillation seguida por la medición de la radiactividad. La internalización del receptor se define como por ciento de la superficie M 2 mAChRs no accesible a [3 H]-NMS en cada momento, relativa a la no-carbachol células tratadas.

Immunoblotting

Western blot se realizó un análisis sobre las células cultivadas en 6 y placas. Las células fueron solubilized en 0,5 ml de tampón de lisis que contiene: 50 mM HEPES (pH 7,5), 0,5% (v / v) Nonidet P-40, 250 mM NaCl, 2 mM EDTA, 10% (v / v) de glicerol, 1 mM orthovanadate de sodio, 1 mM de fluoruro de sodio y 1 μ g / ml de leupeptina inhibidores de la proteasa, aprotinina, pepstatin A, y 100 μ M benzamidine. La concentración de proteínas se determinó utilizando el método de ensayo de Bradford. Cincuenta μ g de lisados celulares fueron sometidos a 4-20% SDS-PAGE. Después de la transferencia, la membrana de nitrocelulosa fue bloqueada y luego probaron con anti-FLAG anticuerpo monoclonal. Inmunorreactiva bandas se visualizaron por un aumento de quimioluminiscencia tras añadir conjugado HRP-anti-ratón de anticuerpos. Después con el paso de glicina 0,1 M (pH 2.5), la membrana se re-probaron con anti-β-actina utilizando un kit de detección de Oncogene (Cambridge, MA).

Inmunofluorescencia Indirecta

24 h después de transfección, las células fueron tratadas como se describe en la figura de leyendas, fijados en formaldehído 4% en PBS durante 5 minutos y enjuagar con un 10% de suero fetal bovino y 0,02% azida en PBS (PBS / suero). Fija las células fueron incubadas con anticuerpos primarios diluido en PBS / suero que contiene saponina 0,2% para 45 minutos, y luego se lavan con PBS / suero (3 × 5 min.). Las células fueron incubadas con etiqueta fluorescente secundaria de anticuerpos en PBS-suero y el 0,2% saponina durante 45 minutos, se lava con PBS / suero (3 × 5 min.) Y una vez con PBS, y montados en portaobjetos de vidrio. Las imágenes fueron adquiridas mediante un Zeiss LSM 510 microscopio confocal de barrido o un epifluorescente Olympus BX40 microscopio equipado con un plan de 60 × pro lente, y fotomicrografías fueron preparados utilizando una Olympus SP MagnaFire cámara digital (Olympus America, Inc). Todas las imágenes fueron procesadas con Adobe Photoshop 7,0 software.

Aislamiento de RNA y RT-PCR

Total RNA celular de las células MEF, corteza y cerebelo de 2-3 semanas de edad Sprague Dawley, crías de ratas fue aislado utilizando TriZol de acuerdo a las instrucciones del fabricante. Un 50 μ l de reacción solución que contenga 1 μ g ARN total fue inverso-transcrito, y PCR se realizó a través de genes específicos y los primers Qiagen un paso RT-PCR kit. Gene primers específicos y reacciones de amplificación fueron las siguientes: Rata M 1 mAChR (175 bp amplificados producto): CCTCTGCTGCCGCTGTTG (sentido) y GGTGGGTGCCTGTGCTTCA (antisentido); Rat M 2 mAChR (686 bp amplificados producto): CACGAAACCTC TGA CCTACCC (sentido) y TCTGACCCGACGACCCAACTA (antisentido); Rat M 4 mAChR (587 bp amplificados producto): TGGGTCTTGTCCTTTGT GCTC (sentido) y TTCATTGCCTGTCTGCTT TGTTA (antisentido); Rat β-actina (764 bp amplificados producto): TTGTAACCAACTGGGACGATATGG (sentido) y GATCTT GATCT TCATGGT GCTAGG (antisentido) . Ciclismo parámetros fueron 30 minutos a 50 ° C durante la transcripción reversa seguida por 1 minuto 95 ° C de arranque en caliente seguido de 28 ciclos a 95 ° C durante 1 minuto, 62 ° C durante 1 minuto y 72 ° C durante 45 segundos y un final ciclo a 72 ° C durante 7 minutos.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Autores de las contribuciones

KTJ y ME llevó a cabo la radioligand vinculante, western blot, inmunocitoquímica, y el proyecto del manuscrito. AG llevó a cabo la RT-PCR experimentos. VM ayudó a redactar el manuscrito. DAJ concebido del estudio, participaron en su diseño y la coordinación, realizó el análisis estadístico y ayudó a redactar el manuscrito. Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

Le damos las gracias McCarty Dr Nael y el doctor Harish Radhakrishna, Georgia Institute of Technology, para la lectura crítica del manuscrito. La fuente de financiación de este estudio fue de los Institutos Nacionales de Salud Subvenciones NINDS NS044164, U54-NS 34194, NCRR P20 RR15583, y NCRR P20 RR17670.