Bioinorganic Chemistry and Applications, 2006; 2006: (más artículos en esta revista)

Conjuga de Phthalocyanines Con oligonucleótidos como Reactivos para sensibilizados o Modificación del ADN Catalítico

Hindawi Publishing Corporation
Alexander A. Chernonosov [1, 2, 3], Vladimir V. Koval [1, 2], Dmitrii G. Knorre [1, 2], Alexander A. Chernenko [4], Valentina M. Derkacheva [5], Eugenii A . Lukyanets [5], Olga Fedorova S. [1, 2]

Este es un artículo de acceso abierto distribuido bajo la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original esté debidamente citados.

Resumen

Varios de metallophthalocyanines conjugados con deoxyribooligonucleotides fueron sintetizados para investigar secuencia específica de modificación de ADN de ellos. Oligonucleotide partes de estos conjugados fueron responsables por el reconocimiento de una selección de secuencias complementarias de ADN en la meta. Metallophthalocyanines fueron capaces de inducir la modificación del ADN: phthalocyanines de Zn (II) y Al (III) se activa como fotosensibilizadores en la generación de oxígeno singlete 1 O 2 , Mientras que phthalocyanine de Co (II), promovida por la oxidación del ADN molecular de oxígeno a través de la catálisis de formación de especies reactivas del oxígeno ( . O 2 -, H 2 O 2, OH ). La irradiación de la mezcla de reacción que contenga cualquiera de Zn (II) - o de Al (III)-tetracarboxyphthalocyanine conjugados de oligonucleótidos pd (TCTTCCCA) con luz de> 340 nm de longitud de onda (o lámpara de Hg Él / Ne laser) se debieron a la modificación de los 22 - nucleótidos objetivo d (TGAATGGGAAGAGGGTCAGGTT). Un conjugado de Co (II)-tetracarboxyphthalocyanine con el oligonucleótido se encontró a modificar el objetivo de ADN en presencia de O 2 y 2-mercaptoetanol o en presencia de H 2 O 2. En ambos sensibilizado y catalizó las condiciones, los nucleótidos G 13-G 15 fueron principalmente modificados, proporcionando pruebas de que la reacción procedió a la doble hundidos ADN de interés. Estos resultados sugieren la posible utilización de phthalocyanine-oligonucleótidos conjugados como nuevos artificial reguladores de la expresión génica y los agentes terapéuticos para el tratamiento del cáncer.

INTRODUCCIÓN

Diseño de secuencias específicas de ADN o ARN-la modificación de los reactivos requiere la conjugación de reconocimiento y grupos reactivos en una sola molécula. Los oligonucleótidos, que son fragmentos de un solo hundidos ARN o ADN, poseen una capacidad inherente a Anneal a las respectivas secuencias complementarias de los ácidos nucleicos en las células. Esta interacción resultados concretos en la formación de doble hundidos complejos y proporciona un mecanismo de reconocimiento necesario para copiar y corregir el material genético. Debido a su singular capacidad de orientación, oligonucleótidos son de particular interés en la quimioterapia. Ellos pueden servir como etiquetas específicas de ácido nucleico-nocivos para la droga. En sí misma, inespecífico compuestos químicos pueden convertirse en armas cuando se precisa, junto a oligonucleótidos. La reacción derivados de oligonucleótidos representan una amplia clase de reactivos específicos propuestos para la regulación de la expresión génica (para una revisión, ver [1]]. Este enfoque, apoyándose en secuencias específicas de la orientación de los compuestos reactivos, fue inicialmente llamado "complementarias dirigidas modificación de los ácidos nucleicos" [2]. En su aplicación inicial, es adecuado para la modificación de un solo hundidos polinucleótido cadenas. Más tarde, el enfoque se amplió para incluir nonreactive oligonucleótidos y sus análogos sintéticos, que forman la base de la "antisentido" tecnología (revisado en [3]]. También se indica que el mismo método puede ser utilizado para determinados doble hundidos ácidos nucleicos en condiciones de formarse un triple hundidos complejos ( "antígeno") [4 - 6]. Actualmente, la metodología se considera de aplicación universal para reprimir el desarrollo de infecciones virales, así como los tumores inducidos por mutaciones en protooncogenes responsable de la transformación de células malignas.

Varios grupos químicos fueron estudiados como reactivo en fracciones de oligonucleótidos conjugados [1]. Phthalocyanines tienen una serie de propiedades químicas hacerlas efectivas reactivos para la modificación de ácidos nucleicos. Ellos pueden actuar como fotosensibilizadores buena, la promoción de oxígeno molecular singlete formación, de manera eficaz y catalizar la oxidación de moléculas orgánicas de oxígeno molecular en la oscuridad. La presencia de salvar los átomos de nitrógeno en los resultados de estos compuestos en la absorción eficiente a 600-700 nm, lo que les hace sensibles a la luz de esta longitud de onda, que pueden penetrar profundamente en los tejidos vivos [7]. Esta propiedad de phthalocyanines se utiliza en terapia fotodinámica (PDT) de cáncer [8]. Oxígeno molecular singlete 1 O 2 se activa hacia los diferentes componentes celulares (ácidos nucleicos, proteínas, lípidos) [9].

Por otra parte, phthalocyanine con algunos complejos de metales paramagnéticos iones son capaces de catalizar la formación de especies reactivas del oxígeno (ROS), como el radical superóxido, peróxido de hidrógeno, radicales hidroxilo y de reducción a través de mecanismo de oxidación. Estas especies diferentes biomoléculas daños [10]. El complejo de phthalocyanine con Co (II) es conocido por ser uno de los más eficaces catalizadores en la oxidación de sustratos diferentes con el oxígeno molecular y peróxido de hidrógeno [11].

El principal objetivo del presente trabajo es hacer frente a la posibilidad de la modificación del ADN de phthalocyanines de Al (III) y Zn (II) como sensibilizadores y Co (II)-phthalocyanine como un catalizador grupo conjugado con oligonucleótidos. Las estructuras de metallophthalocyanine conjugados se presentan en la Figura 1.

Los métodos experimentales
Y productos químicos reactivos

La acrilamida, N, N'-metileno-bisacrylamide, urea, acetonitrilo, DMF (Fluka, Suiza), 1,3-diaminopropane (Merck, Alemania), Tris-HCl, y 2-mercaptoetanol (Sigma, EE.UU.) fueron utilizados. Todas las soluciones tampón se prepararon con agua bidestilada ultrapura utilizando reactivos. E coli 8-oxoguanine-DNA glycosylase fue un acto de cortesía del Dr AA Ishchenko, (ICBFM, Novosibirsk, Rusia). Todos los phthalocyanines investigados figuran cuatro grupos carboxilo, que se utilizaron para la conjugación con grupos amino de los enlaces adjunto a la terminal 5'-fosfato de la octanucleotide (8-nt).

Los oligonucleótidos conjugados y

El 8-nt y 22-nt desoxirribonucleótidos 5'-pdTCTTCCCA-3 'y 5'-dTGAATGGGAAGAGGGTCAGGTT-3' (Figura 2] fueron sintetizados en un ASM-700 automatizado sintetizador (BIOSSET Ltd, Novosibirsk, Rusia) de phosphoramidites adquiridos de Glen Investigaciones (Sterling, VA, EE.UU.), según el protocolo del fabricante. Los oligonucleótidos fueron deprotected con hidróxido de amonio y purificado por HPLC de intercambio iónico en una Nucleosil 100-10 N (CH 3) 2 columna seguidos por invertir-HPLC en fase en un Nucleosil 100-7 C 18 columna (4,6 × 250 mm, adquiridos a MACHEREY-Nagel, Düren, Alemania). La pureza de oligonucleótidos superó el 98%, estimado por electroforesis en un 20% en gel de poliacrilamida desnaturalización después de la tinción con Manchas-Todos los tintes (Sigma-Aldrich, St Louis, Mo, EE.UU.). Las concentraciones de oligonucleótidos se determina a partir de su absorbancia a 260 nm [12]. El 22-nt oligonucleótido fue utilizado como un objetivo de ADN, el 8-nt oligonucleótido fue utilizado para la síntesis de conjugados con phthalocyanines.

Los oligonucleótidos conjugados con phthalocyanine complejos de Al (III), Zn (II), y Co (II) fueron sintetizados mediante una se informó anteriormente fase sólida método [13] con un 30-40% el rendimiento. Los conjugados fueron aisladas de la mezcla de reacción y se purifica por HPLC en acetonitrilo / agua gradiente. Reverse-HPLC en fase perfiles con diferentes tiempos de retención para la libre y oligonucleótidos para la phthalocyanine-oligonucleótidos conjugados siempre una fuerte prueba de que la fracción phthalocyanine covalentemente se adjunta a la oligonucleótido [13].

5'-terminal de fosforilación

El 22-nt oligonucleótido fue marcado con 32 P en el 5'-end en un 30 μ l de mezcla de reacción que contiene 30 pmol de los oligonucleótidos, 30 pmol de - 32 P] ATP (actividad específica 3,3 × 10 -3 mCi / pmol), y 10-20 unidades de T4 polinucleótido quinasa (Sibenzyme, Rusia) en una solución tampón que contiene 0,05 M de cloruro de imidazolium (pH 6.6), 0,01 M MgCl 2, 5 mM dithiothreitol, 0,1 mM espermidina, 0,5 mM ADP, y 0,1 mm EDTA. La mezcla se incubó a 37 ° C durante 30 minutos. El producto fue precipitada por la adición de 10 volúmenes de 2% LiClO 4 en acetona, y más purificado por electroforesis en la desnaturalización del 20% en gel de poliacrilamida (PAGE). El oligonucleótido fue en un electroeluted DE-81 filtro (Whatman, Brentford, Reino Unido), despojado de la filtro con 3 M LiClO 4 a 56 ° C, y precipitó con un 2% de LiClO 4 en acetona. El precipitado se lava con acetona (3 × 200 μ l), secado en vacío, y se disuelven en agua bidestilada (100 μ l). La concentración de la solución resultante de la etiqueta de oligonucleótidos no exceda de 2,5 × 10 -7 M.

Modificación

Todos los modificación se llevó a cabo en una solución tampón que contiene NaCl 0,16 M, 0,02 M de fosfato de sodio (pH 7.4), y 1 mM EDTA.

Catalítico modificación

Modificación oxidativa de los 22-nt oligonucleótido con la complementaria con un oligonucleótido Co (II)-phthalocyanine fracción se realizó a 25 ° C en dos maneras: (1) en presencia de H 2 O 2 y (2) en presencia de O 2 y 2-mercaptoetanol como agente reductor. La concentración de la meta en la reacción de las mezclas fue 10 -8 M, la concentración del conjugado fue 8,22 × 10 -5 M, y las concentraciones de H 2 O 2 y 2-mercaptoetanol fueron 2,0 × 10 -4 M. La concentración de O 2 en solución acuosa a 25 ° C a presión atmosférica es de 2,0 × 10 -4 M. El volumen de muestra fue de 10 μ l; el tiempo de incubación fue de 24 horas.

La identificación y separación de modificación productos

Para cleave los oligonucleótidos modificados en los puntos de modificación que se hace lábil al tratamiento alcalino (apurinic / apyrimidinic lugares oxidados y desoxirribosa), los precipitados fueron disueltos en 50 μ l de Piperidina 1 M (pH 12) y se incubaron durante 45 minutos a 95 ° C [15]. Los productos se precipitó y lavados dos veces con etanol al 95%, una vez con acetona y, a continuación, seca en el vacío.

Para digerir el producto oxidado en Desoxiguanosina residuos, incluidas 8-oxoguanine, que es relativamente estable en álcali, las muestras fueron tratadas con 8-oxoguanine-DNA glycosylase de E coli (FPG proteína). Antes de este tratamiento, las muestras fueron lavadas dos veces con etanol 85% y una vez con acetona para eliminar el búfer, y se seca en vacío. Los precipitados se disuelve en 20 μ l de una solución tampón que contiene 50 mM Tris-HCl (pH 7.5), 50 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, el 9% de glicerol, y el 6,6 × 10 -6 M FPG. Después de la reacción, la enzima se extrajeron dos veces por la mezcla de fenol-cloroformo-isoamyl alcohol (25: 25: 1 v / v / v). La reacción de las mezclas se precipitó con 10 volúmenes de 2% LiClO 4 en acetona, se centrifuga, se lava dos veces con etanol al 95%, secos, y se disuelven en un marcador tintes solución que contenga 0,1% Azul de bromofenol y 0,1% de xileno cyanol FF.

Los productos de modificación fueron separados en un 20% en la presencia de 7 M urea. Después de la electroforesis, el gel fue expuesto a la CP-BU X-ray film (Agfa-Gevaert, Mortsel, Bélgica) para 10-20 horas a -10 ° C.

RESULTADOS

Los conjugados de deoxyribooligonucleotides con phthalocyanines de Al (III) y Zn (II), I-IV fueron estudiados como los reactivos para la modificación fotoquímica de los ácidos nucleicos (Figura 1]. Los oligonucleótidos fueron conectados a la phthalocyanine fracciones a través de enlaces con diferentes números de-CH 2 grupos: tres en conjugados I y III y las seis de conjugados II y IV. Conjugado V que contiene Co (II) phthalocyanine-fue utilizado como reactivo para la modificación de catalizador en presencia de oxígeno molecular (Figura 1]. El enlazador en este conjugado se compone de tres-CH 2 grupos. A 22-nt oligonucleótido sirvió de ADN objetivo. La estructura del dúplex formado complementarias entre el ADN y el objetivo conjugados se presenta en la Figura 2.

UV / visible del espectro libre phthalocyanines y conjugados

La conjugación de phthalocyanines con oligonucleótidos fue confirmada por el cambio en la forma del espectro a 600-700 nm en comparación con el espectro de absorción de libre phthalocyanine. Por libre Co (II)-phthalocyanine, una banda de absorción se observó a 678 nm, con un hombro alrededor de 630 nm. En el caso de los oligonucleótidos conjugado V, una banda a 631 nm con un hombro a 680 nm se detectó [16]. Por libre Al (III)-phthalocyanine, la única banda de absorción en la región visible, se observó a 678 nm, pero para su oligonucleótidos conjugados III y IV, dos bandas se encontraron a 639 nm y 678 nm (ver figura 3]. El espectro de la libertad de Zn (II)-phthalocyanine contenía una banda a 643 nm con un hombro a 680-700 nm (Figura 4]. Esta banda era más amplio que el de Co (II) y Al (III). La unión de Zn (II)-phthalocyanine con oligonucleótidos I y II provoca la aparición de una segunda banda a 688 nm. Todos los conjugados demostrar la absorción de cerca de 260 nm, muy probablemente debido a la contribución de la parte de oligonucleótidos.

Sensibilizó a modificar en relación con la lámpara de Hg de irradiación (λ; = 365 nm)

Modificación del 22-nt oligonucleótido se llevó a cabo en los 5 ° C. Cuando los productos de reacción fueron analizados por electroforesis en un 20% PAAG, no directa división de la meta se observó. Se sabe que la oxidación del ADN puede dar lugar a la aparición de álcali-lábiles sitios [17]. Estas modificaciones son detectadas por el tratamiento de la mezcla de reacción con 1 M Piperidina (pH 12) [15]. Sin embargo, otras modificaciones, que son estables en álcali, también se encuentra, por ejemplo, 8-oxoguanine. Para detectar esta modificación, las mezclas de reacción fueron tratados con proteínas FPG, una enzima de reparación de E coli que cleaves ADN a los residuos oxidados guanina a C8, así como en algunos otros derivados oxidados guanosina [18].

La reacción de los rendimientos objetivo la modificación de Zn (II)-phthalocyanine conjugados I y II que contiene aminopropanol y aminohexanol enlaces fueron 18% y 14%, respectivamente, detectados por Piperidina tratamiento (Figura 5]. El tratamiento con FPG reveló que sólo el 8% y 6% para la modificación del rendimiento conjuga I y II, respectivamente (Figura 5]. Una comparación de división cursos a tiempo demuestra que la modificación del rendimiento en el caso de conjugar I es algo superior a la de conjugar II. Esto puede explicarse por un aumento en la probabilidad de consumo de las especies de oxígeno activo en los procesos de solución debido a un largo spacer de conjugar II. Cuanto más tiempo spacer de conjugar II mueve el phthalocyanine fracción más lejos de la meta de oligonucleótidos en comparación con el conjugado I, que dio lugar a un aumento de la contribución de los procesos con el disolvente.

El objetivo de la modificación tanto de Zn (II)-phthalocyanine conjugados I y II se llevó a cabo preferentemente en guanina residuos en la región G 11-G 20. Residuos G 13 y G 15 fueron modificados, principalmente, como puede verse en un histograma presentado en la Figura 6 para conjugar I. El autoradiogram de un gel correspondiente al tiempo de supuesto objetivo de la modificación conjugado I reveló el tratamiento de FPG se presenta en la Figura 7. Los mismos datos fueron obtenidos para conjugar II.

En el caso de Al (III)-phthalocyanine que contiene el conjugado III (datos no se muestran), la modificación del rendimiento se acercó al 12% como detectado por Piperidina tratamiento, y se aproximó al 5% cuando FPG proteína se utilizó para revelar la modificación de puntos. Los experimentos con el Al (III)-que contiene el conjugado IV se debieron también a una modificación bastante bajo rendimiento del 5-7% como puesto de manifiesto por ambas Piperidina y FPG proteína tratamientos (datos no presentados).

Sensibilizó a la modificación de helio-neón irradiación láser (λ; = 633 nm)

La reacción de las mezclas que contengan la phthalocyanine Zn (II) y Al (III) conjuga los II y IV, respectivamente, también fueron irradiados por una de helio-neón láser en una longitud de onda 633 nm durante 30 minutos a 25 ° C. En contraste con los experimentos con una lámpara de Hg, no división de oligonucleótido objetivo en ausencia de estos reactivos se observó biopolímeros porque no absorben la luz roja en el rango visible del espectro. La luz láser es mucho más intensa que la luz lámpara de Hg, como puede verse en una disminución significativa en el tiempo requerido de irradiación. Los experimentos han demostrado (Figura 8] que la modificación de rendimiento detectados por Piperidina tratamiento fue mayor para Zn (II) phthalocyanine-en comparación con Al (III)-phthalocyanine y fue de 24% y 10%, respectivamente.

Distribución de modificación de los sitios phthalocyanine Al (III) IV y Zn (II) phthalocyanine-II se conjuga bastante similar (Figura 8]. Además de G 13-G 15, notable división se lleva a cabo en 6 G, G 7, y 8 bandas G. Una comparación con los datos obtenidos con una lámpara de Hg radiación a 5 ° C sugiere que esa diferencia puede deberse a la mayor flexibilidad de la fracción phthalocyanine y la mayor movilidad de las especies oxidantes a temperatura más alta.

Catalítico modificación

El término "catálisis" que se utiliza aquí se aplica al mecanismo de especies de oxígeno activo generación, donde un metal-phthalocyanine fracción actúa como catalizador. El ácido nucleico es oxidado por el peróxido de hidrógeno, y metal-phthalocyanine cataliza este proceso reversible a través de cambios en su estado de oxidación.

Modificación del ADN en los complejos con el Co (II)-phthalocyanine conjugado V se realizaron a 25 ° C con H 2 O 2 y con O 2 en presencia de 2-mercaptoetanol como la reducción de compuestos. La página de separación de los productos de reacción no ha mostrado ninguna división directa de la meta. Las modificaciones sólo se detectaron después del tratamiento de la mezcla de reacción, ya sea con 1 o M Piperidina con FPG.

La modificación de rendimiento en presencia de O 2 y 2-mercaptoetanol después del 1 de M Piperidina tratamiento resultó ser un 15%, y en presencia de H 2 O 2 es aproximadamente 35%. La modificación más alto rendimiento se logró en aproximadamente 20 horas. La modificación determinada por los rendimientos FPG proteína tratamiento fueron significativamente más elevados, el 70% de la mezcla de reacción que contiene peróxido de hidrógeno y aproximadamente un 25% para la mezcla de reacción que contiene O 2 y 2-mercaptoetanol.

El objetivo modificaciones fueron localizados principalmente en el G 13-G 15 secuencia, similar a la situación que se observa con el Al (III) - y Zn (II)-phthalocyanine conjugados. La distribución de las modificaciones fue similar para los sistemas que contienen O 2 / 2-mercaptoetanol y el peróxido de hidrógeno (Figura 9]. Sin embargo, la profundidad de la modificación en el caso de peróxido de hidrógeno fue superior en particular. Esto no es inesperado para una sustitución del sistema "O 2 + reducción de reactivo" con H 2 O 2, que es una fuente directa de los radicales hidroxilo. Detección de puntos de modificación de proteínas FPG tratamiento revela un mayor rendimiento de modificación que hace Piperidina tratamiento, muy probablemente debido a una modificación preferencial a los C8 posición de guanina.

DISCUSIÓN

En el presente trabajo, nos muestran que tetracarboxyphthalocyanines de Al (III), Zn (II), y Co (II) modificar los ácidos nucleicos, cuando se entregaron a los objetivos de ADN por medio de un oligonucleótido complementario etiqueta, y que la modificación puede ser iniciado ya sea por irradiación o en el catalizador de reacciones redox en bicicleta. Nuestros experimentos indican que la división no se produce directamente en el modelo de oligonucleótidos. Phthalocyanines presuntamente incurrir en daños a diferentes fracciones de ADN en función de si photosensitization o catálisis redox se lleva a cabo. Apurinic / apyrimidinic sitios y desoxirribosa oxidación fueron revelados bajo condiciones alcalinas, y oxidado, como bases de nucleótidos de 8 oxoguanosine, de tratamiento de las muestras con la proteína FPG. Se encontró que en presencia de la Co (II)-phthalocyanine conjugada, los productos de los catalizadores de modificación en el ADN meta son principalmente sustratos para FPG proteínas, pero están mal puesto de manifiesto por Piperidina. Cuando la alta presión lámpara de Hg (365 nm de longitud de onda) o irradiación láser (633 nm) se utilizaron, la capa sensible modificación productos fueron mejores de Piperidina reveló que el tratamiento de FPG proteína. Los niveles relativamente bajos de photomodification puede explicarse por la gran migración a distancia (~ 90 nm) de oxígeno molecular singlete 1 O 2 a lo largo de la cadena de polinucleótido en comparación con los 0,34 nm distancia entre las bases del ADN [19] o modificados formación de bases de estructura diferente , No reveló la detección de los métodos utilizados.

Sin embargo, nuestros resultados demuestran claramente que la modificación de los ácidos nucleicos se produce cuando el objetivo y metallophthalocyanine grupo se dibujan juntos. Resultados similares a sensibilizarse photomodification de los ácidos nucleicos se obtuvieron antes conjugados con otros que contengan grupos reactivos, incluidas las porfirinas y sus análogos, como Pd (II)-coproporfirina I [20], cloro [21], sapphyrin, y Dy (III) texaphyrin [22]. El uso de oligonucleótidos etiquetas, es posible orientar el reactivo necesario para la secuencia de ácidos nucleicos, por lo tanto, mejorar la selectividad del proceso. Nuestros resultados muestran que la generación de corto viven especies de oxígeno en el caso de modificación de catalizador en presencia de la Co (II)-phthalocyanine reactivo en los resultados suficientemente eficaces y específicos de secuencia modificación de los ácidos nucleicos. La reactividad de estos reactivos para el ADN o ARN de los organismos extranjeros o las células tumorales malignas se plantea la posibilidad de bloquear la expresión de genes específicos y el uso de phthalocyanine conjuga como las drogas.

Los autores agradecen al Dr Dmitri Pyshnyi por su ayuda en la síntesis de oligonucleótidos. Esta investigación fue posible en parte por donaciones de RFBR (04-04-48171, 05-04-48447, 06-04-49263), Presidium de la Academia Rusa de Ciencias (MCB Programa, 10.5), el Ministerio ruso de Educación y Ciencia (02.434.11.7064, NS-4526.2006.4), CRDF (Y1-B-08-16). Alexander A. Chernonosov es un destinatario de la Lavrentyev la Fraternidad de la División de Siberia de la Academia Rusa de Ciencias. Vladimir V. Koval fue apoyado por becas postdoctorales de INTAS (04-83-3849).