Neural Development, 2007; 2: 1-1 (más artículos en esta revista)

Reglamento de husillo y orientación de células madre neuronales suerte en el lóbulo óptico Drosophila

BioMed Central
Boris Egger (b.egger @ gurdon.cam.ac.uk) [1], Jason Q Boone (boone@uoneuro.uoregon.edu) [2], Naomi Stevens R (n.stevens @ gurdon.cam.ac.uk ) [1], Andrea H Brand (ahb@mole.bio.cam.ac.uk) [1], Chris Q Doe (cdoe@uoneuro.uoregon.edu) [2]
[1] El Wellcome Trust / Cancer Research UK Gurdon Institute y el Departamento de Fisiología, Desarrollo y Neurociencia de la Universidad de Cambridge, Tennis Court Road, Cambridge CB2 1QN, Reino Unido
[2] Instituto de Biología Molecular, Instituto de Neurociencias, Howard Hughes Medical Institute, University of Oregon, Eugene, OR 97403, EE.UU.

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

La elección de una célula madre a dividir simétrica o asimétrica tiene profundas consecuencias para el desarrollo y la enfermedad. No reglamentada división simétrica promueve la formación de tumor, mientras que la división asimétrica inadecuado afecta la morfogénesis de órganos. A pesar de su importancia, poco se sabe sobre la forma en huso posicionamiento está regulada. En algunos tejidos de células suerte parece dictar el tipo de división celular, mientras que en otros tejidos se piensa que estocásticos variación en la posición del husillo posterior dictados hermano de células suerte.

Resultados

En este sentido, investigar la relación entre identidad progenitoras neurales y husillo de posición en el lóbulo óptico Drosophila. Usamos marcadores moleculares y en directo de imágenes para demostrar que hay dos poblaciones de los progenitores en el lóbulo óptico: dividiendo simétricamente neuroepitelial células y asimétrica división neuroblasts. Usamos marcado genéticamente única célula clones para demostrar que las células neuroepitelial dar lugar a neuroblasts. Para determinar si un cambio en la orientación del husillo puede desencadenar un neuroepitelial transición a neuroblast, la fuerza neuroepitelial células de dividir a lo largo de su apical y basal del eje de misexpressing Inscuteable. Nos parece que esto no inducir neuroblasts, ni promover la diferenciación neuronal prematura.

Conclusión

Se demuestra que la división simétrica neuroepitelial células dar lugar a la división asimétrica neuroblasts en el lóbulo óptico, y que la regulación de huso orientación y la división simetría es una consecuencia del tipo de células especificación, en lugar de un mecanismo para la generación de diversidad tipo de células.

Fondo

La división modos de las células madre están estrechamente regulado durante el desarrollo y la homeostasis de tejidos adultos. De esta forma se garantiza que los tejidos y órganos y sistemas para desarrollar el tamaño correcto y contener la correcta tipos de células para su buen funcionamiento. Una forma de ampliar el grupo de tallo o células progenitoras durante el desarrollo es simétrica a someterse a la división celular. Por el contrario, una forma de generar la diferenciación de tipos de células, al tiempo que se mantiene una constante tallo / progenitoras población, es asimétrica a someterse a la división celular en caso de que una hija diferencia y el otro sigue siendo una célula madre [1]. Recientemente, se ha sugerido que la proporción de tallo / células progenitoras para la diferenciación de células en un tejido puede ser regulada por el cambio de orientación de husillo, con lo que la alteración de la proporción simétrica a asimétrica divisiones celulares. Por ejemplo, se ha propuesto que las células de mamíferos neuroepitelial primero ampliar a través de divisiones simétricas, seguido por una ráfaga de producción de neuronas como consecuencia de las divisiones asimétrica [2]. Recientemente, se ha informado de que la modificación de la división en el eje vertebrados diferentes tipos de células puede conducir a un cambio de destino, por ejemplo, en mamíferos células basales de la epidermis, las células progenitoras neurales en el neocórtex y el desarrollo de progenitores en la retina en desarrollo [3 -- 5]. A pesar de los recientes avances en la comprensión de células madre de auto-renovación y la orientación del husillo en ambos mamíferos y Drosophila sistemas [6], sin embargo, se sabe muy poco sobre la relación entre la orientación y el husillo tipo de células pliego de condiciones. ¿Estocástico cambios en la orientación del husillo generar diversidad de células durante el desarrollo normal, o husillo orientación siempre responden a las especificaciones tipo de células?

En Drosophila, el sistema nervioso central se obtiene a partir de células madre neuronales llamados neuroblasts. Hay por lo menos tres tipos de neuroblasts: embrionarias, central del cerebro de larvas / torácica, y de larvas del lóbulo óptico. Todos ellos se someten a la división celular asimétrica, auto-renovación del neuroblast, mientras que la producción de una hija de diferenciación de células (células ganglionares de la madre; GMC). Neuroblasts delaminate embrionarias como células individuales de un epitelio polarizado llamado ventral neuroectoderm. Considerando que las células neuroectodérmico división simétrica horizontal con un huso mitótico (en el plano de la neuroectoderm), neuroblasts girar sus cabezas a un plano vertical (perpendicular a la neuroectoderm) y se dividen asimétricamente para generar un gran apical neuroblast, así como una menor basal GMC. El GMC normalmente genera dos post-mitótico neuronas. Neuroblast divisiones embrionarias son molecularmente y físicamente asimétrica: la neuroblast hereda apical proteínas (por ejemplo, atípicos proteína quinasa C (aPKC) y Inscuteable (Insc)) y el GMC hereda basal proteínas (por ejemplo, Miranda (Mira), Prospero (Pros) , Numb, y Socio de Numb (PON)) [7]. Central del cerebro de larvas / torácica neuroblasts se derivan de embriones neuroblasts y someterse a la misma división celular asimétrica a lo largo de su apical y basal del eje de polaridad. Se ha avanzado en la comprensión de las moléculas que participan en la auto-renovación de la capacidad de las larvas neuroblasts cerebro central, y de cómo misregulation de estos factores pueden conducir a la formación de tumor [8 - 12]. Sin embargo, poco se sabe acerca de las divisiones simétricas en el sistema nervioso y lo que el interruptor molecular que se lleva a la división asimétrica.

En contraste con embriones y larvas neuroblasts central neuroblasts cerebro, la tercera clase de neuroblasts, los residentes en el lóbulo óptico, ha sido tan bien caracterizados. El lóbulo óptico se deriva de una óptica de embriones placode que invaginates en el embrión [13]. La óptica del lóbulo células empiezan a proliferar poco después de la eclosión de larvas y por separado en un centro de proliferación exterior (OPC) y un centro interior de la proliferación (IPC). La OPC exterior genera la médula y la lámina de neuronas, el IPC genera la médula interior, la lobula y lobula la placa de neuronas [14]. Se ha informado de que las primeras células del lóbulo óptico neuroblasts que se dividen simétricamente a ampliar la población y, posteriormente, cambiar a la división asimétrica para producir las neuronas del sistema visual [15, 16]. Una hipótesis alternativa sugiere que las primeras células del lóbulo óptico comprenden una división simétrica epiteliales hoja que luego genera la división asimétrica neuroblasts por un mecanismo desconocido [17 - 19]. Sin embargo, el linaje relación entre tipos de células del lóbulo óptico nunca ha sido determinado directamente, y es formalmente posible que los primeros dividiendo simétricamente las células epiteliales y, posteriormente, dividiendo el desarrollo de forma asimétrica neuroblasts son dos piscinas de células que no contribuyen a unos de otros.

En este sentido, recientemente el uso de marcadores moleculares disponibles, los métodos de imágenes en vivo, linaje genético y técnicas para investigar la relación entre la división simétrica principios de los progenitores y asimétrica división neuroblasts del lóbulo óptico. Probamos si los cambios en la orientación del husillo son suficientes para inducir la diferenciación neuronal, como se ha deducido de la retina de mamíferos [5]. Nos encontramos con que óptica lóbulo neuroblasts se derivan de la lateral del lóbulo óptico neuroepithelium; que hay una transición de la simétrica a asimétrica de células madre similares a las divisiones entre estas dos poblaciones progenitoras, y que la inducción de husillo vertical de orientación en neuroepitelial células no es suficiente para generar ectópico neuroblasts o las neuronas. Por lo tanto, la orientación del husillo no determina el destino celular, pero sí es regulada en respuesta al pliego tipo de células.

Resultados
Morfogénesis del lóbulo óptico

Hemos examinado una colección de GAL4 potenciador trampa líneas para identificar marcadores de óptica lóbulo tipos de células. La expresión de una línea, GAL4 c855a [20, 21], se limita a la óptica lóbulos (Figura 1]. Hemos usado esta línea de conducción de expresión UAS-socio de adormecer-gfp (pon-GFP) [22] y seguido del lóbulo óptico morfogénesis en todo el desarrollo larval (Figura 1]. Frontal confocal secciones del cerebro muestran que, a mediados tercera estadio, el desarrollo de la OPC lóbulo óptico forma una cúpula en forma de concha que cubre el lateral del lóbulo cerebral con una abertura de poro en su centro, mientras que el IPC es en forma de U con la apertura de la U apuntando en el dorso-caudal dirección (Figura 1a, b] [18]. Esta estructura surge de un pequeño grupo de 30 a 40 células progenitoras a las larvas recién eclosionados [18]; de 24 horas después de la eclosión de larvas (ALH) de la OPC y el IPC se pueden distinguir (Figura 1c] y la población cada vez mayor de formas epiteliales hoja en todo el desarrollo larval (Figura 1d-f]. En el segundo estadio larvario etapa, una población de células en el borde medial de la OPC epitelio aparece a redondear al alza, pierde la morfología del epitelio, y hacia abajo-regula GAL4 c855a. Estas probablemente sean las anteriormente descritas OPC neuroblasts [18, 19].

El lóbulo óptico se compone de dos diferentes tipos de células

Estudios anteriores han señalado a diferentes conclusiones acerca de los tipos de células del lóbulo óptico. Algunos informes sugieren que los primeros lóbulo óptico consta inicialmente de forma simétrica dividiendo neuroblasts que, en etapas posteriores, se divide asimétricamente neuroblasts [15, 16]. Por el contrario, otros informes concluyen que los primeros lóbulo óptico consta de células epiteliales y sólo después hacer neuroblasts desarrollar en los bordes medial del epitelio [18, 19]. En este último estudio se ha supuesto que la óptica del lóbulo neuroblasts se derivan de la óptica del lóbulo epitelio, pero esto nunca ha sido probado directamente de estudios de linaje. En esta sección y la siguiente, se discute la utilización de marcadores moleculares, experimentos en vivo de imágenes, y el linaje genético de células de análisis para resolver la identidad y los orígenes de estos óptica lóbulo tipos de células.

En primer lugar, si la prueba óptica del lóbulo contiene células epiteliales de tinción para epiteliales junctional marcador proteínas. PatJ es un andamio de proteínas citoplasmáticas y es parte de las conservadas Crumbs complejo, que se encuentra en apical y subapical regiones en las células epiteliales. DE-cadherina (DE-cad) es una proteína transmembrana situado en la zonula adherens, mientras que los discos grandes (DLG) y garabatos (Scrib) son de dominio PDZ tumor supresor de proteínas que se enriquecen a la basolateral septadas cruces [23]. Hemos encontrado que una subpoblación de las células del lóbulo óptico, aquellos que expresan GAL4 c855a y la morfología del epitelio (Figura 1], expresar todas estas junctional marcadores, y que localizar a sus dominios adecuados celular (Figura 2a]. De este modo, la óptica del lóbulo contiene una población de células epiteliales que se expande durante las primeras etapas larvales y pasa a ser agotado por pupariation (Figura 1].

Para determinar si estas células epiteliales han neuroepitelial características, ensayados para la expresión de la proneural genes achaete (ac) y escudo (sc). Ac y sc se expresan en grupos de células en otros epitelios (por ejemplo, ventral ectodermo embrionario y imaginal discos), donde promover la neurogénesis. Delta-Notch señalización antagoniza proneural expresión, por lo que sólo en una o varias células de la agrupación en desarrollo como neuroblast (embrión), o la idea de órgano precursor (disco imaginal), mientras que las restantes células epidérmicas adoptar un destino [24, 25]. Se encontró que todas las celdas de la OPC expresar el gen proneural escudo (Figura 2b; adicional archivo de datos 1], pero no se observó expresión de la proneural genes achaete (datos no presentados). Por lo tanto, el lóbulo óptico es un epitelio neuroepithelium y todas las células epiteliales en la hoja parece que tienen el potencial para entrar en la vía neural.

A continuación analizaron neuroblast marcadores, para determinar si las células neuroepitelial son en realidad neuroblasts simétrica en las divisiones para ampliar la neuroblast población [15, 16]. Estamos manchados de Deadpan (Dpn) y Mira, que etiqueta todos los embriones y larvas cerebro central neuroblasts [9 - 11, 26, 27] y encontró que estos marcadores no a la etiqueta neuroepitelial células del lóbulo óptico (figura 2b-e] . Sin embargo, la etiqueta con una población de células redondeadas en el borde del epitelio, que carecen de DLG / Scrib septadas cruce localización (figura 2b-d] y se coloca en el lugar de los descritos anteriormente óptica lóbulo neuroblasts [18, 19] . Este neuroblast población está estrechamente relacionada con las cadenas de pequeñas células que expresan el GMC marcadores nucleares Pros y nuclear Asense (ASE) (figura 2c, d]. Linaje de análisis, se describe a continuación, confirma que estos pequeños Pros + son células neuroblast progenie. Por lo tanto, sobre la base de marcadores moleculares y la morfología, hemos detectado dos poblaciones de células en el desarrollo del lóbulo óptico: neuroepitelial células y neuroblasts. No se encontraron pruebas de una población de neuroblasts dividiendo simétricamente en el lóbulo óptico.

Óptica de las células del lóbulo neuroepitelial división simétrica, mientras que dividen asimétricamente neuroblasts

Para poner a prueba nuestra conclusión de que las células neuroepitelial división simétrica y asimétrica división neuroblasts, que evaluó la localización cortical polaridad de las proteínas en el lóbulo óptico de inmunohistoquímica y en directo de imágenes. Insc y aPKC localizar a la apical de corteza de embriones y larvas neuroblasts [28 - 30], mientras que Mira, Pros y Pon-GFP, basales están localizados en algunas células epiteliales y en todos los neuroblasts [27, 31 - 34]. Se encontró que Dpn-óptica positiva lóbulo neuroblasts siempre segregar Insc (Figura 2f] y aPKC (datos no presentados) en la mayor neuroblast y Mira, Pros, Pon-y las buenas prácticas agrarias más pequeñas en el GMC (n = 37; (figuras 2d, e , 3c-e; archivos de datos adicionales 2 y 3]. En contraste, la mayoría de Dpn negativo neuroepitelial células partición Pon-GFP por igual a las dos células hijas (n = 28) (Figura 3c, e; adicional archivo de datos 4] y lo hicimos no detectar la expresión de Insc, Mira o Pros. La única excepción es una población de Dpn negativo células epiteliales que se encuentran adyacentes a la Dpn-positivas neuroblasts, que segregan Pon-GFP asimétrica. Estas células son susceptibles de ser recién formada neuroblasts con Dpn niveles por debajo de nuestro umbral de detección.

Para caracterizar mejor el neuroepitelial y neuroblast poblaciones en el lóbulo óptico, el próximo investigado su división celular en los patrones de tipo salvaje cerebros. Se utilizó el sistema MARCM [35] para inducir a los pequeños mCD8-GFP etiqueta de tipo salvaje clones a finales de segunda / tercera principios estadio larval (48 horas ALH) y se analizaron los cerebros a mediados tercer estadio (72 horas ALH) (Figura 3a] . Hemos observado pequeños clones, con dos a ocho células con morfología del epitelio columnar (n = 7) en el lateral del lóbulo óptico, en consonancia con la expansión de un progenitor a través de la división celular simétrica (Figura 3a]. También vio clones en la óptica medial del lóbulo (el neuroblasts donde se encuentran) que había uno o más grande ronda las células adyacentes a un grupo de células redondas pequeñas (n = 11), en consonancia con neuroblasts división asimétrica para generar una cadena de pequeñas GMCs / neuronas (Figura 3a]. Llegamos a la conclusión de que las células neuroepitelial dividir simétricamente para generar dos células neuroepitelial, mientras que neuroblasts división asimétrica para generar progenie más pequeños.

La combinación de nuestro moleculares, morfológicas, y en vivo de imágenes de datos nos permite concluir que hay dos tipos de células en el lóbulo óptico. Neuroepitelial células se encuentran en la región lateral y tienen una clásica morfología del epitelio columnar, epiteliales marcadores moleculares y los cruces epiteliales. Se beneficiarán de la división celular simétrica para ampliar la neural de células madre de población. Neuroblasts se encuentran en la región medial y tienen una forma redondeada y la falta epiteliales cruces. Ellos dividen asimétricamente a la libre renovar y producir una menor diferenciación de las células hija.

Óptica lóbulo neuroepitelial son las células progenitoras de óptica lóbulo neuroblasts

A continuación desea probar directamente la hipótesis de que la óptica del lóbulo epitelios dar lugar a la óptica del lóbulo neuroblasts [17 - 19]. Se realizó un análisis clonal utilizando el FLP / FRT sistema [36] y se ajustará la frecuencia clon de inducción al 1,2 por clones lóbulo óptico. Provocamos clones nucleares expresar una β-galactosidasa (β-gal) reportero de proteínas en las primeras segundo estadio (31 horas ALH), cuando el lóbulo óptico se compone principalmente de neuroepitelial células (Figura 1], y ensayadas en vías de desarrollo para los clones de células suerte en los marcadores 48 horas o 96 horas ALH. Brains fueron etiquetados para β-gal para mostrar todas las celdas dentro de un clon; Scrib para exponer la morfología de las células epiteliales y etiqueta septadas cruces, y para Dpn para marcar neuroblasts (Figura 4]. Observamos cuatro clases de clones: neuroepitelial sólo las células (Figura 4 bis); neuroblasts y su progenie neuronal sólo (Figura 4c); sólo progenie neuronal (datos no presentados); mixtos y clones de células neuroepitelial, neuroblasts y progenie (Figura 4b]. Cuando se analizaron los clones relativamente pronto después de la inducción (48 horas ALH), se observó un alto porcentaje de neuroepitelial sólo clones (22/28), con pocas neuroblast sólo clones (5 / 28) o una mezcla de clones (1 / 28). En contraste, permitiendo que los clones a más largo (96 horas ALH) dio lugar a una mayoría de los clones están neuroblast / progenie solamente (20/33) o sólo la progenie neuronal (4 / 33), con pocas neuroepitelial sólo clones (5 / 33 ) O una mezcla de clones (4 / 33).

Un ejemplo de un clon que apoya la idea de un interruptor de una neuroepitelial a neuroblast tipo de células se muestra en la Figura 3b. Este clon, en el borde medial del epitelio, contiene cuatro células progenitoras neurales y una progenie de células, lo que sugiere que una célula neuroepitelial se sometió a dos rondas de división simétrica a generar cuatro células, una de estas células pasan a un neuroblast suerte y se dividen asimétricamente , Auto-renovación y la elaboración de un único GMC. Otro clon consistió de 20 neuroepitelial células, cuatro grandes ronda Dpn células positivas, y dos más pequeñas células redondas (datos no presentados). Interpretamos este clon como se derivan de una célula neuroepitelial que divide simétricamente a generar 24 celdas, cuatro de los cuales pasaron a una neuroblast suerte. Dos de estos neuroblasts divide asimétricamente para producir un solo GMC cada uno.

Dos conclusiones pueden extraerse de nuestro linaje experimentos. En primer lugar, las células neuroepitelial dar lugar a neuroblasts; inicialmente la mayoría de clones constituidos exclusivamente por células neuroepitelial pero con el tiempo la mayoría de clones contienen neuroblasts y su progenie. Es probable que neuroepitelial clones que ampliar hacia el borde medial del epitelio convertirse en parte o completamente transformado en neuroblasts. Esto es coherente con estudios previos y nuestras propias observaciones de que la población se encoge epiteliales como la población se expande neuroblast (Figura 1] [18, 19]. En segundo lugar, por lo menos algunos neuroblasts en última instancia, diferenciar o morir, por lo que los clones que consisten enteramente de progenie neuronal.

Inductoras de husillo vertical de orientación en neuroepitelial células no promueve neuroblast o especificación neuronal

Se ha propuesto que las células de mamíferos neuroepitelial, retina y células progenitoras de las células madre epidérmicas ampliar su población de células madre de «horizontales» en las divisiones que el huso mitótico se alinea perpendicular a la apical y basal del eje de polaridad celular. A continuación, pasar a un 'vertical' eje división asimétrica de dividir y generar nuevos tipos de células [2 - 5, 37, 38]. No se sabe si un cambio en la celda destino tiene la obligación de cambiar el eje de la división celular (por ejemplo, a una suerte de células que expresa una proteína que modifica el huso orientación), o si un cambio en el estocástico huso orientación pueden llevar a una celda destino cambio (por ejemplo, debido a la asimetría de particionamiento de los factores determinantes de células suerte). La Drosophila óptica lóbulo neuroepithelium representa un excelente sistema modelo para determinar si un cambio en la orientación del husillo induce nueva celda destino, o si un cambio en la celda destino tiene la obligación de modificar la orientación del husillo.

Para cambiar la orientación del husillo en neuroepitelial células que misexpressed Insc neuroepitelial en las células. Expresión de Insc embrionarias en células epiteliales se ha demostrado que reorientar sus ejes de mitótico horizontal (perpendicular al eje apicobasal) a vertical (alineado con el eje apicobasal) [30]. Insc misexpression embrionarias no conduce a cambios evidentes en las embrionarias neuroectoderm. Sin embargo, no todas las células neuroectodérmico dar lugar a los precursores neuronales; más dar lugar a la epidermis. En el lóbulo óptico, todas las células neuroepitelial expresar el gen proneural sc y, por consiguiente, son competentes para convertirse en neuroblasts. Por lo tanto, estamos investigando si huso reorientación puedan inducir a un neuroblast suerte en este sistema. En el control del lóbulo óptico neuroepithelia No se detectaron Insc proteínas y la mayoría de metafase ejes fueron alineados horizontalmente, en condiciones de dar una división celular simétrica (Figura 5 bis, c]. Cuando Insc es misexpressed dentro de la óptica del lóbulo neuroepithelium, localiza la proteína apically y la mayoría de metafase ejes orienta verticalmente, a lo largo del eje apicobasal, en condiciones de permitir una división celular asimétrica (Figura 5b, d]. A pesar de este notable reorientación del huso mitótico, no hemos visto pruebas para la inducción de ectópico Dpn + neuroblasts, GMCs, o neuronas en el lóbulo óptico (datos no presentados). Llegamos a la conclusión de que forzando a la orientación vertical del husillo en neuroepitelial células no es suficiente para inducir o neuroblast GMC célula destino. Después de Insc misexpression la neuroepithelium es prácticamente indistinguible de un control neuroepithelium en todo el desarrollo larvario. Llegamos a la conclusión de que el resultado apical y basal de células hijas son reintegrados en el epitelio y sólo son capaces de cambiar a una neuroblast suerte cuando llegan al borde del lóbulo óptico. De este modo, la transición de célula neuroepitelial a neuroblast debe ser debido a una suerte de células de transición que no está regulada por un cambio de orientación del husillo. Proponemos que el interruptor de una celda neuroepitelial a un neuroblast implica coordinar la regulación de abajo múltiples eventos que incluyen el desmontaje de los cruces del epitelio y la transcripción de genes que promueven la orientación del husillo vertical.

Discusión

En este estudio nos demuestran que del lóbulo óptico neuroepitelial células se pueden distinguir de óptica lóbulo neuroblast células de morfología, la expresión de genes y el modo de división (Figura 6]. Neuroepitelial células ocupar la región lateral de la óptica del lóbulo y se dividen en una división simétrica proliferativa modo, que amplía las células madre neuronales piscina en una fase temprana de desarrollo del lóbulo óptico. En una etapa posterior, cada vez más células madre de redondear al alza y se separó de la parte medial del lóbulo óptico epitelio. Estos óptica lóbulo neuroblasts pierden su adherens cruces y empezar a dividir asimétrica, generando más pequeños GMCs hacia la creciente médula corteza.

La óptica del lóbulo neuroepithelium es similar a la de embriones ventral neuroectoderm en el sentido de que expresa la misma junctional complejos y el escudo proneural genes. Óptica lóbulo neuroblasts exhiben una polaridad apicobasal y pan-expresar genes neuronales como dpn y ase. Sin embargo, la mayoría de las células embrionarias neuroectodérmico adoptar una suerte epidérmica, mientras que el lóbulo óptico células epiteliales eventualmente dar lugar a neuronas y células gliales (por lo tanto, se trata de un neuroepithelium). Recientemente, se ha sugerido que neuroblasts embrionarias requieren una señal extrínseca, siempre superpuestos por el epitelio, para coordinar su división eje apicobasal con tejido de polaridad [39]. Como óptica lóbulo neuroblasts no delaminate de un superpuestos (apical) del epitelio, sino más bien de separar lateralmente la neuroepithelium adyacentes, que no mantienen contacto con un epitelio superpuestos. No obstante, todavía son capaces de reorientar sus ejes mitótico y dividir asimétrica a lo largo del eje apicobasal, GMCs incipiente despegue hacia el desarrollo de la médula corteza. La corteza células gliales, que enwrap el cerebro de larvas [40], puede proporcionar información sobre la posición apicobasal a la óptica del lóbulo neuroblasts en lugar de un epitelio superpuestos.

En el embrión de Drosophila los genes proneural ac, sc, y letal del escudo se expresan en la neuroectoderm [41, 42], como es el factor de transcripción Pros y su adaptador Mira [32 - 34]. Aunque hemos visto proneural la expresión génica en el lóbulo óptico neuroepithelium, que hemos detectado ni a favor ni proteínas Mira mRNA o proteína. Esto contrasta con la neuroectoderm embrionarias, en caso de que ambos Pros y Mira se expresan y localizar basolaterally, y sugiere que la cascada transcripcional subyacente óptica lóbulo neuroblast formación es diferente de la formación de embriones neuroblast. En el lóbulo óptico, Mira y se Pros expresado por primera vez en neuroblasts. Aquí se sitúen en una media luna en la corteza basal y segregar en la médula GMCs (Figura 2d, e] (en contradicción con un estudio anterior Pros lo que sugiere que no se expresa en el lóbulo óptico neuroblasts y GMCs, pero sólo en las neuronas maduras [16] ).

Posibles mecanismos para la transición del lóbulo óptico neuroepitelial células a neuroblasts

Clonal Nuestro análisis demuestra que la óptica del lóbulo neuroblasts se derivan de la óptica del lóbulo neuroepithelium en un temporal y espacialmente regulado moda. Al evaluar la relación entre clonal óptica lóbulo neuroepitelial células y neuroblasts que se recuperó sólo un pequeño número de clones mixta que incluya a los dos células epiteliales y neuroblasts. En lugar de ello, la mayoría de clones que figuran ya sea sólo o células epiteliales neuroblasts y su progenie. La transición de una neuroepithelium a neuroblasts podría ocurrir por una célula neuroepitelial dividiendo simétricamente, lo que genera dos neuroblasts, o por una célula neuroepitelial división asimétrica, generando una célula neuroepitelial y uno neuroblast. Nuestro análisis clonal no distingue si uno o ambos de estos mecanismos se producen.

A mediolateral gradiente de un morphogen podrá regular los cambios en la expresión de genes necesarios para inducir la neuroblast suerte. Una vez que el neuroepithelium ha proliferado a alcanzar un tamaño crítico, la mayoría de las células medial sería empujado más allá del alcance de la morphogen la actividad, y sería inducido a convertirse en neuroblasts. Un posible candidato para este morphogen es Decapentaplegic (DPP), la Drosophila BMP2 / 4 homólogo, lo que demuestra regionales, que dependen de alas, de expresión en el lóbulo óptico [43]. Las mutaciones en cualquiera de los dos wg DPP o dar lugar a una reducción en el tamaño del lóbulo óptico y defectos en la óptica del lóbulo neuropile y se ha sugerido que estos defectos pueden ser causados por la falta de especificación progenitoras en el desarrollo del lóbulo óptico [43].

Similitudes vertebrados a las células madre neuronales

La transición del lóbulo óptico neuroepitelial neuroblasts a las células en el lóbulo óptico es una reminiscencia de la transición de las células a neuroepitelial radial neuroglia en el neocórtex en desarrollo de vertebrados y en el tubo neural. Neuroepitelial células de mamífero, o células madre neuronales, en primer lugar se someten a la división simétrica de ampliar el de células madre neuronales piscina. Esto es seguido por auto-renovación, asimétrica división, durante el cual las células neuroepitelial-epitelial regular rasgos tales como cruces (pero no adherens cruces) y la libre renovar al mismo tiempo la generación de células a más restringido potencial de desarrollo [44 - 50].

La organización del lóbulo óptico también tiene comparación con la retina de vertebrados, cuando una estructura espacial ordenado es evidente tanto en cuanto a los celulares del desarrollo y la diferenciación: en la zona marginal ciliar (CMZ), el más joven y menos determinado las células madre son los más próximos a la periferia , La proliferativa retinoblasts medial y son las células que han dejado de dividir están en el borde central [51, 52]. Del mismo modo, en el lóbulo óptico, la neuroepitelial se encuentran células lateralmente, la neuroblasts mediáticamente, y las células ganglionares hacia el interior del lóbulo.

Las similitudes sorprendentes entre la óptica y el lóbulo CMZ sugieren que las vías similares genéticos pueden estar involucrados en ambos sistemas. Recientemente, se demostró que Insc, que regula la orientación huso en Drosophila neuroblasts, se expresa también en la retina de vertebrados [5]. Insc expresión embrionaria en neuroblasts y óptica lóbulo neuroblasts es uno de los primeros signos de neuroblast pliego de condiciones; ni el de embriones ventral neuroectoderm ni la óptica del lóbulo neuroepithelium expresar insc. Curiosamente, mientras que insc se expresa en neuroblasts dividir verticalmente en la Drosophila y del lóbulo óptico embrionario del sistema nervioso central, en la retina de mamíferos y se expresa en tanto verticalmente dividir celdas (donde se localiza apically) y dividir celdas horizontalmente (donde es apicolateral). Esto sugiere que, en la retina de vertebrados, la división avión está determinada por cualquier localiza Insc, y no solamente por la presencia de Insc.

ZIGMAN et al. [5] muestran que la reducción de los niveles de Insc aumenta el número de divisiones horizontales a expensas de las divisiones verticales. Esto lleva eventualmente a una disminución en el número de principios de la diferenciación de células visuales y eventualmente a un aumento de la posterior diferenciación de las neuronas bipolares. A partir de estos resultados los autores inferir que un cambio de vertical a horizontal aumenta la división de células madre de piscina a expensas de principios de las neuronas diferenciadas, es decir, que determina la orientación del husillo el destino de la células progenitoras.

Conclusión

En este sentido, indican que la óptica del lóbulo neural alberga dos tipos de células madre: las células neuroepitelial, que dividen simétricamente a ampliar la neural de células madre de piscina, y neuroblasts, que dividen asimétricamente a la libre renovar y generar diferenciación GMCs. Neuroblasts se derivan de la neuroepithelium en un desarrollo regulado y espacialmente la moda. Reorientación de la huso mitótico en células Drosophila neuroepitelial, siguiendo las instrucciones de expresión ectópica de Insc, no es suficiente en sí misma para inducir el neuroblast suerte y no conduce a la neurogénesis prematuro. En lugar de ello, eje de orientación responde a destino celular en lugar de su promoción. Cell suerte especificación en neuroblasts conduce a la expresión de insc husillo y reorientación. Una segunda consecuencia de neuroblast suerte especificación es la expresión de Pros y Mira. Por lo tanto, cuando el huso reorienta a la neuroblast, la división celular genera dos tipos de células diferentes, debido a la asimetría de particionado de Pros. En la óptica del lóbulo los diferentes planos de división de las células y neuroepitelial neuroblasts dar lugar a capas estratificadas de las células que contribuyen a la morfogénesis de los lóbulos del cerebro (Figura 6]. Por lo tanto, un papel fundamental de orientación del husillo regulado en el lóbulo óptico puede estar en la posición apropiada dentro de las células del tejido, una función similar a lo que se ha propuesto para la piel de mamíferos [3].

Materiales y métodos
Fly cepas

Las moscas se plantearon en medio de harina de maíz a 25 ° C. Oregon R yw y se utilizaron como control las cepas. En analizar la expresión sc 3.7sc-lacZ línea [53] (de P Simpson, Cambridge, UK) se ha utilizado. El siguiente conductor y líneas de respuesta se utilizaron: GAL4 c855a [20, 21] (a partir de la Drosophila Stock Bloomington Centro, Bloomington, Indiana, EE.UU.), UAS-pon-gfp [31], UAS-pon-gfp; UAS-H2B - mRFP1 [54] (Y de Bellaiche, París, Francia) y UAS-insc/TM3 [30] (de J Knoblich, Viena, Austria). Por MARCM clones hemos utilizado hs-FLP; FRT40A, bañera-Gal80; tub-Gal4/TM6B y FRT40A; mCD8-UAS-GFP, UAS-nlslacZ [8] (de B Bello, Basilea, Suiza). Por flip-clones a cabo la localización y linaje hs-FLP (F38) y act5C (FRT) nlslacZ (de Bloomington) fueron utilizados.

Etapas de larvas y clon de inducción

Larvas recién eclosionados se recogen en un 4 a 6 horas ventana de tiempo en escena y en medio de harina de maíz a finales de primer / segundo estadio temprano (21 a 27 horas ALH; después de su nacimiento), a fines segunda / tercera estadio temprano (45 a 51 horas ALH), mediados tercera estadio (69 a 75 horas ALH) oa fines de instar tercero (93 a 99 horas ALH). Focalizada la expresión génica se logró con la GAL4/UAS sistema. El GAL4 c855a línea impulsa la expresión génica orientados a todos los óptica lóbulo células progenitoras de la primera estadio en adelante. Por MARCM experimentos clones fueron inducidos por choque térmico durante 30 minutos a 37 ° C a finales de segunda / tercera estadio temprano con el siguiente genotipo: yw, hs-FLP; FRT40A, + / FRT40A, bañera-GAL80; UAS-mCD8: GFP, UAS-nlslacZ/tub-GAL4. Las larvas fueron disecados y fijados a mediados tercera estadio para clonar examen. Por flip-out análisis clonal clones fueron inducidas por el calor de choque durante 45 minutos a 37 ° C en 31 horas ALH. Los clones fueron examinados en 48 horas o 96 horas ALH.

Insc misexpression y el análisis de eje del husillo

Por insc misexpression GAL4 c855a se cruzó a UAS-insc/TM3. El eje del husillo se analizó en GAL4 c855a / insc-UAS y GAL4 c855a / TM3 control de cerebros. Para células en metafase prometaphase y una línea que se señaló que une los dos centrosomes. El ángulo del eje del husillo se calculó en referencia a la tangente a la superficie neuroepitelial. Sólo se considera negativo Dpn células que están dentro de la neuroepithelium y no vecinos Dpn positivo neuroblast regiones.

La inmunocitoquímica y de adquisición de imágenes

Tejidos de larvas fueron fijadas y como ya immunostained se describe en [55]. Anticuerpos primarios utilizados en este estudio incluyen conejo anti-Scrib 1:2500 [56], rata anti-DE-Cad 1:100 (Serotec, Raleigh, Carolina del Norte, EE.UU.), conejo anti-PatJ 1:1000 [57] (rebautizado PatJ [58]], un ratón anti-DLG 4F3 1:100 (hibridoma Estudios del Desarrollo del Banco (DSHB), Iowa City, Iowa, EE.UU.), rata anti-Dpn 1:2 [10], conejo anti-Ase 1:500 ( Una de Jarman, Edingburgh, UK), ratón anti-Pros MR1A (DHSB) 1:30, conejo anti-Mira A96c 1:1000 [33] (SN de Enero, San Francisco, EE.UU.), conejo anti-Insc 1:500 (W de Chia, Singapur, Singapur) de ratón anti-β GAL 1:500 (Promega, Madison, Wisconsin, EE.UU.), conejo anti betaGal 1:10000 (CAPPEL, Organon Teknika Corporation, West Chester, Pensilvania, EE.UU.), conejo anti - Cnn 1:1000 (inédito, proporcionado amablemente por el Sr Raff, Cambridge, UK), conejo anti-GFP 1:1000 (Abcam, Cambridge, Cambridgeshire, Reino Unido), pollo y anti-GFP 1:20 (Upstate, Charlottesville, Virginia, EE.UU.). El ADN genómico fue teñido con DAPI (Sigma-Aldrich, Gillingham, Dorset, UK). Fluorescente secundario conjugado con anticuerpos Alexa405, Alexa488, Alexa568, Alexa633 se utilizaron (Molecular Probes, Invitrogen, Paisley, Renfrewshire, Reino Unido). Las imágenes fueron adquiridas con una Leica SP2 microscopio confocal y procesados con Imaris 3.2 (Bitplane, Zurich, Suiza) y Adobe Photoshop 8,0. Las cifras y las ilustraciones fueron hechas utilizando Adobe Illustrator 11,0.

Live imágenes

Larvas cerebros expresar GAL4 c855a conducción Pon-GFP y H2B-mRFP1 fueron disecados en el tercer estadio y se coloca en poli-Lisina (0,002%) cubreobjetos recubiertos por una cámara que contiene grasa corporal acondicionado D22 insectos medio, el 7,5% de suero de ternera bovina [59]. Cell divisiones fueron imágenes utilizando un Zeiss Meta510 microscopio confocal invertido equipado con un 40 × 1,4 NA petróleo-objetivo de inmersión.

Fluorescencia de hibridación in situ

Las sondas se realiza mediante amplificación por PCR de una biblioteca de cDNA con el primer inversa que contiene un promotor T7 polimerasa, CAGTAATACGACTCACTATTA. PCR se realizó a través Phusion Taq (New England Biolabs, Hitchin, Hertfordshire, Reino Unido) con los siguientes ciclos: 98 ° C durante 2 minutos, 5 veces (98 ° C durante 20 s, 50 ° C durante 20 s, 72 ° C durante 1 minuto), 35 veces (98 ° C durante 20 s, 59 ° C durante 20 s, 72 ° C durante 2 minutos) y 72 ° C durante 5 minutos. Los primers fueron diseñados utilizando Primer3 [60] con una longitud máxima de 24 pares de bases (pb) y una óptima temperatura de fusión (Tm) de 60 ° C. UTP-Dig (Roche Diagnostics, Burgess Hill, West Sussex, UK) etiquetados ARN sondas fueron generados a partir de plantilla de productos PCR de transcripción in vitro. Para una mejor penetración en el tejido sondas fueron degradados a un tamaño medio de 500 bp fragmentos utilizando un buffer de carbonato de fragmentación [61]. Fluorescencia de hibridación in situ (FISH) se realizó de acuerdo a [62], con modificaciones menores. Larvas cerebros se fijaron en paraformaldehído al 4% en buffer fosfato salino-durante 20 minutos. Hibridación se realizó a 65 ° C durante 12 a 16 horas. Señal de fluorescencia se obtengan mediante la utilización de un kit de amplificación Tyramide (Molecular Probes, Invitrogen). Primers para sondas fueron: AC _forward, GAAAATCACTCTGTTTTCAACGAC; ac _reverse, CAGTAATACGACTCACTATTA TCAGTTTAATGTCCTCAATGTATGC; sc _forward, ACAACGAAAAGCACTACCATGTCA; sc _reverse, CAGTAATACGACTCACTATTA AGAAAATAGGGCGTGGTGGTAAAT; mira _forward, GGTAGAGAATCTCCAGAAGACCAA; mira _reverse, CAGTAATACGACTCACTATTA AAACGCGAAAGATAGAAAACAATC. Los nucleótidos en negrita representan la T7 polimerasa sitio de unión.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Autores de las contribuciones

BE participó en la expresión estudios, llevado a cabo la Pon-GFP viven estudio, el estudio MARCM, Insc misexpression el estudio y redactó el manuscrito. JQB llevó a cabo el FLP-de análisis clonal y participó en el estudio de expresión, quien también ayudó en la redacción del manuscrito. NRS participó en el diseño y la realización de la Insc misexpression estudio. AHB y CQD concebido del estudio y participó en su diseño y la coordinación y redactó el manuscrito final. Todos los autores leído y aprobado el manuscrito final.

Material complementario
Adicional 1 archivo de datos
escudo
y
Mira
mRNA expresión en el lóbulo óptico.
(a)
FISH para detectar
SC
ARNm (verde) a finales de tercero estadio en combinación con inmuno-tinción de DLG (rojo).
SC
ARNm se expresa en todo el epitelio y en el medial neuroblasts. El
3.7sc-lacZ
reportero línea (Figura
2b
) Se expresa fuertemente en la neuroepithelium y es downregulated en medial neuroblasts.
3.7sc-lacZ
no puede reproducir todo el
SC
patrón de expresión, o
lacZ
expresión en medial neuroblasts puede ser por debajo de nuestro nivel de detección.
(b)
Pescado para
Mira
ARNm (verde) a finales de tercero estadio en combinación con inmuno-tinción de DLG (rojo).
Mira
ARNm se expresa en neuroblasts medial, pero no en células neuroepitelial.
Datos adicionales de archivo 2
Óptica lóbulo neuroblasts división asimétrica. Asimétrica división de una OPC neuroblast medial en un estadio tardío tercera cerebro.
GAL4
c855a
unidades Pon-GFP y H2B-mRFP1 en el OPC células progenitoras.
Datos adicionales archivo 3
La desigualdad en la segregación de Pon-GFP a la célula hija GMC. Asimétrica división del neuroblast una OPC en un estadio tardío tercera cerebro.
GAL4
c855a
unidades Pon-GFP y H2B-mRFP1 en el OPC células progenitoras. Tenga en cuenta que Pon-GFP es asimétrica segregado a la hija de células basales
Datos adicionales de archivo 4
Óptica de las células del lóbulo neuroepitelial dividir simétricamente. Simétrica de división de una célula neuroepitelial OPC a finales de tercero estadio.
GAL4
c855a
unidades Pon-GFP y H2B-mRFP1 OPC en células progenitoras. Tenga en cuenta que Pon-GFP es simétrica a ambos segregados células hijas
Agradecimientos

Y damos las gracias Bellaiche, Bello B, B Chia, YN Jan, un Jarman, Knoblich J, J, Raff, P Simpson, el hibridoma Estudios del Desarrollo y el Banco Bloomington Drosophila Stock Centro para la prestación de anticuerpos reactivos y líneas de mosca. Un agradecimiento especial va a Chell J para comentarios sobre el manuscrito. Queremos dar las gracias a la marca y Doe laboratorios para el debate y un apoyo para Sossick con microscopia. BE es un Wellcome Trust Investigador Asociado y fue apoyado por becas del Fondo Nacional Suizo Roche y la Fundación de la Ciencia. JQB fue apoyada por un NSF IGERT pre-doctoral de formación de subvención. NRS es un Wellcome Trust 4 años estudiante de doctorado en Biología del Desarrollo. Este trabajo fue financiado por el Wellcome Trust Programa de Donación a AHB y por el Howard Hughes Medical Institute (CQD). CQD es un investigador HHMI.