Acta Histochemica et Cytochemica, 2006; 39(6): 173-181 (más artículos en esta revista)

Espacio-temporal de Análisis Molecular de la Interacción entre PICK1 y PKC

Sociedad Japonesa de Histoquímica y Citoquímica
Kenji Masukawa [1], Norio Sakai [2], Shiho Ohmori [1], Yasuhito Shirai [1], Naoaki Saito [1]
[1] Laboratorio de Farmacología Molecular, Biosignal Centro de Investigación, Universidad de Kobe, Kobe 657-8501, Japón
[2] Departamento de Farmacología Molecular y Neurociencia, Escuela de Estudios Superiores de Ciencias Biomédicas, Universidad de Hiroshima

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original esté debidamente citados.

Resumen

PICK1 es una proteína que se identificaron inicialmente como una proteína quinasa C α (α PKC), la proteína de unión utilizando la levadura de dos sistema híbrido. Además de PKC α, PICK1 el complejo se une a diversas y regula las proteínas transmembrana incluidos los receptores y los transportistas. Sin embargo, no se ha aclarado cuándo y dónde PICK1 se une a α PKC. Hemos examinado la interacción espacio-temporal de PICK1 y PKC utilizando técnicas de imagen y demostraron que la PKC activada α se une a PICK1 y transporta a la membrana plasmática. Aunque la translocación de membrana PICK1 requiere la activación de PKC α, PICK1 se mantenga a la membrana, incluso después de PKC se mueve hacia atrás al citosol. Estos resultados sugieren que la interacción entre α PKC y PICK1 es transitorio y puede que no sea necesario para la regulación de los receptores / transportadores de PICK1 α o de PKC en la membrana.

I. Introducción

Proteína kinasa C (PKC) desempeña un papel fundamental en muchas vías de señalización y la existencia de múltiples subtipos sugiere que las diferentes isoformas tienen funciones diferentes. La PKC superfamilia se compone de al menos 10 subtipos y se divide en tres grupos, clásicos PKC (cPKC; α, β I, II, β, γ), novela PKC (nPKC; δ, ɛ, η, θ), y PKC atípicas (aPKC; ζ, ι / λ), sobre la base de sus estructuras [20, 21, 25, 26]. Cada subtipo de PKC tiene sensibilidad diferencial a activadores y muestra de tejidos y células, expresión concreta, lo que sugiere que cada subtipo desempeña un subtipo específico de papel en diferentes vías de transducción de señales y en la regulación de numerosos procesos celulares [20 - 22]. - El subtipo función específica de PKC, sin embargo, no ha sido aclarado por técnicas bioquímicas convencionales debido a la baja especificidad por el sustrato entre los miembros de la familia. Los últimos avances técnicos nos permitió controlar el movimiento de PKC en células vivas utilizando PKC fusionados con proteína verde fluorescente (GFP) [23, 29]. Informes de uso de buenas prácticas agrarias de etiquetado PKC subtipos han demostrado que la PKC translocación varía en función del subtipo de PKC y en el tipo de estimulación [1, 15, 18, 19, 23, 32, 39, 40]. Estos resultados sugieren que la translocación correcta espacio-temporales de cada subtipo de PKC es necesaria para su activación y la fosforilación de substratos específicos. Análisis de subtipo y estímulo específico de PKC translocación proporciona una manera de estudiar su papel individual en vías de señalización celular.

Una característica importante y característica del sistema nervioso central sinapsis es la agrupación de receptores y las moléculas de señalización en ambos presináptica y la postsináptica los sitios a los que subyace una eficiente transmisión sináptica en el cerebro. Por ejemplo, glutamato en la sinapsis excitatoria del hipocampo, tanto ionotrópicos de glutamato N-metil-D-aspartato (NMDA) y α-amino-3-hidroxi-5-methylsoxazole-4-propionato (AMPA) se concentran los receptores postsinápticos a sitios [36], mientras que la proteína G-junto de receptores de glutamato metabotrópicos mGluR7a está específicamente dirigido a la zona activa presináptica de terminales nerviosas [31]. Estudios recientes han demostrado la importancia de PDZ de dominio que contienen las proteínas en los específicos de mediación sináptica agrupación de receptores y neurotransmisores en la regulación del receptor de señalización en las sinapsis [5, 10, 11].

Entre las proteínas que interactúan con la proteína quinasa C (PKC), PICK1 es un dominio de proteínas PDZ clonado inicialmente sobre la base de su interacción con PKC por una levadura de dos híbridos de cribado [33]. PICK1 selectivamente se une a α PKC mediante la interacción con el QSAV secuencia en el extremo COOH-terminal de α PKC [34]. El carboxilato vinculante bucle en el dominio PDZ de PICK1 se requiere para la interacción [34]. PICK1 posteriormente ha sido demostrado para interactuar con los receptores Eph tirosina quinasas y ephrin-B ligandos [37], GluR2/3/4c subunidades de los receptores AMPA [6, 41], mGluR7a receptor [3, 7], y la dopamina y la noradrenalina los transportistas [38]. PICK1 un triple formas complejas que contienen α PKC y mGluR7 en las neuronas [7].

En el presente estudio, hemos examinado el espacio-temporales PICK1 interacción entre α y PKC en células vivas de las técnicas de imagen para dilucidar el papel funcional de PKC como un socio obligatorio para PICK1.

II. Materiales y Métodos
Materiales

12 - O-tetradecanoylphorbol 13-acetato (TPA), inhibidor de PKC (Gö6983), y uridina trifosfato (UTP) fueron adquiridos de Sigma Chemical Co (St. Louis, MO). Todas las demás sustancias químicas fueron de grado analítico.

Cultivo celular

HEK293 células y se compraron de Riken Cell Bank (Tsukuba, Japón). CHO-K1 células fueron adquiridos de Ciencias de la Salud de Investigación de Recursos del Banco (Osaka, Japón). HEK293 células fueron cultivadas en Dulbecco modificada de Eagle's medio, y CHO-K1 células en Ham's F-12 medianas (Invitrogen, Grand Island, NY) a 37 ° C en un ambiente humidificado contiene 5% de CO 2. Todos los medios de comunicación se complementaron con un 10% de suero fetal bovino, penicilina (100 unidades / ml) y estreptomicina (100 μ g / ml). El suero fetal bovino utilizado no fue inactivado por calor. Para los experimentos de transfección, las células HEK293 y CHO-K1 células fueron trypsinized y sin semillas a una densidad de 1 × 10 5 cells/3.5-mm en vidrio de fondo cultura platos (MatTek Corp, Ashland, MA) e incubados durante 16-24 h antes de transfección.

Transfección de plásmidos en células cultivadas

CHO-K1 y HEK293 células fueron transfectadas con 3 μ l de FuGENETM 6 Transfección Regent (Roche Molecular bioquímicos) y 1 μ g de ADN de acuerdo con el protocolo del fabricante. Para co-expresión de los plásmidos, la misma cantidad de cada plásmido fue mixta y transfectadas. Los experimentos se realizaron 24-48 h después de la transfección.

Construcción de plásmidos de codificación de la DsRed2-PKCS y las buenas prácticas agrarias-PICK1 proteína de fusión

BS1043 es un plásmido DsRed2 codificación PKC-α proteína de fusión en la que PKC α (BS611) y DsRed2 están obligados a la N-terminal de PKC α. BS1085 es un plásmido de codificación DsRed2-γ PKC proteína de fusión en la que γ PKC en pTB701 (BS55) y DsRed2 están obligados a la N-terminal de γ PKC. BS1104 es un plásmido de codificación DsRed2-γ PKC-α CT proteína de fusión. Un fragmento de cDNA γ PKC en pTB701 (BS55) con un sitio HindIII en el 5'-terminal y un sitio EcoRI en la 3'-terminal ha sido producido por una PCR con cDNA para γ PKC en pTB701 (BS55) como la plantilla. El sentido y antisentido se primers 5'-TTAAGC TTCCATGGCGGGTCTGGGTCCTG-3 'y 5'-TTGAATTCTCATACTGCACTTTGCA AGATTGGGTGCACGAAGTCCGG GTTCAC-3', respectivamente. El producto de PCR de PKC γ subcloned por primera vez en un vector de asistencia técnica de clonación, pCRTM2.1 (Invitrogen, San Diego, CA). El plásmido fue digerido con HindIII EcoRI y luego subcloned en la HindIII EcoRI y sitio en pDsRed2-C1 (Clontech Laboratories, Inc). GFP están obligados a la N-terminal de PICK1 para producir GFP-PICK1 (BS 1001). Plásmidos codificación GFP-PICK1-T82A, T227A-y-T249A) fue construido por la mutación de cada uno de treonina a alanina.

Observación de la translocación de GFP-o-DsRed2 fundido proteína

Transfectadas las células estaban repartidos en vidrio de fondo cultura platos (MatTek) y cultivadas durante al menos 24 horas antes de observación. El medio de cultivo fue reemplazado con HEPES buffer normal compuesto de 135 mM NaCl, 5,4 mM KCl, 1 mM MgCl 2, 1,8 mM CaCl 2, 5 mM HEPES, y 10 mM de glucosa, pH 7,3. La fluorescencia de las proteínas de fusión fue controlado por escaneo láser confocal de microscopía de fluorescencia (modelo LSM invertido 510; Carl Zeiss, Jena, Alemania). GFP-fundido proteína se vigila a 488 nm de excitación argón utilizando un 510 - a 535-nm banda pasan barrera filtro. DsRed-fundido proteína se vigila a 543-nm de excitación HeNe1 utilizando un 590-nm de banda pasa el filtro de barrera. DsRed y las buenas prácticas agrarias fueron controlados simultáneamente mediante multitracking software que detecta alternativamente cada fluorescencia de conmutación rápida entre el láser y sistema de filtro.

Immunoprecipitation

GFP PKC-α cDNA fue transitoriamente HEK293 transfectadas en células (1 × 10 5 células / cápsula) de FuGENETM 6 Transfección reactivo (Roche, Mannheim). Después de transfectadas las células fueron cultivadas a 37 ° C durante 16 horas y, a continuación, cosechadas con 5 ml de homogenado buffer (250 mM sacarosa, 10 mM EGTA, 2 mM EDTA, 20 mM Tris-HCl, 20 μ g / ml leupeptina, y 1 mM phenylmethylsulfonyl fluoruro, pH 7.4) con 1% Tritón X-100. Después de los ultrasonidos (UD-210 Tomy Seiko, Tokio, Japón) (producción, 5; deber, el 50%, 10 veces a 4 ° C), las muestras fueron centrifugadas a 400000 × g durante 30 min a 4 ° C (Hitachi, Tokyo , Japón), y el sobrenadante se recogió. El sobrenadante fue girada con un anti-GFP anticuerpo policlonal (diluida 1:50) (Molecular Probes, Eugene, Oregón) durante 2 horas a 4 ° C y luego con la proteína A-Sepharose por un período adicional de 2 horas. Las muestras fueron centrifugadas a 2000 × g durante 5 min a 4 ° C, y "pellets" se lavaron tres veces con buffer fosfato salino-sin Ca 2 + y Mg 2 + (PBS (-)). Por último, el precipitado se suspendió a 50 μ l de PBS (-) y utilizado para los ensayos de cinasa o inmunoblot.

Quinasa de ensayo recombinante GFP PKC-α

GFP PKC-α se immunoprecipitated de células HEK293 transfectadas con GFP PKC-α cDNA. El immunoprecipitated muestras (10 μ l de suspensión de pellet) se utilizaron para kinasa in vitro ensayos. La actividad quinasa fue ensayada por la medición de la incorporación de 32 Pi en MBP de [γ-32 P] ATP, tal como se describe anteriormente [24].

El análisis de los datos

El curso temporal de la translocación se registró como una serie cronológica de 30-50 imágenes por cada experimento. Análisis de imágenes se realizó a través de Zeiss LSM 510 software, y la membrana de fluorescencia ratio se calculó. Esta fue definida como la membrana plasmática intensidad de fluorescencia / citoplasma intensidad de fluorescencia en 1-7 μ m 2 región de interés (ROI). ROIs se citoplasma de los círculos y rectángulos de la membrana plasmática. Para cada punto del tiempo, la membrana de fluorescencia se calculó a partir de al menos 5 diferentes ROIs. Estos valores promedio y se trazan para generar un tiempo de translocación.

III. Resultados

La intensa fluorescencia DsRed2 de PKC-α se observó en el perikarya de la HEK293 transfectadas las células que expresan DsRed2-α PKC por sí sola, débil y de fluorescencia se observó en los núcleos (Fig. 1 A, fila inferior). El tratamiento con 1 μ M TPA inducida por la evidente DsRed2 translocación de PKC-α del citosol a la membrana plasmática. El traslado comenzó a las 5 min y se completó en 15 minutos después de la estimulación TPA (Fig. 1 A). La fluorescencia se mantuvo en la membrana plasmática durante al menos 25 minutos después de TPA tratamiento y no habían regresado a en el citoplasma de las células probada. DsRed2 La PKC-α en los núcleos no parecen ser trasladadas. La intensa fluorescencia de GFP-PICK1 se observó en el perikarya de la HEK293 transfectadas las células que expresan GFP-PICK1 por sí sola, débil y de fluorescencia se observó en los núcleos (Fig. 1 A, fila superior). En contraste, la fluorescencia de GFP-PICK1 no translocate después del 1 μ M TPA estimulación.

Entonces investigó el translocaciones de PKC y PICK1 cuando co-expresadas en las mismas celdas. Co-DsRed2 expresión de PKC-α con GFP-PICK1 no alteró la distribución difusa de cada proteína fluorescente (Fig. 1 B). Cuando las células fueron estimuladas con 1 μ M TPA, tanto las buenas prácticas agrarias PICK1-DsRed2 y PKC-α trasladadas desde el citosol a la membrana dentro de 15-20 minutos después de la estimulación (Fig. 1 B), a pesar de las buenas prácticas agrarias-PICK no respondió a TPA cuando expresó por sí solo. Estos resultados sugieren que la translocación de GFP-PICK1 fue inducida por la activación y translocación de PKC α exógenos.

Staudinger et al. PICK1 informó de que interactúa con el sitio de unión PDZ en la terminal C de PKC α a través de un dominio PDZ en PICK1 [33, 34]. Para dilucidar el subtipo especificidad de PKC para la interacción con PICK1, hemos examinado la translocación de GFP-PICK1 en las células que expresan simultáneamente γ PKC o β IPKC. Como se muestra en la Figura 1 y C 1 D, TPA no translocate GFP-PICK1 a la membrana plasmática, mientras que la TPA inducida por la translocación de PKC o γ β IPKC era evidente, lo que sugiere que la translocación de PICK1 está relacionado con la expresión de PKC α, pero no γ PKC o β IPKC. Como se supone que PKC α se une a PICK1 a través de su terminal C con dominio PDZ de PICK1, la unión de dominio de PKC α a translocate con PICK1 se examinó mediante el uso de γ PKC haber terminal C de PKC α. Los cuatro residuos de aminoácidos en la terminal C de PKC α se ha demostrado como un PDZ-sitio de unión. Los últimos cuatro aminoácidos de γ PKC fueron sustituidos con PDZ vinculante secuencia de PKC α (γ PKC-α CT) y co-expresada con PICK1. Como se muestra en la Figura 2 A, al mismo tiempo la translocación de GFP-γ PICK1 con PKC-α CT a la membrana plasmática se observó después de TPA tratamiento.

Para estudiar si no sólo la unión de PKC α a PICK1 sino también la fosforilación de PICK1 de α PKC es necesaria para la TPA inducida por la translocación de PICK1, hemos examinado el efecto de un inhibidor de PKC (Gö6983) en el PICK1 translocación en la que expresan las células HEK293 PICK1 GFP-DsRed2 y PKC-α (Fig. 2 B). En presencia de 7 nM Gö6983, ni la localización citosólica de PICK1 ni el de PKC α se vio alterada. Gö6983, sin embargo, bloquearon la translocación de GFP-PICK1, mientras que DsRed2-α PKC mostró translocación de membrana. Los resultados indican que la TPA inducida por la translocación de PICK1 requiere tanto la activación de PKC α, además de la unión de PKC α a PICK1.

Tres posibles sitios de fosforilación PKC, R / KXXS / T o R / KXS / T se encontraron en la secuencia de aminoácidos de PICK1 [27]. Además, si estudió o no es PICK1 fosforilados de PKC α después de su unión a PKC α activa y si la fosforilación es necesaria para la TPA inducida por la translocación de PICK1. Hemos construido tres mutantes de PICK1 (PICK1-T82A, T227A, T249A) en que los posibles sitios de fosforilación PKC mutado y se examinó su translocación en respuesta a la TPA. Mutación de treonina 82 a alanina (T82A) de PICK1 bloqueado la translocación de PICK1 de TPA (Fig. 2 C), aunque PICK1-T227A (Fig. 2 D) y PICK1-T249A (Fig. 2 E) mostró evidentes translocación de membrana. Translocación de PKC α se hizo evidente después de TPA en el tratamiento HEK293 todas las células que expresan estos PICK1 mutantes. Estos resultados sugieren que el TPA y PKC-α depende de PICK1 translocación a la membrana plasmática requiere la fosforilación de treonina 82 (T82).

Como se ha indicado anteriormente, inducida por TPA translocación de PKC α es lento e irreversible. Por lo tanto, es difícil detectar la diferencia temporal de la translocación entre PKC α y PICK1. Se utilizó para la estimulación UTP translocate α PKC, lo que induce un rápido y reversible translocación [32]. La activación de PKC α a través de la proteína G-receptor acoplado estimulación inducida por la rápida y reversible la translocación de DsRed2 tanto PKC-α y las buenas prácticas agrarias-PICK1 pero el tiempo de la membrana de orientación DsRed2 diferían entre PKC-α y las buenas prácticas agrarias-PICK1 (Fig. 3]. La diferencia temporal de los dos translocaciones se muestra en la Figura 3 A. La fluorescencia de DsRed2-α PKC trasladadas desde el citosol a la membrana dentro de los 30 segundos y los distribuya de la membrana al citosol en 150 seg. En contraste, la translocación de GFP-PICK1 era evidente a los 60 segundos, aún localizados en la membrana a 150 segundos y los distribuya de la membrana al citosol dentro de 300 segundos tras la estimulación con 100 μ M UTP. La intensidad de la fluorescencia en la membrana y en el citoplasma y se midió la membrana / citosol proporción de la fluorescencia se cuantificó (Fig. 3 B). Figura 3 B muestra que la membrana de la translocación de PKC α precede a la de PICK1, PICK1 y que se mantenga a la membrana de más de PKC α. Estos resultados sugirieron que una vez PICK1 está dirigida a la membrana plasmática de la asociación con la activa PKC α, no es necesario para PICK1 a asociarse con PKC α.

La relación entre la actividad de quinasa PKC α y su unión a PICK1 Además, se analizaron (Fig. 4]. El curso temporal de la actividad PKC fue ensayada por la medición de la incorporación de 32 Pi de [γ-32 P] ATP en MBP en cada momento después de la adición de los activadores, PS / DO / Ca 2 +, tal como se describe en Materiales y Métodos. α PKC fue significativamente activado 10 segundos después del tratamiento con PS / DO / Ca 2 + y la actividad de quinasa PKC α se incrementará progresivamente hasta que, al menos, 180 seg. Sin embargo, el menú desplegable usando el ensayo anti-GFP de anticuerpos mostraron que la máxima interacción de PICK1 con las buenas prácticas agrarias PKC-α se encontró 60 segundos después de la activación de las buenas prácticas agrarias PKC-α, mientras que la interacción es muy débil ante la estimulación. Es interesante señalar que la interacción se redujo a 180 segundos cuando la actividad quinasa se sigue en aumento. Esto sugiere fuertemente que PICK1 no se une a α PKC continuamente, incluso cuando α PKC se encuentra en estado activo.

IV. Discusión

En el presente estudio se investigó el mecanismo detallado de PKC dependientes de la translocación de PICK1 en las células vivas. TPA no translocate exógenos PICK1, cuando PICK1 solo se overexpressed en células HEK293, mientras que PICK1 trasladadas cuando se co-expresada con PKC α. PICK1 trasladadas a la membrana plasmática dentro de los 30 min en respuesta a la TPA como PKC α se translocan. Este PKC dependientes de la translocación de PICK1 se PKC-α específicos, aunque otros subtipos PKC como PKC β y γ mostró TPA PKC inducida por translocación similar a la de PKC α. Se sugiere que el subtipo específico de la interacción con PKC α PICK1 es causada por la unión de dominio PDZ de PICK1 al PDZ-sitio de unión (QSAV) en el COOH terminal de α PKC [34]. De hecho, inducida por TPA translocación de PICK1 a la membrana plasmática se observó cuando γ PKC que tiene una secuencia QSAV a C-terminal fue co-expresó, indicando que el PDZ de sitios de unión de PKC α, QSAV, es necesaria para PKC dependientes de la translocación de PICK1. Sin embargo, la TPA no translocate PICK1 sin sobreexpresión de PKC α, a pesar de PKC α endógena se expresa en células HEK293. Cantidades significativas de PKC α son tal vez necesarias para la translocación evidente de las buenas prácticas agrarias de etiquetado PICK1.

TPA inducida por la translocación de PKC se visualizan mediante el uso de buenas prácticas agrarias de etiquetado PKCS en las células vivas [29]. TPA inducida lenta e irreversible la translocación de PKC y la translocación no depende de la actividad de PKC como inhibidor de PKC no altera la translocación [29]. Como se muestra en la Figura 2, el tratamiento previo con un inhibidor de PKC no inhibió la translocación de PKC-α GFP, pero simultáneamente la translocación de PICK1 fue completamente bloqueado por 7 nM Gö6983, un inhibidor de PKC. Estos resultados muestran que la TPA inducida por la translocación de PICK1 requiere la activación de PKC α, además de la sobreexpresión de PKC α. ¿Por qué la activación de la PKC α necesario? Una posibilidad es que la fosforilación de PICK1 de PKC es necesaria para la translocación de PICK1 acompañado con PKC α. La otra posibilidad es que la secuencia QSAV en el extremo COOH-terminal de α PKC puede llegar a ser accesibles al dominio PDZ vinculante de una vez PICK1 α PKC se activa y tiene una conformación abierta. Como PICK1 tiene tres posibles PKC-fosforilación sitios, los mutantes, los sitios de fosforilación (T82, T249 y Y227) para residuos de alanina y examinó la TPA inducida por la translocación de la PICK1 mutantes. La mutación del T82, pero no la de T227 o T249 abolido la translocación de PICK1, lo que sugiere que la fosforilación de T82 era importante. Sin embargo, como T82 está localizado en el dominio PDZ vinculante de PICK1, la mutación del T82 puede inhibir la translocación de PICK1 inquietante de la interacción entre el dominio PDZ vinculante de PICK1 y PKC α, pero no por la inhibición de la fosforilación dependiente de proceso. Si la fosforilación de T82 es el responsable de la translocación de PICK1, PICK1-T82E, que imita la forma de fosforilados PICK1, podrían ser trasladadas por la TPA. La sustitución de T82 a glutamato en PICK1 también abolió la TPA inducida por la translocación de PICK1 acompañado con PKC α (datos no presentados). Estos resultados sugieren que el T82 podrían ser importantes para la interacción entre PICK1 y PKC α, a pesar de la necesidad de fosforilación T82 sigue siendo controvertido.

Dominio PDZ proteínas puede organizar los complejos de señalización y regular la actividad canal, el tráfico, localización y [2, 11, 12, 17, 30]. PICK1 se identificó por primera vez como un socio obligatorio de PKC α [33, 34] y desde entonces se ha demostrado interactuar con muchos receptores, canales, y los transportistas [3, 4, 7 - 9, 14, 35, 37, 41]. Aunque PICK1 sólo tiene un dominio PDZ, PICK1 oligomerización en espiral a través de su bobina-región [34, 41] que permite el cruce de enlace con diferentes socios vinculante. PICK1 interactúa con la terminal C de los receptores AMPA [6, 41] y ha sido implicado en la internalización o la estabilización de las piscinas interior de los receptores AMPA en hipocampo y cerebelo largo plazo la depresión [13, 16, 28, 42]. Pérez et al. [28] sugiere que PICK1 funciones como la orientación y el transporte de proteínas que dirige la forma de activar PKC α para GluR2 en espinas, lo que la actividad que dependen de la liberación de GluR2 sináptica de las proteínas de anclaje y la PICK1 que dependen de transporte de GluR2 de la membrana sináptica [28]. En el presente estudio, sin embargo, demostró que PKC α PICK1 orientados a la membrana, y que este transporte se produjo a través de la fosforilación de PICK1. La unión de PICK1 y PKC α parece ser transitoria, ya que PICK1 se separó de PKC α después de la fosforilación por PKC α.

En tiempo real de imágenes puede revelar cuándo y dónde PKC α se une a PICK1. Sin embargo, como TPA inducida por el lento y simultánea translocación de PKC α y PICK1 de citosol a la membrana, es difícil determinar si la unión de PKC α con PICK1 precede a su translocación a la membrana plasmática, o si la translocación precede a su obligatoriedad. Por lo tanto, hemos examinado la diferencia temporal entre las translocaciones de PKC α y PICK1 después de la UTP con la estimulación inducida por el que la membrana transitoria translocación de PKC α (Fig. 3]. UTP trasladadas α PKC antes de PICK1 y PKC α posteriormente fue liberado de la membrana plasmática antes de PICK1, lo que sugiere que UTP induce la activación y translocación de PKC α, la unión de la PKC α activado con PICK1, la fosforilación de PICK1, y, por último, la disociación de PICK1 de PKC α. Aunque la activación de PKC α es necesaria para PICK1 a translocate a la membrana plasmática, como se muestra en la Figura 2, la unión de PKC α PICK1 para no continuar durante la localización de PICK1 en la membrana plasmática. Figura 4 puso de manifiesto que una vez fue PICK1 trasladadas a la membrana plasmática, su interacción con PKC α ya no era necesaria para la localización de membrana PICK1. Es posible que la fosforilación de PICK1 de PKC α es responsable de la asociación de PICK1 desconocido con proteínas de la membrana plasmática, como los receptores. Pero una vez PICK1 está anclado a la membrana, la unión a PKC α ya no es necesaria para la PICK1 y no encuadernado PICK1 puede regular los receptores / transportadores en la membrana.

Esta obra fue financiada en parte por el siglo 21 Centro de Excelencia del Programa del Ministerio de Educación, Cultura, Deportes, Ciencia y Tecnología de Japón, las subvenciones del Ministerio de Educación, Cultura, Deportes, Ciencia y Tecnología de Japón, y subvenciones para la investigación científica en áreas prioritarias "Molecular Brain Science".