Genetic Vaccines and Therapy, 2007; 5: 1-1 (más artículos en esta revista)

Lentiviral mediada por la corrección de genes de mucopolisacaridosis tipo III

BioMed Central
Donald S Anson (donald.anson @ adelaide.edu.au) [1], Chantelle McIntyre (chantelle.mcintyre @ adelaide.edu.au) [1], Belinda Thomas (belinda.thomas @ southernhealth.org.au) [1 ], Rachel Koldej (rachel.koldej @ adelaide.edu.au) [1], Enzo Ranieri (enzo.ranieri @ adelaide.edu.au) [1], Ainslie Roberts (ainslie.roberts @ adelaide.edu.au) [ 1], Peter R Clements (peter.clements @ adelaide.edu.au) [1], Kylie Dunning (kylie.dunning @ adelaide.edu.au) [1], Sharon Byers (sharon.byers @ adelaide.edu.au ) [1]
[1] Departamento de Genética Medicina de la Mujer y el Hospital de Niños, Niños, Jóvenes y Salud de la Mujer de servicios, 72 King William Road, North Adelaide, SA 5006, Australia
[2] Departamento de Pediatría, Universidad de Adelaida, SA 5005, Australia
[3] Departamento de Biotecnología, Flinders University, GPO Box 2100, Adelaide, SA 5001, Australia
[4] Facultad de Farmacia y Ciencias Médicas, Universidad del Sur de Australia, GPO Box 2471, Adelaide, SA 5001, Australia
[5] Departamento de Respiratoria y Medicina del Sueño, Monash Medical Centre, VIC 3168, Australia
[6] Departamento de Obstetricia y Ginecología, Universidad de Adelaida, SA 5005, Australia

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

Mucopolisacaridosis tipo III (MPS III A) es el más común de la mucopolysaccharidoses. La enfermedad es causada por una deficiencia de las enzimas lisosomales sulphamidase y los resultados en el almacenamiento de los glucosaminoglucanos (GAG), heparán sulfato. MPS III se caracteriza por la generalización de almacenamiento y excreción urinaria de heparán sulfato, y una progresiva y, finalmente, neurológico profundo. La terapia génica es una de las pocas vías de tratamiento que sostienen la promesa de un tratamiento sostenible de este trastorno.

Métodos

El gen murino sulphamidase cDNA fue clonado en un vector lentiviral y de alto título de virus producidos. MPS IIIA Humanos fibroblastos culturas se transduced con la sulphamidase vector y analizaron mediante moleculares, enzimáticos y metabólicos ensayos. De alto valor virus fue inyectado por vía intravenosa en seis de 5 semanas de edad MPS IIIA ratones. Tres de estos ratones fueron pre-tratados con hyperosmotic manitol. El peso de los animales y se vigila el contenido de GAG en muestras de orina fue analizada por electroforesis en gel de poliacrilamida.

Resultados

Transducción de cultivos de fibroblastos MPS IIIA con el gen corregido sulphamidase tanto el metabolismo enzimático y defectos. Sulphamidase gen secretada por las células corregido fue capaz de cruzar correcta untransduced MPS IIIA células. GAG urinaria resultó ser reducido en gran medida en las muestras procedentes de ratones que reciben el vector no tratados en comparación con los controles MPS IIIA. Además, el peso de los ratones tratados se convirtió en normalizarse progresivamente durante los 6 meses post-tratamiento.

Conclusión

Lentiviral vectores parecen prometedores vehículos para el desarrollo de la terapia génica para MPS IIIA.

Fondo

El mucopolysaccharidoses (MPS) son un grupo de trastornos lisosomales de almacenamiento que se derivan de deficiencias en el catabolismo de glicosaminoglicanos (GAG) [1]. En la actualidad hay once conocida MPS, cada uno de ellos como consecuencia de la deficiencia de una enzima diferente lisosomales. De la MPS, MPS IIIA (síndrome de Sanfillipo A) es uno de los más comunes, y en lo que respecta a tratamiento va, uno de los más difíciles, en que el sistema nervioso central (CNS) patología es fundamental [1]. Muy pacientes afectados suelen presentar de 2-3 años de edad con una serie de síntomas relacionados con la patología CNS. Estos síntomas incluyen retraso en el desarrollo, hiperactividad, comportamiento agresivo, y trastornos del sueño. Otros síntomas incluyen diarrea y el hirsutismo. Las manifestaciones somáticas de la enfermedad, que incluyen la patología ósea, hepatoesplenomegalia y rigidez en las articulaciones, generalmente son leves y son más comunes en los pacientes de mayor edad. MPS IIIA el resultado de una determinada genéticamente deficiencia de sulphamidase, lisosomales una enzima que normalmente cataliza la división de N-vinculada de sulfato de glucosamina residuos a la no reducción de terminal de heparán sulfato. Como esto representa un paso obligatorio en la degradación del heparán sulfato, elevación de los niveles de heparán sulfato de fragmentos se encuentran en los tejidos y en la orina. MPS IIIA también resultados en la secundaria de almacenamiento de GM2 y GM3 gangliósidos en el SNC.

MPS IIIA representa un paradigma útil para las terapias encaminadas a tratar la patología generalizada que se encuentra en muchas de las MPS. La disponibilidad de los pequeños (ratón) [2] y las grandes (perro) [3, 4] modelos animales de MPS IIIA proporciona una útil experimental de recursos para el desarrollo preclínico y el ensayo de terapias.

La MPS III ratón [2], el resultado de una mutación espontánea, muestra muchas de las características patológicas progresiva encuentran en la enfermedad humana. De 6-7 meses de edad afectado notablemente los ratones son menos activas, desarrollar una apariencia scruffy, hunched postura y distensión abdominal, y se acorta la vida útil. Los animales muestran niveles elevados de orina de GAG, que es predominantemente heparán sulfato, sulphamidase disminuido en gran medida la actividad en todos los tejidos, normal o supranormal los niveles de otras enzimas lisosomales y ampliamente distribuido de almacenamiento. MPS IIIA ratones son también significativamente más pesados que las normales. La MPS III del ratón, por lo tanto, proporciona un excelente modelo para el análisis inicial de estrategias de terapia génica para el MPS en general, y MPS IIIA en particular.

Aunque por vía intravenosa la terapia de reemplazo enzimático ha sido desarrollado para una serie de MPS, es evidente que este enfoque no es una opción viable para el tratamiento de la patología CNS debido a su eficaz de particionamiento de la circulación periférica de la barrera hemato-encefálica [5] . Terapias alternativas para MPS CNS patología incluyen las terapias de moléculas pequeñas, destinadas a prevenir la síntesis de almacenamiento de material [6, 7], y la terapia de reemplazo de genes [7]. También está acumulando pruebas de que la barrera hemato-encefálica no es totalmente impermeable a las enzimas lisosomales, y que los altos niveles de enzima en la circulación periférica, ya sea emitido por la terapia de reemplazo enzimático [8], o por medio de terapia génica [9], como resultado la entrega de cantidades importantes (es decir, lo suficientemente elevada como para afectar la patología) de la enzima a la CNS.

Gene terapia de reemplazo tiene evidente potencial para el tratamiento de la MPS [7, 10, 11], incluidos MPS IIIA. Hemos demostrado anteriormente retrovirales mediada por la corrección de genes de cultivos de fibroblastos MPS IIIA [12]. Sin embargo, los retrovirus tienen serias limitaciones [13] que se oponen a su utilización en la entrega de genes a la CNS, y hacer de ellos una utilidad limitada en la transducción de los tejidos in vivo. Con el fin de promover el desarrollo de la terapia génica para MPS IIIA hemos desarrollado un vector lentiviral que expresa el gen murino sulphamidase y demostrado que puede ser utilizado para corregir MPS IIIA células in vitro. Tras la administración intravenosa del vector a MPS IIIA ratones urinaria GAG y el peso de los ratones tratados se convirtió en normalizarse progresivamente durante los 6 meses siguientes a la administración de vectores.

Materiales y métodos
PCR

Los primers utilizados para la amplificación del gen murino sulphamidase se msulatg (GGGCCCATCGATGCCACC ATGCACTGCCCGGGACTGGCCTG); msulbglr (GAGGGTCGTAGATCTGGGGTGTCC); msulbglf (GGACACCCCAGATCTACGACCCTC) y msultga (GGGCCCGAATTC TCAGAGTTCATTGTGAAGCGGTC). Secuencias homólogas al gen murino sulphamidase secuencia se muestran en cursiva. La reacción de condiciones para todos los PCR fueron de 94 ° C, 30 segundos, 60 ° C, 20 segundos y 68 ° C, 1 minuto durante 20 ciclos y se utiliza la Expandir sistema de alta fidelidad (Roche). Primer capítulo de cDNA a partir de células NIH3T3 (ATCC CRL-1658) fue utilizado como plantilla. Un fragmento de 648 pb correspondiente a los 5 'parte de la murino sulphamidase cDNA secuencia fue amplificado con los primers msulatg y msulbglr, clonado y como Cla I / Bg LII fragmento en pSP70 (Progen). Un fragmento de 872 pb correspondiente a la 3 'parte de la secuencia fue amplificado con los primers msulbglf y msultga y clonados como BGL II / Eco RI fragmento, una vez más en pSP70.

Lentiviral Vector

El vector lentiviral utilizada en este estudio es esencialmente la misma que la pAF2 Δ-SE vector [14], salvo que el promotor SV40 temprano fue sustituido por el murino cinasa phosphoglycerate promotor del gen de MSCVpac [15] para dar pHIV-1pgkEYFP

El virus de la producción

La producción y purificación de los virus utilizados en este trabajo ha sido descrito en otras partes [16]. El virus fue resuspendido en 0,9% (w / v) NaCl, y se cuantifica por p24 ELISA (NEN-Dupont). Virus para la administración in vivo ha demostrado ser negativos para la replicación del virus competentes [14].

Cultivo celular, la transducción, enzimáticos y metabólicos y análisis

Normal y MPS IIIA fibroblastos de piel humana se chapada en 6 platos y bien crecido hasta confluentes en DMEM/10% (v / v) FCS (2 ml por pocillo). El medio fue entonces atmosféricos y las células alimentadas con 1,5 mL de DMEM/10% (v / v) FCS contiene 8 μ g / mL polybrene. MPS IIIA células fueron entonces transduced con vector de 24 horas. El medio fue canjeado por el medio de cultivo. Para el análisis, se intercambió medio de Ham's F12/10% (v / v) FCS, y después de 4 horas, la media se intercambiaron de nuevo por la F12/10 Ham% (v / v) FCS con 10 μ Ci / ml 35 SO 4, un otras 24 horas más tarde la etiqueta fue removido y las células alimentadas con DMEM/10% (v / v) FCS. Para evaluar enzimática cruz-corrección, etiquetados MPS IIIA células fueron expuestas a la media obtenida de lentivirus-transduced celdas durante 24 horas. Para el análisis de almacenamiento, las células se cosecharon 72 horas después de etiquetado y lisados celulares preparado por congelación / descongelación en 20 mM Tris-HCl, pH 7,0, 500 mM NaCl. Los lisados celulares fueron aclarados por microcentrifugation (13000 g, 5 minutos) y los sobrenadantes ensayadas para sulphamidase [17] y β-hexoaminidasa [18] actividad, el total de proteína S y 35 cpm. Los pellets resultantes de la microcentrifugation de la congelación / descongelación lisados celulares fueron usados para preparar el ADN genómico utilizando la SV Promega Wizard Genomic DNA kit.

PCR en tiempo real de análisis

Vector secuencias fueron detectados en el ADN genómico mediante un ensayo TaqMan para amordazar las secuencias de genes presentes en el vector (Adelante primer 5 'AGCTAGAACGATTCGCAGTTGAT 3', primer invertir 5 'CCAGTATTTGTCTACAGCCTTCTGA 3', la sonda 5 'CCTGGCCTGTTAGAAAC 3' con FAM / NFQ reportero). Los resultados fueron normalizados utilizando un solo ejemplar en la secuencia de genes de transferrina (Adelante primer 5 'AAGCAGCCAAATTAGCATGTTGAC 3', primer invertir 5 'GGTCTGATTCTCTGTTTAGCTGACA 3', la sonda 5 'CTGGCCTGAGCTCCT 3' con FAM / NFQ reportero). Los ensayos se realizaron bajo condiciones estándar y el uso de Applied Biosystems TaqMan PCR Universal Master Mix. ADN de un A549 derivados línea celular, y que contiene una única copia del vector lentiviral, fue utilizado para proporcionar una norma absoluta de número de copias. En tiempo real PCR se realizó en un termociclador ABI 7300 y analizados mediante el software de detección de Secuencia v1.2.2 (Applied Biosystems). Todas las muestras fueron analizadas por triplicado.

El tratamiento de MPS IIIA ratones

La MPS III ratón colonia se estableció originalmente prevista de los ratones por el doctor Stanley P. (Instituto Albert Einstein College de Medicina, Nueva York). Los ratones fueron alojados en el Instituto de la Mujer y el Hospital de Niños de animales al servicio del cuidado de mantenimiento general en que fue proporcionada por el cuidado de los animales entrenados personal. MPS IIIA y ratones normales se genotipo por PCR utilizando los métodos establecidos previamente [19]. Seis de 5 semanas de edad de sexo masculino MPS IIIA ratones fueron inyectados con 50 μ g p24 equivalente del vector lentiviral a través de inyección en la vena de cola. Tres ratones fueron pre-tratados con inyección intravenosa de hyperosmotic manitol (200 μ l de 25% (w / v) en solución salina manitol) 5 minutos antes de la administración del vector en un intento de lograr vector entrega a la CNS.

Análisis de orina de GAG

Las muestras de orina del ratón se incubaron durante una hora a 37 ° C con dos volúmenes de 0,1% de cloruro de cetylpyridinium en 0,054 M Na 3 citrato (pH 4.8). Las muestras fueron centrifugadas durante 10 minutos a 3000 rpm y "pellets" se resuspendido en 150 μ L 2 M LiCl. Tras adición de 800 μ l de etanol absoluto, las muestras fueron incubadas a -20 ° C durante una hora y luego se centrifuga durante 10 minutos a 3000 rpm. "Pellets" se resuspendido en 200 μ l de agua, liofilizado y, a continuación, resuspendido en 20 μ l de agua.

Purificada glucosaminoglucanos muestras (0,2 μ mol creatinina equivalentes) se analizaron en el 40-50% gradiente lineal geles de poliacrilamida tal como está descrita anteriormente [20].

El análisis estadístico

A excepción de los datos de peso, los resultados se analizaron mediante ANOVA de una manera / SNK [21].

Mouse pesos fueron analizadas por comparación de los no-lineal de las tendencias para cada grupo. En primer lugar, la relación entre peso corporal y la edad de cada grupo se utiliza un modelo de suavización spline cúbicos. Modelización utilizando diferentes no lineales, las tendencias de cada grupo se comparó con los modelos utilizando la misma no tendencia lineal para todos los grupos y el registro de valores de probabilidad para determinar la significación. Cuando se encontró significación predicción se calcularon los intervalos de splines para determinar la edad en que los grupos fueron significativamente diferentes. En los intervalos de edad en que predice los valores de un grupo no se superponían las previsiones para el intervalo de otro grupo de los grupos de tratamiento que se comparan se tomaron como siendo significativamente diferente (p <0,001).

Resultados
Aislamiento de la murino sulphamidase secuencia de cDNA y la construcción de lentiviral vectores transducing murino sulphamidase

El murino sulphamidase cDNA secuencia fue amplificado por PCR dos partes, tal como se describe en Material y métodos. El 5 'del primer utilizado para amplificar los 5' parte de la secuencia fue diseñada para introducir un consenso Kozak secuencia inmediatamente anterior a la apertura codón. Secuenciación del ADN se utilizó para confirmar la ausencia de errores inducidos por PCR. Los dos fragmentos fueron luego se unió a través de la común BGL II sitio para generar una secuencia completa. La secuencia completa fue clonado en el pHIV-1pgk vector situándolo en el marco del control transcripcional del promotor pgk (Fig. 1]. El resultado fue designado construir pHIV-1pgk msulp

Corrección de MPS IIIA fibroblastos de piel, el análisis metabólico

MPS IIIA fibroblastos de piel se transduced con 68, 167 o 508 ng p24 equivalente de la pHIV-1pgk msulph así por vector (6-así placa), tal como se describe en Material y métodos. Etiquetado con 35 SO 4 demostrado que todos los vectores transduced células metabólicamente normalizado (Fig. 2], al igual que las células expuestas a medio recogidos a partir de células transduced con 508 ng p24 equivalente de vector (Fig. 2]. Este medio figuran 16 pmol / min / ml de sulphamidase actividad. Medio condicionado de control MPS IIIA células no contienen sulphamidase actividad detectable. En todos los casos de almacenamiento fue significativamente diferente de control MPS IIIA células (P <0,01) y no significativamente diferente de las células normales de control (P> 0,05).

Corrección de MPS IIIA fibroblastos de piel, análisis enzimáticos

El análisis de los niveles de actividad sulphamidase (Fig. 3] mostró que el nivel de reemplazo enzimático con el aumento de cantidades cada vez mayores de vector añadido, con los dos mayores cantidades de manera efectiva la normalización de los niveles de enzimas. En comparación con untransduced MPS IIIA células, el aumento de la actividad con la menor cantidad de virus (68 ng p24) fue insignificante, mientras que el aumento de la actividad sulphamidase con los dos más grandes cantidades de virus (167 y 508 ng p24) fue significativa (P <0,01). La corrección en la actividad enzimática en las culturas transduced con 167 ng de vector p24 no fue significativamente diferente del nivel encontrado en las células normales (P> 0,05), mientras que la actividad enzimática resultante de transducción con 508 ng de vector p24 fue significativamente mayor (P <0,05) que en las células normales de control. β-hexoaminidasa no fue significativamente diferente en ninguna de las muestras (P> 0,05). En la cruz de corrección de los experimentos, sulphamidase actividad en las células expuestas a medio condicionado de células transduced no era detectable por encima de fondo.

Corrección de MPS IIIA fibroblastos de piel, PCR en tiempo real de análisis

PCR en tiempo real el análisis de muestras de ADN de fibroblastos transduced reveló el vector número de copias a ser proporcional (R 2 = 0,99) a la dosis de virus utilizado (Fig. 4]. El número de copias varía de 0,3 copias / celular (68 ng p24 dosis) a 1,7 copias / celular (508 ng p24 dosis). No vector se detectó en un transduced de células o células expuestas a medio condicionado transduced recogida de las células. Enzimas de expresión es proporcional (R 2 = 0,90) para el virus de la dosis (Fig. 4], y, por ende, también al vector número de copias (R 2 = 0,95).

En vivo administración de vectores, análisis de orina de GAG y el peso corporal

Seis 5 semanas de edad MPS IIIA ratones (animales # s 2, 3, 7, 94, 98 y 99) se inyecta por vía intravenosa con el vector, tal como se describe en Material y métodos. Tres de estos ratones (n º s 2, 3 y 7) también recibió hyperosmotic manitol inmediatamente antes de la administración del vector. En varias ocasiones después del tratamiento se recogió la orina, GAG purificado por el CPC precipitación y analizada por gradiente-PAGE, tal como se describe en Material y métodos. Los resultados de este análisis muestran que hay una gran y constante reducción en la orina de GAG a la normalidad, o cerca de los niveles normales, en los animales tratados (Fig. 5]. Comparación de las muestras tomadas de distintos animales en diferentes puntos temporales sugieren que la reducción en la orina de GAG se hace más marcado después de un período más largo de tratamiento (por ejemplo, los animales 2, 122 días frente a 54 días después del tratamiento).

En el momento del tratamiento todos los animales mostraron el aumento de peso típico de MPS IIIA ratones afectados. Sin embargo, durante los 6 meses de periodo de tratamiento de su peso progresivamente hacia una tendencia normal y se convirtió más cerca de la gama normal que a la gama visto en ratones no tratados (Fig. 6]. No hay diferencia en el crecimiento se observó entre los ratones dado hyperosmotic manitol antes del tratamiento y los que no son (datos no presentados). En consecuencia, los ratones tratados se analizaron como un grupo. El análisis estadístico demostró que el peso de los ratones tratados fue significativamente diferente de la de los ratones no tratados después de 54 días de edad (17-22 días post-tratamiento), y no significativamente diferente de la edad normal después de 166 días (18.5-19 semanas post-tratamiento) .

Discusión

Gene terapia de reemplazo para el MPS tiene varias ventajas potenciales sobre la terapia de reemplazo enzimático, el actual estándar de oro para el tratamiento siempre que estén disponibles. Estos incluyen una reducción de la frecuencia de trato, una mejor eficacia y la perspectiva de poder para tratar la enfermedad de CNS mediante la introducción de vectores de genes directamente en el SNC. Hasta hace poco, el desarrollo de la terapia génica para el MPS ha fracasado por la falta de adecuados sistemas vectores de genes. En general, los vectores de integración es el instrumento más conveniente para trastornos metabólicos heredados como el MPS, ya que confiere estabilidad genética en las transduced genes y, por ende, el potencial de efectos a largo plazo. Debido a esto, los vectores retrovirales han sido durante mucho tiempo el gen de entrega del vehículo de elección. Sin embargo, los vectores derivados de oncogénico vectores retrovirales son incapaces de transduce no ciclismo células [13], limitando seriamente su utilidad. Por este motivo, y otros, han desarrollado vectores lentiviral [14, 22 - 25]. Estos tienen en general los atributos positivos de vectores retrovirales con la característica adicional de ser capaz de no transduce las células de la bicicleta, lo que significa que tienen una gran utilidad para in vivo de genes de entrega. Esto ha llevado a la utilización de vectores lentiviral en el desarrollo de la terapia génica para una serie de enfermedades, incluyendo el MPS [26 - 29].

En este estudio hemos construido un vector lentiviral y demostró la prueba de principio experimentos in vitro. Las células humanas se han utilizado para estos experimentos simplemente por conveniencia, sino que fueron inmediatamente disponible, mientras que las culturas y de control MPS IIIA murino fibroblastos no lo eran. Lentiviral mediada por la entrega de genes humanos a MPS IIIA fibroblastos de piel como resultado de la corrección del metabolismo enzimático y defectos exhibidos por estas células, incluso con la dosis más baja de virus utilizado. Además, la completa corrección de los defectos metabólicos en cultivos de células MPS IIIA con el menor número de copias de vector, y el hecho de que medio secretada gen de células corregidas pudo interrogar a corregir el defecto metabólico en no transduced células, demuestra la potencial de la terapia génica pueda afectar a múltiples células, además de los directamente transduced por vector. En la cruz de corrección experimento no fue posible determinar si la enzima es la absorción a través de la manosa-6-fosfato (M6P) receptor, como la corrección metabólica fue visto cuando la enzima se agregó a la presencia o ausencia de M6P (datos no presentados). Además, sulphamidase actividad era demasiado bajo para ser detectado en todas las muestras de la cruz de corrección de la prueba. Esto, al menos en parte, refleja la relativamente baja sensibilidad de la enzima de ensayo, y en parte el relativamente bajo nivel de actividad de la enzima en el medio condicionado utilizado (hacia el bajo nivel de actividad que pueden ser fácilmente detectados).

En el estudio in vitro pgk el promotor parece ser relativamente débil, como el nivel de expresión obtenidos con el vector no fue superior a la que se encuentra en las células normales, lo que sugiere que puede ser útil para evaluar el nivel de expresión de otros promotores. Sin embargo, la utilización de fuertes promotores deben desarrollarse con cautela, ya que aumentan el riesgo de mutagénesis de inserción a través de activación de oncogenes [30].

El desarrollo de un verdadero tiempo de ensayo de PCR para nuestro vector, y el control de línea celular que contiene un solo ejemplar de nuestro vector, serán de utilidad en estudios adicionales, por ejemplo la determinación del vector número de copias en los tejidos in vivo después de la administración. De una cuidadosa selección del vector de secuencias que la PCR en tiempo real detecta que hemos hecho este análisis genérico de modo que detectará todas las versiones de nuestro vector, cualquiera que sea el transgén o secuencia promotora lleva el vector.

Vector se administró a ratones MPS III A, ya sea con o en ausencia de un hyperosmotic manitol tratamiento previo. En los estudios presentados en este documento estos dos grupos de animales no pueden ser distinguidos, por lo tanto, todos los animales se agruparon para su análisis. Administración del vector a MPS IIIA ratones resultó en la normalización parcial de orina de GAG como lo demuestra el análisis de índices de gradiente, lo que supone una primera indicación de la eficacia in vivo. El poder del gradiente PÁGINA sistema [20] es que permite la evaluación específica de los pequeños a gran tamaño libre GAG moléculas (es decir, cuatro a treinta sacárido residuos de longitud) típico de lisosomales de almacenamiento de material, en lugar de pequeños libre GAG (di - a tetra-sacáridos) que pueden ser analizados por espectrometría de masas, o el total (libre y conjugado) GAG medido mediante el análisis de ácido uronic.

El peso de los animales tratados fue también progresivamente normalizado, lo que sugiere que el tratamiento está teniendo un efecto generalizado sobre la enfermedad patología, aunque la actividad enzimática puede no ser detectado en muestras de sangre de los ratones tratados (datos no presentados). Un análisis más detallado de estos animales está en curso y será publicado en otros lugares.

En conclusión, lentiviral vectores parecen ser prometedores reactivos para el desarrollo de una terapia eficaz para MPS IIIA. El trabajo futuro incluirá la entrega en vivo del vector a somáticas y las células CNS y análisis detallado de fenotipo de la enfermedad en los animales tratados.

Agradecimientos

Esta labor fue apoyada por la financiación de Salud Nacional de Australia y el Consejo de Investigación Médica, el Consejo Nacional (EE.UU.) MPS Society, y la Universidad de Adelaida. Nos gustaría dar las gracias a Kate Dowling, Biometrics SA, Universidad de Adelaida, en busca de ayuda con el análisis estadístico de los pesos corporales.