Neural Development, 2007; 2: 4-4 (más artículos en esta revista)

Neurotrophin / TRK media de señalización del receptor de C / EBP α - β y NeuroD a la contratación inmediata de principios de promotores de genes en las células neuronales y requiere C / EBPs para inducir inmediata y principios de la transcripción de genes

BioMed Central
Anna Maria Calella (AnnaMaria.Calella @ usz.ch) [1], Claus Nerlov (nerlov@embl.it) [1], Rodolphe G López (Lopez@embl.it) [1], Carla Sciarretta (sciarretta @ EMBL. es) [1], Oliver von Bohlen und Halbach (oliver.vonbohlen @ arcor.de) [2], Oksana Bereshchenko (bereshchenko@embl.it) [1], Liliana Minichiello (minichiello@embl.it) [1]
[1] Laboratorio Europeo de Biología Molecular, Biología Mouse Unidad, a través de Ramarini, 00016 Monterotondo, Italia
[2] Centro Interdisciplinario de Neurociencias (IZN), el Departamento de neuroanatomía de la Universidad de Heidelberg, Im Neuenheimer Feld, 69120 Heidelberg, Alemania
[3] Hospital Universitario de Zurich, Instituto de Neuropatología, Schmelzbergstrasse, 8091 Zurich, Suiza

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

Extracelular a través de los receptores de señalización para neurotrophins media neuronal diversas funciones, entre ellas la supervivencia, migración y diferenciación en el sistema nervioso central, pero los objetivos transcripcional y los reguladores que median estas diversas funciones neurotrophin no se conocen bien.

Resultados

Hemos identificado los principios inmediatos-(IE) genes Fos, Egr1 y Egr2 transcripcional como objetivos de cerebro factor neurotrófico derivado (BDNF) / TrkB señalización en la enseñanza primaria neuronas corticales, y muestran que la respuesta Fos suero elemento zona responde a BDNF / TrkB en de manera que dependen de una combinación de C / EBP-eBox elemento. El Egr1 y Egr2 promotores contienen elementos reguladores homóloga. Se encontró que C / EBP α y β y NeuroD formado complejos in vitro e in vivo, y se contrató a las tres regiones homólogas promotor. C / EBP α y NeuroD cooperativa activado el promotor Fos en ensayos de transfección. Agotamiento genético de los receptores TRK dado lugar a problemas de reclutamiento de C / EBPs y NeuroD en vivo, y la eliminación de Cebpa y Cebpb alelos reducido BDNF inducción de la Fos, Egr1 y Egr2 primaria en las neuronas. Por último, la diferenciación defectuosa de dendritas corticales, medido por tinción MAP2, se observó en ambos compuestos Cebp y Ntrk ratones knockout.

Conclusión

Estamos aquí identificar tres genes IE como objetivos para BDNF / TrkB señalización, muestran que C / EBP α y - β son reclutados a lo largo de NeuroD con destino a los promotores, y que C / EBPs son esenciales TRK mediadores de señalización en las neuronas corticales. Mostramos también que C / EBPs y Trks son necesarios para la diferenciación cortical dendrita, en consonancia con la regulación de Trks dendríticas a través de una diferenciación C / EBP-dependiente mecanismo. Por último, este estudio indica que la inducción de BDNF IE genes importantes para la función neuronal depende de factores de transcripción (C / EBP, NeuroD) hasta regulado durante el desarrollo neuronal, con lo que el acoplamiento funcional de la competencia células neuronales para su diferenciación.

Fondo

La influencia de los factores de crecimiento, así como factores de transcripción, en células suerte determinación y diferenciación está bien establecida. Brain factor neurotrófico derivado (BDNF) afecta el desarrollo neuronal cortical de la señalización a través de sus afines tirosina quinasa del receptor, TrkB. En conjunto, regular muchas funciones celulares durante y después del desarrollo del sistema nervioso [1 - 4]. En particular, nos han informado de que TrkB, a través de la activación de Ras el / Mitogen activa la proteína quinasa (MAPK) y Phosphatidylinositol-3 kinasa / celular homólogo del oncogén viral v-Akt (PI3K/AKT) vías, regula las funciones de toda la formación de la corteza cerebral, incluida la diferenciación neuronal dendríticas [5]. Aunque varios factores de transcripción se han encontrado para responder a la activación de TrkB y otros TRK familia de receptores, no se entiende muy bien cómo TRK señalización interactúa con los factores de transcripción que regulan la diferenciación neuronal para activar los genes específicos necesarios durante las distintas fases de desarrollo neuronal y, posteriormente, en función neuronal.

La base neurogénica hélice-loop-hélice (bHLH) factores de transcripción han demostrado ser importantes intrínsecas neuronales reguladores de suerte determinación y diferenciación. Hay por lo menos dos categorías de factores de transcripción bHLH que median la neurogénesis: proneural bHLHs (Neurogenins Triture la familia y las proteínas), en el que están implicados en la iniciación de neurogénesis, diferenciación neuronal y factores (los miembros de NeuroD / NEX familia), que son importantes para la terminal diferenciación. Los estudios en ratones que carecen de NeuroD / NEX miembros de la familia indican que se han visto obligados no sólo para la supervivencia de los principios de diferenciación gránulo neuronas en el hipocampo y cerebelo, sino también por su diferenciación terminal [6, 7]. En concreto, NeuroD selectivamente promueve dendrita, pero no axonal, la morfogénesis en gránulo neuronas a través de su fosforilación en distintos sitios de CamKII [8]. Estos factores forman heterodimers doquier con bHLH proteínas expresadas, como E12 y E47, y activar la expresión génica a través de programas de interacción, a través de su base de dominio, con las secuencias de ADN que contiene el núcleo hexanucleotide motivo CANNTG, conocido como el eBox [9, 10]. Todavía es desconocido que las señales extracelulares o intracelulares mecanismos están implicados en la regulación de la función bHLH factor.

El CCAAT / potenciador de la proteína de unión (C / EBP) la familia de factores de transcripción parejas del factor de crecimiento de transducción de señales celulares con numerosas respuestas, incluyendo la diferenciación celular en una variedad de no-tejidos neuronales [11, 12]. La expresión de C / EBPs También se ha encontrado a cambiar durante una serie de fisiológicos y fisiopatológicos condiciones en respuesta a señales extracelulares, tales como hormonas, mitogens, y citoquinas [12]. Recientemente, un Mitogen y extracelular señal quinasa regulada (MEK) -C/EBP cascada de señalización que ha sido implicada en el compromiso de células progenitoras neuronales hacia un destino in vitro a través de la inhibición de MEK o bien C / EBPs utilizando las formas dominantes negativos [13] . Paquin et al. [14], utilizando la electroporación en el útero de manipular cortical precursores, han sugerido que la MEK mediada por fosforilación de C / EBPs es esencial para determinar el destino neuronal. Hasta el momento, sin embargo, ningún modelo genético ha demostrado un efecto de MEK1 / 2 o C / EBPs en linaje compromiso neuronal o diferenciación.

Estamos aquí identificar Fos, Egr1 y Egr2 como los genes que son regulados por BDNF / TrkB en C / EBP-dependientes. Identificamos una novela compleja entre C / EBP α y β y NeuroD, y encontrar que en vivo, estos factores son reclutados a la Fos, Egr1 y Egr2 promotores en un TRK-dependientes. Genéticos C / EBP agotamiento lleva a una cortical dendríticas diferenciación neuronal defecto, que recuerda a la observada en la ausencia de múltiples TrkB / C alelos, en consonancia con la idea de que TRK señalización a través de C / EBP-NeuroD complejos media terminal neuronal cortical diferenciación in vivo.

Resultados
BDNF induce Egr1, Egr2 Fos y expresión en la enseñanza primaria neuronas corticales

Para identificar los genes regulados por BDNF señalización a través de TrkB en las células neuronales, las neuronas corticales primarios derivados de E15.5 embrionarias forebrain (neurogénesis cuando se encuentra en su pico) fueron estimuladas con BDNF y su expresión génica en comparación con la de control no tratado culturas de análisis de microarrays. Entre los más altamente regulados los genes de un grupo de codificación de principios inmediatos (IE) factores de transcripción que consistía en Egr1, Egr2 y Fos. Para los tres se constató que la inducción de BDNF se redujo cuando el sitio de unión para el adaptador en situación especialmente difícil en el receptor TrkB se mutado (por esta cepa de ratón ver [5, 15], y Materiales y métodos), de conformidad con una reglamentación común mecanismo subyacente su upregulation (Figura 1a]. El sitio en situación especialmente difícil que dependen de la inducción de estos genes fue confirmada por cuantitativos de PCR en tiempo real (QRT-PCR) (Figura 1b-d].

Un combinado C / EBP sitio-E-box media Fos inducción de BDNF

Con el fin de identificar el mecanismo de transcripción que induce BDNF IE transcripción de genes que inicialmente estableció que la construcción de un reportero llevar 700 pares de bases (pb) de la Fos promotor fue inducido por BDNF cuando transfectadas transitoriamente en las culturas primarias de neuronas corticales (figura 2a] . A continuación analizaron la función de la superficie de la Fos promotor en torno a la respuesta elemento suero (SRE), ya que este es el más altamente conservadas por parte del promotor proximal Fos. La SRE zona contiene la superposición de sitios de unión para el factor de respuesta a suero (SRF), C / EBP, E-proteínas y la activación de la proteína-1 (AP-1) / activación de factor de transcripción (ATF). Transfección transitoria de análisis, la mutación simultánea de eBox y el C / EBP sitio (véase la figura complementaria 1 en archivo de datos adicionales 1 y Adicional de los materiales y métodos adicionales en el archivo de datos 2 para el análisis) se encontraron significativamente a disminuir la inducción promotor de BDNF (Figura 2b]. Se determinó que ambas Cebpa y Cebpb, así como Neurod (codificación de la proteína de eBox Beta2/NeuroD), se upregulated en neuroblasts cultivadas en condiciones de diferenciación neuronal (Figura 3a-d], y que C / EBP α y NeuroD cooperado en Fos promotor de activación , En una forma dependiente de la presencia de sus afines sitios de unión, en una línea celular heteróloga no expresar estas proteínas (Figura 3e]. Aquí hay que hacer notar que otros C / EBP α y NeuroD sitios pueden estar presentes en el promotor o en el vector columna vertebral, proporcionando residual después de la activación de la mutación identificada C / EBP α y NeuroD sitios.

C / EBPs y NeuroD son reclutados para IE promotores de genes in vivo

Secuencia alineación identificado homologías Fos a la SRE en la zona Egr1 y Egr2 promotores (suplemento Figura 2 adicionales en archivo de datos 1]. Para entender si estas regiones homólogas promotor obligado C / EBPs y NeuroD en las células neuronales in vivo, cromatina immunoprecipitation (CHIP) se realizó un análisis sobre forebrains embrionarias. Se ha demostrado que C / EBP α, C / EBP β y NeuroD estaban todos presentes en las tres regiones homólogas promotor (figura 4a, c, d, f-h]. Como control de la especificidad del chip, un análisis similar se realizó en dos secuencias no relacionadas derivados de la Fos 3 'no traducidas región (UTR) y Egr1 exón 4; estas regiones no mostraron detectable vinculante de C / EBPs o NeuroD, mientras que los anticuerpos contra histona 3 (H3) y acetil-H3 (Ac-H3) fueron capaces de precipitar estas amplicones, lo que confirma la calidad de la cromatina de entrada (Figura 4 ter, e].

C / EBPs BDNF mediar la inducción de genes IE en la enseñanza primaria neuronas corticales

El análisis anterior mostró que la Fos, Egr1 y Egr2 promotores contienen secuencias homólogas de reglamentación, y que los tres contratar C / EBP α - β y NeuroD. Para determinar si C / EBPs desempeñar un papel directo en el BDNF regulación de estos genes, cultivadas primaria neuronas corticales de ratones con dos o tres alelos null de la Cebpa y Cebpb genes (Figura 5a-c); inactivación de los cuatro y Cebpa Cebpb alelos de embriones conduce a la letalidad en E10.5 [16]. Este análisis demostró que una disminución significativa en la expresión después de BDNF estimulación se observó ya en Cebpa + / - Cebpb + / - las células, mientras que más pérdidas de un nuevo alelo (Cebpa + / - Cebpb - / - o Cebpa - / - Cebpb + / -- Células) dio lugar a una nueva reducción, lo que resulta en la pérdida de 70% a 90% de la BDNF inducida por el nivel de la expresión génica. Esto no fue debido a la pérdida de BDNF / TrkB de señalización, como BDNF mediada por la inducción de la vía MAPK (según lo medido por fosforilación de p42/p44 MAPK) y la vía PI3K/AKT (medido como la fosforilación de AKT) no se vieron afectados por la pérdida de Cebpa y Cebpb alelos (Figura 5d].

TRK regula la señalización promotor de contratación

Debido a los resultados obtenidos son consistentes con TRK receptor de señalización que regulan tanto la contratación o la actividad de C / EBP y NeuroD factores de transcripción objetivo a los promotores. Los principales receptores TRK expresada en el desarrollo del sistema nervioso central (SNC) son TrkB y TrkC, que funcionan en una forma redundante en la promoción de la supervivencia neuronal durante el desarrollo CNS [17]. Para abordar el papel de TRK señalización en la C / EBP y NeuroD promotor de contratación chip hemos realizado experimentos en los recién nacidos forebrains de ratones que carecen de TrkB y un alelo del gen que codifica TrkC (Ntrk2 - / - Ntrk3 + / - ratones), con lo que la reducción sustancial nivel de neurotrophin / TRK señalización en el desarrollo de la CNS. Estos experimentos mostraron que la cantidad de C / EBPs y NeuroD presentes en la Fos, Egr1 y Egr2 promotores fue significativamente menor en forebrains TRK señalización donde se redujo en comparación con el de tipo salvaje forebrain (Figura 6a-c] o el ratón forebrain faltan sólo TrkB ( que mostró un fenotipo intermedio, los datos no se muestra), mientras que el chip de H3 (a control de calidad de la cromatina) no mostraron ninguna diferencia (Figura 6d]. Es importante destacar que la expresión de Cebpa, Cebpb y Neurod, medido por QRT-PCR, no fue afectado por la reducción de señalización del receptor TRK (Figura 6e].

C / EBP α y NeuroD forma un complejo in vitro e in vivo

Si bien el promotor Fos contiene consenso vinculante para ambos sitios C / EBP y eBox proteínas, un consenso eBox canónica no está presente en la Egr1 o Egr2 SRE regiones de homología. Esto, junto con la correlación observada entre C / EBP y NeuroD promotor de contratación, sugiere que los dos factores son reclutados como un complejo afines a través de un sitio de unión de uno de los dos (más probable una relación C / EBP). Para determinar si C / EBP α y NeuroD fueron capaces de asociar que co-Q2bn células transfectadas con vectores de expresión para BANDERA-etiquetados C / EBP α-Myc y NeuroD etiquetados y se lleva a cabo co-immopreciptiation análisis. Esto demostró que Myc-NeuroD fue eficiente co-precipitado con FLAG-C/EBP α, lo que demuestra que los dos factores son capaces de formar un complejo (Figura 7]. Para abordar la cuestión de si tal existe un complejo en condiciones fisiológicas en las células neuronales se utilizó una cepa del ratón en el que un tándem de purificación de afinidad (TAP) etiqueta [18], ha sido fusionado con el carboxilo terminal de C / EBP α. El PAT-etiqueta contiene una inmunoglobulina (Ig) vinculante dominio de S. aureus proteína A, que permite que la etiqueta de forma selectiva las proteínas se unen a un conejo IgG-matriz de agarosa. De este modo, los extractos nucleares de E16.5 forebrain (un momento momento en que la forebrain se enriquece en las células neuronales) de ratones heterocigotos para el alelo Cebpa TAP (Cebpa T / + ratones) y de tipo salvaje controles fueron objeto de IgG de agarosa pull - y conserva las proteínas se analizaron para detectar la presencia de NeuroD de Western Blot. Como era de esperar, el PAT de etiquetado C / EBP α isoformas Estuvieron presentes en el menú desplegable de Cebpa T / + lisados (Figura 7b, panel inferior). Hemos observado que NeuroD fue también retenida selectiva de IgG de agarosa en Cebpa T / + lisados (Figura 7b, panel superior), lo que indica una compleja formación con C / EBP α in vivo. Si bien estos resultados son plenamente compatibles con la existencia de C / EBP α-NeuroD complejos en forebrain neuronas, que no podía excluir que esos complejos formados después de la lisis. Por lo tanto, las células transfectadas Q2bn por separado con FLAG-C/EBP α-Myc y NeuroD vectores de expresión y mixtos lisados de estas células antes de co-immunoprecipitation. Esto no se ha traducido en la formación de complejos detectable, mientras que C / EBP α-NeuroD complejos son fácilmente detectables en Q2bn lisados de células cotransfected con los dos vectores de expresión (Figura 7c]. Por último, para abordar la cuestión de si la C / EBP α-NeuroD interacción directa que se realizó glutation S-transferasa (GST), pull-downs usando C / EBP α-GST fusiones de las conservadas carboxi-terminal bzip o amino-terminal transactivation dominio ( TAD) e in vitro traducido NeuroD. De ellos, NeuroD fuertemente asociados con la C / EBP α y bzip sólo débilmente con el TAD. En consonancia con el alto grado de conservación de la bzip dominio entre C / EBP isoformas, una fusión GST de la C / EBP β bzip región también fue capaz de derribar NeuroD (Figura 7d]. En conjunto, estos resultados muestran que NeuroD pueden interactuar con C / EBPs conservado a través de sus bzip región. Desde C / EBP α-NeuroD complejos pueden ser aisladas en ambos transfectadas forebrain células y sugiere que estas moléculas son co-expresados e interactuar en las neuronas.

C / EBP agotamiento defectuoso conduce a la diferenciación cortical dendríticas in vivo

A continuación se dirigió a la función de C / EBPs en el desarrollo neuronal. Los ratones que carecen de C / EBP α mueren al nacer [19], junto Cebpa y Cebpb null alelos son embriones letal, y los ratones que transportaba a tres Cebpa y Cebpb alelos null mueren al nacer [16]. Por lo tanto, para facilitar el análisis se utilizó condicional inactivación del gen Cebpa utilizando un floxed Cebpa alelo (lx Cebpa alelo [20]] y un Nestin-Cre transgén (NesCre [5]], y los ratones homocigotos para el alelo nulo Cebpb. Southern blot análisis mostró que NesCre recombinación de los Cebpa lx alelo era prácticamente completo en el SNC postnatal en el día 0 (P0; suplementario la figura 3 del archivo de datos adicional 1]. Por otra parte, como la co-expresión de Cebpa / b en las neuronas sugirió que podría funcionar en una forma redundante, también combina las dos mutaciones. En este caso, el doble mutante (Cebpa lx / lx; Cebpb - / -; NesCre TG / +) fallecieron en el momento del nacimiento, mientras que los mutantes llevar hasta tres Cebpa y Cebpb suprimido alelos (Cebpa lx / lx; Cebpb - / +; NesCre TG / +, Y Cebpa lux / l +; Cebpb - / -; NesCre TG / +) son viables y se utilizan en este análisis. El análisis histológico de P0 cortices no mostró defectos morfológicos en cifras brutas o la alteración de las capas corticales a la inactivación de hasta tres Cebpa y Cebpb alelos (Figura 8a-f]. Del mismo modo, la expresión de marcadores neuronales general NeuN (Figura 8g, h] y β-tubulina III (Tju1; Figura 8i, j] no se redujo incluso en Cebpa lx / lx; Cebpb + / - NesCre TG / + cortices, ni alguna diferencia visto en la expresión del marcador glial ácida glial fibrilar proteína (GFA) (Figura 8k, l]. No en desequilibrio neuronal versus gliales linaje diferenciación, por tanto, fue detectado. Cuando los marcadores específicos de dendritas neuronales (microtúbulos de proteínas asociadas a 2, MAP2) y axones (68 kDa proteína de los neurofilamentos, NF68) se analizaron, MAP2 tinción de dendritas corticales no era disminuido debido a la supresión de dos Cebpa o Cebpb alelos, pero se vio gravemente perturbada en la ausencia de tres alelos (Figura 8m-r]. La cuantificación mostró que la pérdida de tres alelos, además, dio lugar a una disminución significativa en la cantidad de MAP2 presentes en el forebrain (Figura 8s, t); ninguna diferencia en la coloración axonal NF68 (datos no presentados) o importe total de NF68 (Figura 8U, v ) Se observó, indicando la diferenciación intacta axonal. Teniendo en cuenta el reglamento ya se ha informado de MAP2 de NeuroD [21], NeuroD expresión proteica en Cebpa / b deficiente cerebros se investigó y encontró a ser normal (Figura 9a, b]. También se investigó si MAP2 expresión es regulada por el momento de la pérdida de Cebpa / b, lo que se encontró a no ser el caso, como MAP2 expresión mRNA en el nivel no fue afectada (Figura 9c]. Por lo tanto, proponemos que la reducción observada en la proteína MAP2 es debido a la pérdida de MAP2 que contienen estructuras dendríticas. Otra posibilidad podría ser defectuoso mRNA localización y traducción, lo que redujo la acumulación de proteína MAP2.

La posibilidad es que las diferencias observadas en dendríticas diferenciación se refleja un retraso en el desarrollo, en lugar de un defecto. Por lo tanto, realizan análisis similares con 12 semanas de edad, los ratones. También en este caso, capas corticales (según lo determinado por cresil violeta manchas; Figura 10 bis, b] y neuronal números (ensayados de NeuN inmunoticción; Figura 10c, d] no se vieron afectados. Immunoblotting confirmado niveles equivalentes de NeuN (Figura 10e, f], β-tubulina III (Figura 10g] y la GFAP marcador glial (Figura 10h, i], mientras que el defecto en MAP2 manchas en Cebpa lx / lx; Cebpb + / -; NesCre TG / + ratones (en comparación con Cebpa lx / lx; Cebpb + / - los controles) fue todavía persistentes (Figura 10j, k]. Immunoblotting confirmó la disminución en los niveles de proteína MAP2 (Figura 10l, m]. En conjunto, estos datos indican un papel para C / EBP α y β en la diferenciación cortical dendríticas. A fin de apoyar esta conclusión a la que mide el espesor de apical primaria y secundaria dendritas de las neuronas piramidales ubicadas en la corteza somatosensorial primaria. La media del espesor de dendritas apical primaria en Cebpa lx / lx; Cebpb + / -; NesCre TG / + ratones se comprobó que se reducirá en un 10% en comparación con Cebpa lx / lx; Cebpb + / - los controles (2,00 ± 0,02 μ m y 2,24 ± 0,115 μ m, respectivamente; Figura 10m]. Del mismo modo, las dendritas secundarias fueron 7% más delgada en los mutantes en comparación con ratones control (0,79 ± 0,02 μ m y 0,013 ± 0,85 μ m, respectivamente; Figura 10n]. A pesar de las diferencias observadas en ambos casos no son estadísticamente significativas (p> 0,05) por análisis de ANOVA, son coherentes con C / EBPs estar implicados en la diferenciación dendríticas función.

Discusión

La identificación de objetivos para la transcripción de señalización de los receptores neurotrophin es fundamental para comprender los efectos de neurotrophins neuronal en la expresión génica, diferenciación y función. Estamos aquí proporcionar pruebas de que, en las células neuronales, C / EBP α y - β forma un complejo con NeuroD, y que estos factores son reclutados para el BDNF responda Fos, Egr1 y Egr2 promotores de una manera dependiente de señalización del receptor TRK in vivo. Reducir los niveles de C / EBP α y - β dado lugar a una reducción Fos, Egr1 y Egr2 expresión en respuesta a BDNF en la enseñanza primaria neuronal culturas, y a problemas de diferenciación terminal dendríticas puesto de manifiesto por una disminución de los niveles de MAP2 en la corteza dendritas in vivo. En conjunto, estos resultados identificar NeuroD-C/EBP complejos como mediadores de TRK señalización, e identificar los genes IE Fos, Egr1 y Egr2 abajo como objetivos para este itinerario.

Nuclear mediadores de señalización neurotrophin

Neurotrophins tienen múltiples funciones durante el desarrollo CNS, y mediar en la supervivencia neuronal, migración, diferenciación y función. Estos procesos requieren la activación de determinados objetivos de abajo. Por ejemplo, la Pi3-quinasa AKT-Foxo vía es importante para la supervivencia neuronal después del proceso de factor de crecimiento inducido por la señalización [22], y ambos Pi3 quinasa AKT-MAPK y las vías están involucradas en funciones similares abajo del receptor TrkB señalización inducida in vivo [15, 23], mientras que la fosfolipasa C γ (PLC γ) - CamK-CREB vía regula la plasticidad del hipocampo después del proceso de TrkB [3]. Cebpb ha sido previamente demostrado ser un objetivo neuronal transcripcional abajo del factor de crecimiento nervioso (NGF) receptor (TrkA ) En células PC12 [24]. Existen pruebas que indican que NeuroD responda a neurotrophin señalización en vivo. NeuroD es altamente expresado en diferentes tejidos, incluido el desarrollo de las neuronas del sistema nervioso periférico (SNP) y CNS, alcanzando su máxima expresión durante la diferenciación en la corteza cerebral [25]. En el SNP, NeuroD es necesaria para la supervivencia y la diferenciación del oído interno neuronas sensoriales durante las etapas posteriores [26, 27]. La pérdida de estas neuronas sensoriales en el vestibular de los ganglios coclear (VCG) de neuroD null ratones se asemeja a los fenotipos encontrado en los ratones que carecen de los receptores TrkB o TrkC (revisado en [28]]. Por otra parte, la expresión de trkB o trkC en el VCG de neuroD null ratones se redujo significativamente, [26], el apoyo a un vínculo entre NeuroD y TrkB / C de la supervivencia de los recién diferenciar oído interno neuronas sensoriales. Del mismo modo, dentado gránulo las neuronas del SNC no maduro neuroD/nex1 doble en ratones mutantes, lo que indica que estas moléculas son fundamentales no sólo para la supervivencia de los principios de diferenciación de las neuronas, sino también por su diferenciación terminal [29, 30]. Aunque no se observó fenotipo en el neocórtex de neuroD/nex1 animales, esto puede ser explicado por los miembros de la familia NeuroD funcionalmente redundante.

Hemos identificado NeuroD-C/EBP complejos como nuevos mediadores de señalización TRK in vivo. La conclusión de que la inhibición de estos complejos (a través de supresión de Cebpa y Cebpb alelos) tiene efectos sobre la diferenciación cortical similares a las observadas por la reducción de TRK señalización durante el desarrollo (a través de la interrupción de Ntrk2 y Ntrk3 alelos; suplementario Figura 4 en archivo de datos adicionales 1, y el trabajo previo en el que hemos demostrado que TrkB / C cooperarán en la promoción de la supervivencia de la diferenciación del hipocampo y cerebelo gránulo neuronas [17], y que regula las funciones de TrkB en toda la formación de la corteza cerebral, incluida la diferenciación neuronal dendrita [5]] Además, en consonancia con la señalización a través de TRK NeuroD-C/EBP sea necesaria para la inducción y MAP2 dendrita crecimiento. Habida cuenta de que C / EBPs y NeuroD son inducidos durante linaje compromiso neuronal in vitro, es interesante especular que su apariencia permite TRK receptor de señalización para regular los genes implicados en la terminal posterior diferenciación neuronal y la función.

De los objetivos que se encuentran afectados en este estudio, Fos y Egr1 han sido implicados en la formación de dendríticas en células PC12 [31, 32]. Genéticos ablación de Fos, Egr1 o Egr2 no se ha informado a afectar dendrita diferenciación in vivo, lo que sugiere que la combinación de múltiples downregulation objetivos conduce a los efectos observados en dendrita diferenciación neuronal. Sin embargo, es igualmente posible que algunos de los objetivos NeuroD-C/EBP participan en la función neuronal, ya que Egr1 ha informado de que se requiera en el SNC a largo plazo plasticidad sináptica (LTP) en el giro dentado [33] . El conocido funciones de los genes afectados son, por tanto, en consonancia con el fenotipo observado diferenciación, y sugieren un papel de C / EBPs en la generación de LTP. Sin embargo, dada la posibilidad de despidos funcional, más el análisis genético se requiere para resolver este problema.

No se observó ningún efecto de C / EBP agotamiento en bruto CNS morfología o la distribución o el número de neuronas y células gliales, según lo determinado por el análisis histológico y cuantificación de NeuN y GFAP. En informes anteriores [13, 14] han demostrado que altos niveles de negativa dominante-C / EBP fueron capaces de inhibir la neurogénesis. Nuestros datos genéticos no, en este momento, confirmar el papel de C / EBPs en neuronal-glial linaje decisiones. Sin embargo, además de C / EBP α y β, C / EBP y δ ε se expresa también en la CNS y pueden ser capaces de compensar la pérdida de la α y β isoformas. Además, debido a la letalidad embrionaria temprana de los ratones que carecen de todos los Cebpa y Cebpb alelos, uno de tipo salvaje alelo se intactos en nuestro análisis, que puede ser suficiente para cualquier compromiso paso. Cabe señalar que el uso de altos niveles de dominante negativo C / EBPs puedan afectar a otros relacionados con factores de transcripción (como C / CREB y ATF / CREM), y la confirmación de la propuesta de C / EBP en función neuronal linaje compromiso por medios genéticos seguirán siendo importantes para resolver definitivamente esta cuestión.

La contratación de C / EBP-NeuroD complejos objetivo a los promotores

El promotor elementos de la Fos, Egr1 y Egr2 promotores que reclutan C / EBP α y β y NeuroD tienen homología significativa, pero en el caso de Egr1 y Egr2 no contienen un consenso eBox. Esto plantea la posibilidad de que el C / EBP-NeuroD complejos que forman in vivo en células neuronales que expresan estos factores (tal como se determina por TAP mediada por tirar hacia abajo de mouse forebrain tejidos) son contratados a través de un único sitio de unión para C / EBP, con poco o ninguna interacción entre NeuroD y el ADN. Esta idea es apoyada por la observación de que la mutación del promotor Fos eBox no tuvo ningún efecto sobre la actividad promotora Fos en ensayos de transfección transitoria, mientras que la mutación simultánea de ambos la C / EBP y el sitio de eBox disminuyó significativamente promotor de inducción de BDNF.

La contratación de NeuroD y C / EBP α y β para IE genes promotores se veía afectada en vivo cuando los niveles de señalización TRK se redujeron por la inactivación de Ntrk2 / Ntrk3. Este resultado demuestra que TRK-regula la señalización mediada por la asociación de estos factores con la cromatina, y la observación de que NeuroD y C / EBP contratación fueron altamente correlacionados es coherente con estos factores están reclutados como un complejo, tal como se describe más arriba. Es importante destacar que la reducción del nivel de C / EBP a través de Cebpa / Cebpb disminuyó la inactivación inducibility de los tres IE genes promotores en respuesta a BDNF, proporcionando un vínculo directo entre el nivel de C / EBP (y, por deducción, C / EBP-NeuroD complejos) disponibles y neurotrophin mediada por la activación de genes. Si bien C / EBPs, por lo tanto, son un componente esencial de TrkB / TrkC mediada por la activación de genes IE, la vinculación de eventos de señalización para TRK C / EBP y / o NeuroD aún no se han comprendido plenamente en este punto. Ambos C / EBPs y NeuroD se sabe son fosforilados en respuesta a señales extracelulares, sin embargo, la relevancia fisiológica de fosforilación de estos eventos aún no se han abordado genéticamente. Tal vez lo más pertinente, desde los estudios in vitro, la fosforilación de C / EBP β Thr188 de ERK, y Thr217 por ribosomal S6 kinasa (RSK), ambos de los cuales se encuentran aguas abajo de quinasas MEK [34], se han propuesto que se requiere para su papel en linaje compromiso neuronal [13, 14]. Nos parece que TRK mediada por la inducción de genes IE depende de la situación especialmente difícil adaptador de sitio de unión, una función principal de las cuales es la de mediación de alto nivel de activación de ERK sostenido en las neuronas cultivadas [15]. Por lo tanto, es posible que, también en el contexto de un complejo NeuroD-C/EBP, este itinerario regula C / EBP actividad. Experimentos para hacer frente a esta cuestión son genéticamente actualmente en curso.

En resumen, hemos demostrado aquí que C / EBP α y NeuroD forma complejos en vivo y en vit ro. Estos pueden definir una nueva clase de C / EBP-bHLH factor de transcripción complejos generalizada de importancia, como hemos demostrado recientemente que el mismo se produce la interacción entre C / EBP α y SREBP-1 en hepatocitos [35]. Chip análisis genéticos y el agotamiento de manifiesto que la contratación de C / EBP y NeuroD para IE promotor del gen cromatina se produjo simultáneamente en un TRK que dependen de forma, y se requiere IE para la inducción de genes de neurotrophins. El resultado fisiológico de C / EBP agotamiento se redujo MAP2 expresión y problemas de diferenciación cortical dendríticas. Por lo tanto, hemos identificado C / EBP-NeuroD complejos como nuevos mediadores de señalización TRK, y aportar pruebas de que tales complejos en función de las fases finales de desarrollo neuronal para promover la diferenciación terminal neuronal.

Materiales y métodos
ARN preparación para el análisis de microarrays y RT-PCR

RNA fue aislado de las neuronas corticales E15.5 de + / + y trkB SHC / SHC ratones con TRIzol de acuerdo con el protocolo suministrado por el fabricante (Gibco Life Technologies (actualmente Invitrogen), Milán, Italia), y etiquetados con arreglo a uno - ciclo eucariota objetivo de etiquetado protocolo de Affymetrix (Santa Clara, CA, EE.UU.). Las muestras se hibridó a Affymetrix del genoma murino U74Av2 GENEChips. Por RT-PCR o qPCR, cDNA fue preparado de RNA total usando los cebadores aleatorios hexamer y MuLV la transcriptasa inversa (Roche, Milán, Italia) o Listo para su puesta en marcha T-priming Primera Línea Kit (Amersham Biosciences, Milán, Italia), tal como se describe por los fabricantes. Las secuencias de los primers utilizados para las diferentes reacciones de PCR se enumeran en el cuadro 1.

Construcciones de ADN

Las construcciones pMSRF / cebp, pMcebp / ebox, y se crearon pMebox tal como está descrita anteriormente [36]. Las mutaciones en el pMSRF / cebp y pMcebp / ebox construcciones se introdujeron como se describe [37], mientras que para el pMebox construir la QuickChange del sitio-Kit de mutagénesis dirigida se utilizó (Stratagene, Milán, Italia). Los oligonucleótidos utilizados para generar pMSRF / cebp, pMcebp / ebox y pMebox construcciones llevadas las siguientes mutaciones (subrayado), respectivamente: tgtccat cgg aggacatctgcgtcagcaggtttccacggcc, tgtccatattagga ACG ctgcgtcagcaggtttccacggcc, y tgtccatattagga un atctgcgtcagcaggtttccacggcc. C / EBP α se introdujo como Bam HI-Eco RI fragmentos en pcDNAI (Invitrogen, Milán, Italia) para el etiquetado in vitro [38], y, en pcDNA3.1 (Invitrogen) para transfección. Mouse NeuroD de larga duración cDNA se obtuvo por RT-PCR usando ARN aislado de las neuronas corticales y los primers Bam HI / 5'-cgggatccgtggaaacatgacc-3 'y 5'-ggaattcactgacgtgcctcta-3' / Eco RI.

Culturas de la cortical y progenitores postmitotic neuronas

Cortical progenitores, así como postmitotic neuronas, a partir de embriones de ratón se cultivaron de acuerdo con los métodos descritos anteriormente [15, 39]. En pocas palabras, cortices se obtuvieron de E12-13 embriones de ratón, triturated y, a continuación, chapados en poli-L-lisina (en diferentes densidades, según el último experimento). El medio de cultivo consistió en medio Neurobasal (Gibco BRL (ahora Invitrogen), Milán, Italia), 0,5 mM de glutamina, penicilina-estreptomicina, 1% N2 suplemento (Gibco BRL), básica y factor de crecimiento de fibroblastos (bFGF) (40 ng / ml ; R & D Systems, Milán, Italia). Después de 48 horas, medio fue reemplazado por el mismo medio que contiene 2% B27 suplemento (Gibco BRL) en lugar del 1% N2 suplemento. Postmitotic neuronas se prepararon de cortices cerebral de embriones de ratón E15.5 derivada de los cruces de tipo silvestre o en situación especialmente difícil trkB / SHC ratones homocigotos. Neuronas corticales fueron cultivadas y estimuladas BDNF, tal como se describe [15]. Recombinante purificada BDNF (Regeneron Pharmaceuticals, Inc, Tarrytown, NY, EE.UU.) se añadió al medio de cultivo a una concentración de cualquiera de 5 o 50 ng / ml, tal como se indica.

La inmunocitoquímica

Cortical progenitores, ya sea después de 1 ó 4 días in vitro (DIV) se fija en el 4% de paraformaldehído (PFA) durante 20 minutos. Lavados se realizaron con 10 mM de buffer fosfato salino (PBS) / glicina para neutralizar la PFA. Las células fueron permeabilized con el 0,5% NP-40/PBS durante 5 minutos. Solución de bloqueo se añadió durante 1 hora (10% NHS, el 0,3% los carragenanos Lambda (Sigma, Milán, Italia), un 0,5% en TritonX100 TBS 50 mM) a temperatura ambiente, seguido de incubación con un mouse monoclonal anti-MAP2 de anticuerpos (1 : 300, el clon AP20, ChemiconMilan, Italia) o un mouse monoclonal anti-Nestin de anticuerpos (1:300, el clon 401, Chemicon) en el 1% de suero normal de caballo (NHS), un 0,3% los carragenanos Lambda, del 0,5% TritonX100, 50 mM Tris - buffer salino (TBS), S / N en el 4 ° C. Immunostainings se visualizaron mediante un fluoresceína conjugado de cabra anti-ratón IgG (H + L) (1:200 en TBS, Jackson RE, Milán, Italia). Las diapositivas fueron montadas con Vectashield medio de montaje (Vector H2000, Milán, Italia).

Transfección de neuronas corticales y luciferase ensayo

Neuronas corticales se chapada a 3 × 10 6 células por 60 mm. Transfections se llevaron a cabo en cualquiera de 3 o 4DIV utilizando Lipofectamine 2000 reactivo (Invitrogen), según el protocolo del fabricante. En pocas palabras, uno de 60 mm y de las células se transfectadas con 2,3 μ g de plásmido reportero más 3 μ g del plásmido sarcoma virus ras largo terminal repetir que contiene la Escherichia coli beta-galactosidasa de genes (PRSV-β-gal). Luego, 24 horas después de transfección, las células se dejaron unstimulated o estimulada con 50 ng / ml de BDNF por 2 horas. Las células fueron entonces zadas en 250 μ l de Triton amortiguador de lisis (100 mM fosfato potásico pH 7,8, 0,2% Tritón X-100, 1 mM dithiothreitol (DTT)). Célula de los desechos se eliminan por centrifugación, y los lisados se utilizaron en luciferase y β-gal ensayos. Luciferase La actividad se midió utilizando un Lumat LB 9507 luminómetro (Berthold Technologies Wildbad, Alemania). El pliegue de inducción se define como la relación de β-gal luciferase normalizó la actividad en lisados de las células estimuladas en relación con la actividad normalizada luciferase de unstimulated células.

Co-transfección de ensayo

Plásmidos utilizados para cotransfections incluido pcDNA3.1 (Invitrogen) que impulsan la expresión de C / EBP α o NeuroD, y un tipo salvaje (PWT) o mutado (pMcebp / ebox) Fos promotor de conducción de expresión luciferase. NIH3T3 células fueron cultivadas a 60% a 80% en la confluencia de 30 mm de pozos y transfectadas con un total de 1,5 μ g de ADN incluidos 250 ng del plásmido luciferase reportero y 250 ng de PRSV-β-gal plásmido para la normalización. Las células fueron transfectadas utilizando FuGENE 6 (Roche), según el protocolo del fabricante. Después de 24 horas, las células han sido recolectados, zadas, y la β-galactosidasa y luciferase actividades se midieron como se ha descrito anteriormente.

Co-immunoprecipitation ensayo y el oeste de análisis

pCMV-Tag3 vector (Stratagene, Milán, Italia) fue usado para expresar un NeuroD possesssing Myc-epítopo etiqueta, y pcDNA3.1 (Invitrogen) se utilizó para expresar C / EBP α poseer una Bandera-epítopo etiqueta. Q2bn células fueron cultivadas en DMEM complementado con el 8% de suero fetal bovino y 2% de suero de pollo, transfectadas utilizando fosfato de calcio, cosechadas y 24 horas después de transfección. Las células fueron interrumpidas en buffer de lisis (50 mM Tris pH 7,4, 1,5 mM de MgCl 2, 100 mM NaCl, 0,5% Tritón X-100), complementado con un cóctel inhibidor de la proteasa (Roche) en hielo durante 15 minutos, y luego incubados a temperatura ambiente durante 30 minutos con 0,25 u / μ l de benzonase (Sigma). Después de una aclaración por centrifugación, lisados fueron sometidos a Co-IP con 20 μ l de anti-Flag M2 afinidad bolas de gel (Sigma) a 4 ° C la noche a la mañana (O / N). Las bolas fueron recogidos y lavados, y la obligada proteínas se eluye de un concurso con 3X BANDERA péptido (Sigma), y se analizaron por SDS-PAGE seguida de Western Blot utilizando anti-Myc etiqueta de anticuerpos (1:2000, Ab9106, Abcam, Cambridge , Reino Unido) y anti-Flag etiqueta de anticuerpos (1:2500, Sigma). Análisis de pERK1 / 2 y pAKT estimulado en neuronas corticales derivadas de cortices cerebral E12.5 de embriones de ratón y los diferentes controles Cebpa y Cebpb mutantes se llevó a cabo mediante transferencia Western-Blots, tal como se describe [15]. El anticuerpo monoclonal anti-pERK1 / 2 de anticuerpos se utilizó a 1:2000 (clon E10, New England Biolabs, Frankfurt, Alemania), el conejo policlonal anti-pAKT (Ser473) se utilizó a 1:1000 (Señalización Celular, Frankfurt, Alemania) , Y el anticuerpo monoclonal anti-α-tubulina de anticuerpos se utilizó en 1:20.000 (clon DM1A, Sigma).

GST bajar ensayo

El GST fusiones C / EBP β bzip (aminoácidos 231 a 328 de pollo C / EBP β) y la C / EBP α bzip (aminoácidos 256 a 358 de rata C / EBP α) se construyeron mediante amplificación por PCR y la clonación en pGEX4T-1 (Pharmacia, Milán, Italia). GST C / EBP α TAD (aminoácidos 1 a 96) se ha descrito [40]. S-35 etiquetado NeuroD fue preparada con la Promega TNT T7 sistema y L-35 S-metionina (Amersham Biosciences) de acuerdo con las sugerencias del fabricante. Derribo experimentos se llevaron a cabo de pre-incubación de 100 μ l de bolas de suspensión (que corresponde a alrededor de 500 ng de proteínas) con 50 μ l 10% de albúmina de suero bovino (BSA) y 350 μ l derribar buffer (50 mM Tris pH 8, 250 mM NaCl , 0,5% NP40) durante 30 minutos a temperatura ambiente con agitación suave. S-35 etiquetado de proteínas (5 μ l) fue añadido posteriormente, y la incubación se siguió durante 1 hora. Las bolas fueron lavados 3 veces con helado NETN de amortiguación (0,1 M NaCl, 1 mM EDTA, 10 mM Tris pH 8,0, el 0,5% NP40), pildoradas y resuspendido en 20 μ l de buffer 2X SDS (20% de glicerol, 4 % SDS, 10% de β-mercaptoetanol, 125 mM Tris-Cl pH 6,8, el 0,2% Azul de bromofenol). Las muestras fueron hervidas durante 5 minutos, y las bolas se pildoradas. Los sobrenadantes se resolvieron mediante SDS-PAGE (12,5%). Etiquetados proteínas se detectaron en una Fuji BAS2040 phosphorimager (Milán, Italia).

Tandem afinidad de depuración

De tipo silvestre (+/+) y Cebpa TAP / + (T / +) E16.5 forebrains fueron disecados, y luego sometido a lisis hipotónica en buffer (25 mM Tris pH 7,4, 50 mM KCl, 2 mM de MgCl2, 1 mM EDTA, 1 mM TDT, los inhibidores de la proteasa de Sigma) durante 20 minutos en hielo. Las muestras fueron centrifugadas a 4000 rpm durante 20 minutos a 4 ° C para recoger los núcleos, que fueron lavados en buffer hipotónico y benzonase resuspendido en buffer (50 mM Tris pH 7,4, 1,5 mM de MgCl 2, 100 mM NaCl, el 10% de glicerol y 1 mM TDT y los inhibidores de la proteasa). Benzonase (Novagen, Milán, Italia) fue añadido a 0,25 u / μ l izquierda y a temperatura ambiente durante 25 minutos, tras lo cual lisados fueron complementados con 0,2% NP40 a la izquierda y hielo por 10 minutos. Los extractos nucleares fueron recolectados por centrifugación a 14000 rpm a 4 ° C durante 20 minutos, y 5 mg de este material se haya utilizado en la propiedad intelectual después de una pre-liquidación de paso con proteinA sepharose bolas (Pharmacia) a 4 ° C durante 30 minutos. Hemos añadido 20 μ l conejo IgG bolas de agarosa (Sigma) para los extractos y se incubaron con suave mecer a 4 ° C durante 2 horas. Las bolas fueron lavadas tres veces con tampón de lisis seguido de la proteasa TEV buffer (10 mM Hepes-KOH pH 8,0, 150 mM NaCl, 0,1% NP-40, 0,5 mM EDTA, 1 mM TDT). VET la proteasa (Invitrogen) fue añadido en el 0,3 u / μ l de la noche a la mañana y lo abandonó a 4 ° C. Las proteínas en el sobrenadante de centrifugar las muestras se precipitó utilizando acetona, disuelto en 20 μ l de la muestra de amortiguación, y cargado en un 10% SDS-PAGE gel. Western blot se realizó mediante un anti-NeuroD de anticuerpos (1:500; D-20, Santacruz, Milán, Italia) en 5% BSA. Despojado membranas fueron re-probaron con un anticuerpo anti-C/EBP α (1:500; 14AA, Santacruz).

Chip análisis

Chip ensayos se realizaron esencialmente tal como está descrita anteriormente [41]. E16.5 o P0 de tipo salvaje del ratón forebrains fueron rápidamente disecados, cortado en pequeños trozos, y se incubarán durante 10 minutos a 1% PFA a 37 ° C. Los tejidos han sido recogidos, lavados en PBS, y resuspendido en buffer de lisis (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8,1) conteniendo 1 mM fluoruro de fenilmetilsulfonilo (PMSF) y 2 mg / ml aprotinina. Después de ultrasonidos, lisados fueron aprobados por centrifugación y se diluye 10 veces con buffer de dilución (0,01% SDS, 1% Triton 100X, 1,2 mM EDTA, 16,7 mM Tris-HCl pH 8,1, 150 mM NaCl). Después de un paso preclearing utilizando un ADN de esperma de salmón / ProteinA agarosa purines (50% purines, Upstate, Milán, Italia), la cromatina se incubó O / N en la 4 ° C, ya sea con Ig de conejo, o 2 μ l de C / EBP α (14AA , Santacruz), C / EBP β (# 3082 policlonales, Señalización Celular), NeuroD (Santa Cruz), histona H3 (Abcam), o acetilado histonas H3 (Upstate) anticuerpos. IP complejos fueron obtenidos mediante la proteína A / G sepharose bolas, y lavados dos veces con buffer de dilución, una vez con 500 mM NaCl, y una vez con Tris-EDTA buffer. Tras el final de lavado, 250 μ l de buffer de elución (1% SDS, 0,1 M NaHCO 3) se añadió, y las bolas se rotaron a temperatura ambiente durante 15 minutos. La elución se complementó con 5 M NaCl y se incubaron durante 4 horas a 65 ° C para revertir el formaldehído entrecruzamiento. Para analizar el ADN, las muestras fueron tratadas con 40 ng / μ l de proteinasa K (Merck, Milán, Italia) durante 1 hora a 45 ° C, extrae con fenol: cloroformo, y el etanol-precipitó en la presencia de glucógeno como transportista. La última de propiedad intelectual de ADN resuspendido productos fueron de 20 μ l de 10 mM Tris-HCl y 1 mM EDTA, de los cuales 2 μ l se utilizó para el análisis de PCR con 50 pmol de cada primer (Cuadro 1] en un volumen final de 50 μ l.

PCR cuantitativa

qPCR o QRT-PCR se realizó a través de DyNAmoSYBR Verde qPCR kit de acuerdo con el protocolo del fabricante (Finnzymes, Milán, Italia), utilizando los primers se indica en la Tabla 1. Para el chip, diluciones seriadas de ADN de la propiedad intelectual fueron objeto de PCR en tiempo real. Después de ejecutar el qPCR reacciones, cruce de umbral (T c) los valores fueron determinados para cada muestra. El valor de T c se define como el ciclo en que la fluorescencia se eleva por encima de un umbral de referencia, utilizando el software iCycler (MJ Research, Cambridge, MA). Para normalizar las variaciones en la cantidad a partir de ADN, una Δ T c valor se calcula restando el valor de T c immunoprecipitated para la muestra de la T c valor de la entrada correspondiente de ADN. ADN cantidades se han expresado como porcentajes correspondientes de entrada mediante el chip muestra como un porcentaje de aportación Δ = 2 (Tc) × 100. Sólo cuando la propiedad intelectual figuran muestras> 1,5 veces más ADN como la Ig muestras que se considera que tiene suficiente ADN para el análisis [42].

Cepas de ratones transgénicos

Los métodos utilizados para generar los knockouts de trkB, trkC, y trkB SHC se han descrito anteriormente [15, 17], así como los utilizados para generar los knockouts de Cebpa (generosamente proporcionada por los Dres D Tenen (Universidad de Harvard, Boston MA, EE.UU.) y G Darlington (Baylor College of Medicine, Houston TX, EE.UU.) y Cebpb (generosamente proporcionada por los Dres PF Johnson y E Sterneck (National Cancer Institute, Bethesda DC, EE.UU.), la floxed Cebpa (generosamente proporcionada por el Dr Lee YH, Instituto de Biología Molecular, Academia Sínica, Taipei, Taiwán), y el ratón transgénico NestinCre líneas [5, 19, 20, 43]. La C / EBP α-C-TAP tensión se generó de acuerdo a [18] (O Ermakova y C Nerlov, datos no publicados).

Histología y niveles de expresión proteica

Histológico e inmunohistoquímico (IHC) los análisis se llevaron a cabo tal y como se describe anteriormente [3]. Tejido cerebral se realizó bioquímica, tal como se describe [5]. Los anticuerpos específicos utilizados para evaluar la diferenciación neuronal se NeuN (1:500 BM, 1:100 IHC, clon A60, Chemicon), β-tubulina III (1:10000, clon Tuj.1, AbCam), GFAP (H-50 1; : 500, policlonales, Santa Cruz), MAP2 (1:300, clon AP20, Chemicon) y NF68 (AB1983; 1:250, policlonales, Chemicon). Los anticuerpos anti-PLC γ-1 (1:2000, mixta monoclonal, Upstate), anti-Erk1 (1:3000, monoclonales, Zymed, Milán, Italia), y anti-α-tubulina (1:20000, clon DM1A, Sigma ) Se utiliza para controlar la carga de proteínas. Para el análisis de expresión proteica NeuroD, P0 cortices de Cebpa / b y trkB / C mutantes y controles en zadas (50 mM Tris pH 7,4, 1,5 mM de MgCl 2, 100 mM NaCl, 0,5% Tritón X-100), complementado con un cóctel inhibidor de la proteasa (Roche) en hielo durante 15 minutos, y luego incubados a temperatura ambiente durante 30 minutos con 0,25 u / μ l de benzonase (Sigma). Western blot se realizó mediante un anti-NeuroD de anticuerpos (1:500, D-20, Santacruz) en 5% BSA. Despojado membranas fueron re-probaron con un anti-anticuerpo SP3 (D-20X; 1:1000, policlonales, Santacruz). Densitométricas análisis [44] de imágenes blots se utilizó para comparar los niveles de expresión de proteínas mutantes en el cerebro y el control, y se realizó en tres diferentes Blots para cada anticuerpo. Los coeficientes obtenidos para mutantes y muestras de control fueron comparados estadísticamente utilizando Student's t-test.

Método de Golgi y el análisis de espesor dendríticas

Los animales fueron perfundidos con PFA 4% en tampón fosfato. Brains fueron disecados y después de la fijada en el 4% PFA. Golgi de tinción se realizó de acuerdo a la Golgi-Kopsch método, tal como se describe anteriormente [45]. En pocas palabras, los bloques de tejido cerebral (aproximadamente 2,5 mm de espesor) se prepararon y se sumergen en una solución que contiene 2,5% de dicromato de potasio para 1 día a temperatura ambiente en la oscuridad. La solución fue entonces sustituido con frescos del 2,5% de dicromato de potasio solución, y los tejidos se incubaron durante otros 6 días. Los tejidos fueron lavados y trasladados a una solución que contenga 0,75% Agno 3. Después de 5 a 6 días, el cerebro se eliminaron trozos, se lava en un 40% y 20% de etanol, y cortado en 80 μ m secciones coronales utilizando un vibratom (Leica, Heidelberg, Alemania). Las secciones fueron montadas en gelatina revestido con diapositivas y coverslipped con Merkoglas (Merk, Darmstadt, Alemania). Análisis de espesor dendríticas se realizó en Golgi impregnados secciones que fueron uniformemente oscuro en toda la sección. Sólo dendritas que no muestra rupturas en su coloración, y no fueron enmascarados por otras neuronas o artefactos, fueron evaluados. Cuantitativas en tres dimensiones de análisis se realizaron utilizando una combinación de hardware-software de sistema (NeuroLucida, Inc Microbrightfields, Colchester, VT, EE.UU.) el control de los ejes xyz del microscopio (Axioscop Imaging, Zeiss, Rehlingen, Alemania), y un microscopio montado cámara de vídeo (Hitachi, Tokio, Japón). Las tres dimensiones de reconstrucción se realizó utilizando un objetivo de 100 × (NA: 1,4; aceite de inmersión) y la NeuroLucida sistema. El promedio de grosor dendríticas se calculó a partir de las dendritas reconstruido con la ayuda de NeuroExplorer (Microbrightfields Inc). La media, desviación estándar (SD), y error estándar de la media (SEM) se calcularon. ANOVA seguido de un Newman-Keuls test se utilizaron para el análisis estadístico, y se realizaron con Prism 4.0 (Graph Pad, San Diego, EE.UU.).

Autorización para el uso de animales experimentales

El EMBL-Monterotondo Animal Comité de Ética aprobado todos los procedimientos animal. Además, confirmar que todos los experimentos con animales se apegara al italiano y europeo las normas reglamentarias.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Autores de las contribuciones

AMC participado en el diseño del estudio y se lleva a cabo la biología molecular, bioquímica y genética experimentos, y el análisis estadístico. NC participó en la revisión crítica del manuscrito, y ha contribuido a la biología molecular experimentos. RGL contribuido a los experimentos de genética molecular. CS contribuido a la bioquímica y la genética molecular experimentos, y participó en la secuencia alineación. OBH realizó el método de Golgi y el análisis de espesor dendríticas. OB ha contribuido a la in vitro análisis bioquímico de la C / EBP-NeuroD complejo. LM concibe el estudio, participaron en su diseño y la coordinación, y redactó el manuscrito. Todos los autores han leído y aprobado el manuscrito final.

Material complementario
1 de ficheros adicionales
Cuatro figuras complementarias.
2 ficheros adicionales
Otros Materiales y métodos.
Agradecimientos

Queremos dar las gracias al Dr E Reuvni para el análisis de secuencia promotora, y E Perlas por su excelente asistencia técnica, farmacéutica y Regeneron Inc recombinante para la prestación de BDNF. Este estudio fue apoyado en parte por una subvención de la Unión Europea (EuroStemCell) a LM y NC. OvBuH fue apoyada por la Deutsche Forschungsgemeinschaft (SFB 636/A5).