Journal of Immune Based Therapies and Vaccines, 2007; 5: 1-1 (más artículos en esta revista)

El efecto de CPG-ODN en células presentadoras de antígenos del Potro

BioMed Central
M Julia BF Flaminio (mbf6@cornell.edu) [1], S Alexandre Borges (asborges@fmvz.unesp.br) [2], Daryl V Nydam (dvn2@cornell.edu) [3], David W Horohov (David . Horohov@uky.edu) [4], Rolf Hecker (rolf.hecker @ gmx.com) [5], Mary Beth Matychak (mbm10@cornell.edu) [1]
[1] Departamento de Ciencias Clínicas de la Facultad de Medicina Veterinaria, Universidad de Cornell, Ithaca, NY, EE.UU.
[2] Departamento de Clínica Veterinaria, Facultad de Medicina Veterinaria e Zootecnia, Universidade Estadual Paulista "Julio de Mesquita Filho", UNESP-Campus de Botucatu, SP, Brasil
[3] Departamento de Medicina de Población y Diagnóstico de Ciencias, Facultad de Medicina Veterinaria, Universidad de Cornell, Ithaca, NY, EE.UU.
[4] Departamento de Veterinaria, Maxwell H. Gluck Equine Research Center, University of Kentucky, Lexington, KY, EE.UU.
[5], Qiagen GmbH, Hilden, Alemania; dirección actual Tübingen, Alemania

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

Citosina-fosfato de guanosina oligodeoxynucleotide (CPG-ODN) ha sido utilizado con éxito para inducir la respuesta inmune contra el virus intracelular y organismos en los mamíferos. El principal objetivo de este estudio fue evaluar el efecto de CPG-ODN en células presentadoras de antígenos de los jóvenes potros.

Métodos

Monocitos de sangre periférica de potros (n = 7) fueron aisladas en el primer día de vida y mensualmente a partir de entonces hasta 3 meses de vida. Adultos caballo (n = 7) monocitos fueron aislados y una vez probado para la comparación. Monocitos aislados fueron estimulados con IL-4 y GM-CSF (para obtener células dendríticas, DC) o no estimulado (para obtener los macrófagos). Macrófagos y países en desarrollo fueron estimulados para 14-16 horas con cualquiera de CPG-ODN, LPS o no estimulado. La estimulado y no estimulado las células se realizarán las pruebas de marcadores celulares de superficie (CD86 y CMH clase II) mediante citometría de flujo, mRNA expresión de citocinas (IL-12, IFN α, IL-10) y TLR-9 utilizando cuantitativa en tiempo real RT-PCR , Y para la activación del factor de transcripción NF-κ B p65 mediante un ensayo de quimioluminiscencia.

Resultados

La mediana de fluorescencia de la CMH clase II en la molécula no estimulado potro macrófagos y países en desarrollo en el momento del nacimiento fueron 12,5 veces y 11,2 veces inferior, respectivamente, que las células adultas caballo (p = 0,009). Esta diferencia disminuyó a los 3 meses de vida (p = 0,3). La expresión de CD86 la co-estimuladoras molécula fue comparable en los adultos caballo y potro macrófagos y países en desarrollo, independiente del tratamiento. CPG-ODN estimulación inducida por IL-12p40 (53 veces) e IFN α (23 veces) mRNA expresión en CPG-ODN adultos tratados con países en desarrollo caballo (p = 0.078), pero no los macrófagos, en comparación con los no-estimulado las células. Por el contrario, potro vehículos blindados no respondió a CPG-ODN con el aumento de la estimulación de citoquinas expresión mRNA de hasta 3 meses de edad. TLR-9 y la expresión mRNA NF-kB activación (NF-kB p65) en potro países en desarrollo y los macrófagos fueron comparables (p> 0,05) a caballo de células adultas.

Conclusión

CPG-ODN tratamiento no induce la maduración específico y expresión de citoquinas en los macrófagos y potro países en desarrollo. Sin embargo, los adultos caballo países en desarrollo, pero no los macrófagos, un aumento de su expresión de la IL-12 e IFN α citoquinas a CpG ODN-estimulación. Es importante destacar que los potros presentan una edad que dependen de la limitación en la expresión de MHC clase II en macrófagos y los países en desarrollo, independiente del tratamiento.

Fondo

La susceptibilidad de los ingenuos potro a la infección en el período neonatal es en gran medida depende de la adecuación de la transferencia y la absorción de la madre derivadas de anticuerpos a través del calostro. - Pasiva transferidos de protección inmune humoral, sin embargo, es limitada y de corta duración. Cuando los anticuerpos maternos se reducen a niveles bajos, el potro debe confiar en su sistema inmune para resistir las infecciones. Además, la protección contra patógenos intracelulares podrá exigir inmunidad celular. Por lo tanto, maduración temprana del potro del sistema inmune podría aumentar la resistencia a las enfermedades infecciosas.

ADN bacteriano tiene una potente actividad immunostimulatory se explica por la presencia frecuente de unmethylated citosina-fosfato de guanosina (CpG) motivos [1, 2]. Sintéticas CpG oligodeoxynucleotides-(CPG-ODN) han demostrado potente actividad immunostimulatory en adultos y neonatal en los vertebrados probablemente porque imitan ADN bacteriano [3]. In vivo, CpG-ODNs han demostrado inducir Tipo 1 fuerte respuesta inmune, con la consiguiente activación de celular (linfocitos T citotóxicos, CTLs) y humoral (Th1 isotipos de inmunoglobulinas) componentes [4]. Por lo tanto, CpG-ODNs han sido ampliamente estudiados para su aplicación como adyuvantes en las vacunas en especies domésticas, incluidas las especies bovina, ovina y porcina, lo que revela aumento de la eficacia de la vacuna y la protección [5 - 11]. En el caballo, CpG ODN-2007 formulado en el 30% Emulsigen añadido a una actividad comercial muertos-virus vacuna contra el virus de la gripe equina mejorar la respuestas de anticuerpos en comparación con la vacuna por sí sola [12].

Los receptores tipo Toll (TLRs) son esenciales para el reconocimiento de muy conservadas motivos estructurales (patógeno de patrones moleculares asociados o PAMPS) sólo expresadas por patógenos microbianos. La combinación de diferentes TLRs proporciona detección de un amplio espectro de moléculas microbianas. Por ejemplo, TLR-4 reconoce específicamente lipopolisacárido (LPS) que se derivan de bacterias gram-negativas, mientras que el ADN bacteriano (unmethylated CpG motivo) es reconocido por TLR-9 [13]. TLRs son predominantemente expresado en la presentación de antígenos de células [macrófagos, células dendríticas (DCS) y, en cierta medida, las células B], que son absolutamente inmunes presentes en los tejidos (bazo, ganglios linfáticos, leucocitos de sangre periférica), así como los tejidos que están directamente expuestos a los microorganismos (los pulmones, el tracto gastrointestinal, la piel). El factor nuclear kB (NF-kB) es un factor de transcripción activado el momento de la contratación del adaptador MyD88 y TLR 4 o TLR9 compromiso con PAMPs [14]. Células presentadoras de antígeno (vehículos blindados) desempeñan un papel importante en la incoación e instrucción de antígenos específicos de la respuesta inmune, y son el vínculo entre la innata y la inmunidad adaptativa: reconocer, procesar y presentar antígenos a los linfocitos T. Muchos estudios han indicado que los países en desarrollo, pero no los macrófagos, son críticos para la inducción de respuesta inmune primaria, es decir, por primera vez células T encuentro con el antígeno procesado [15]. Células dendríticas capacidad para procesar y presentar antígenos depende de su etapa de maduración, y que circulan precursor países en desarrollo entrar en los tejidos como inmaduros países en desarrollo. Después de la captura de antígenos, migran a órganos linfoides secundarios, donde se convierten en países en desarrollo madura. Países en desarrollo inmaduro exposición activa la fagocitosis, pero carecen de suficiente superficie celular MHC clase II y co-estimuladoras moléculas (CD83, CD86) para una eficiente presentación de antígenos a los linfocitos T [16]. Por el contrario, demostrar madurez países en desarrollo disminuyó la capacidad de fagocitosis y de procesamiento de antígenos, y el aumento de expresión de MHC clase II y co-estimuladoras molécula en la superficie celular. CpG-ODNs han demostrado inducir la maduración de los países en desarrollo mediante el aumento de la superficie celular expresión de MHC clase II, CD40, CD86/80 y moléculas [17]. En combinación con los antígenos, CpG-ODNs mejorar el procesamiento de antígenos y la presentación de países en desarrollo y la expresión de citoquinas de tipo I (es decir, el interferón tipo I IFN α e IL-12) [18]. En el caballo, Wattrang et al. (2005) demostró que contengan phosphodiester ODN unmethylated CpG ODN motivo de tipo I inducida por la producción de interferón en células sanguíneas mononucleares periféricas [19]. La activación de los monocitos humanos a través de Toll-like receptor ha demostrado inducir su diferenciación en macrófagos o bien países en desarrollo, y la presencia de GM-CSF es sinérgico para la expresión de MHC clase II, CD86, CD40 y CD83 moléculas, reacción mixta de linfocitos y la secreción de citoquinas Th1 de las células T [20].

En contraste con los adultos, recién nacidos humanos han puesto de manifiesto problemas de respuesta a las múltiples PAMPS, lo cual puede contribuir significativamente a la inmunidad neonatal inmaduro [21, 22]. Sin embargo, CPG-ODN se ha demostrado que induce in vitro de citocinas IFN α y reducir la producción en vivo diseminación de virus, en los corderos recién nacidos [23]. Hasta la fecha, se dispone de información limitada sobre la competencia de potro células para detectar los agentes patógenos y desencadenar una respuesta inmune contra ellos. Una dependencia similar en APC podría existir competencia en el potro en cuanto a resistencia a los virus intracelulares y las infecciones bacterianas, por ejemplo, Rhodococcus equi, que causa neumonía pyogranulomatous exclusivamente a los potros jóvenes [24, 25].

El ex vivo sistema utilizado en esta investigación permite un estudio longitudinal de las células inmunes del potro. Se investigaron el efecto de una CpG ODN-en monocitos-macrófagos derivados de países en desarrollo y de caballos adultos y potros desde el nacimiento hasta los 3 meses de vida. Se evaluó el efecto de CPG-ODN en el proceso de maduración de las células dendríticas de los potros y en comparación con las de caballos adultos de la medición de la superficie celular de moléculas de expresión, perfil de citoquinas, vía y señalización de activación.

Métodos
Potros, caballos adultos y muestras de sangre

Este estudio se realizó a raíz de un protocolo aprobado por la Universidad de Cornell Centro de Recursos Animales y Educación y las directrices institucionales de los Animales y el empleo Comités. Ocho yeguas embarazadas de diferentes razas (1 de Baviera, 1 Westfalen, 1 Selle Fraincaise, 1 Thoroughbred, 2 Oldenburg, 2 Pony yeguas) pertenecientes a la Universidad de Cornell Equinos Park fueron controlados para este estudio. Estas yeguas tenían acceso a los pastos y el granero, y que fueron alimentados con hierba y heno de granos en función de su calendario de la gestión. Ellos fueron vacunados aproximadamente 30 días antes de foaling con Encevac-T ® (Intervet, DeSoto, KS). Todos los foalings se observaron, y la adecuada absorción de colostral inmunoglobulina G (IgG) de los potros se evaluó utilizando el SNAP ® Test (Idexx, Westbrook, MN) por 18 horas del nacimiento. Daily examen físico en la primera semana de vida, y mensual completa de glóbulos se realizaron para evaluar natural inflamatorio o infeccioso en las condiciones de potros.

Sesenta mililitro de sangre periférica se obtuvieron muestras de los 8 potros a través de punción venosa yugular utilizando tubos vacutainer heparinized dentro de 5 días de vida, y mensual de hasta 3 meses de vida. Uno de los potros fue sacrificados debido a la sinovitis sépticos y fue retirado del estudio. Una cantidad equivalente de la sangre se recogió una vez de 7 diferentes caballos adultos (5 Thoroughbred y 2 ponis). Todas las muestras fueron procesadas como a continuación inmediatamente después de colección.

- Monocitos y macrófagos derivados de las células dendríticas

Monocitos fueron purificados a partir de sangre periférica mediante una modificación técnica descrita por Hammond et al. [26]. En resumen, las células mononucleares se aislaron utilizando Ficoll-Paque (Amershan Biosciences, Piscataway, NJ) la densidad de centrifugación, y se incubaron en DMEM-F12 medio (Gibco-Invitrogen Corporation, Grand Island, NY) más el 5% de crecimiento en suero bovino (Hyclone, Logan UT ), Antibióticos y antimicóticos (Gibco-Invitrogen Corporation, Grand Island, NY) durante 4 h en 5% CO 2, 37 ° C. Todos los reactivos fueron certificadas por la presencia de lipopolisacárido. El poco adherentes y no adherentes se eliminaron las células de lavado suave con una temperatura de 37 ° C solución tampón fosfato (PBS). Para la generación de países en desarrollo, recombinante equina IL-4 (rEqIL-4, 10 ng / ml) humana recombinante y los granulocitos y monocitos factor estimulante de colonias (rHuGM-CSF, 1000 unidades / ml, R & D Systems, Minneapolis, MN) se han añadido a el medio de cultivo como los siguientes:

Basal de células dendríticas de control: para la generación de países en desarrollo, los monocitos se cultivaron en presencia de rEqIL-4 y rHuGM-CSF durante 5 días.

Para probar el efecto de CPG-ODN o LPS en las células dendríticas: monocitos se cultivaron en presencia de rEqIL-4 (10 ng / ml) y rHuGM-CSF (1000 unidades / ml) durante 5 días, seguida por la adición de CpG - ODN 1235 (10 μ g / ml, Qiagen, Hilden, Alemania) o LPS (Sigma Diagnostics, Inc, San Lois, MO) a la media de 14-16 horas.

Macrófagos de referencia de control: monocitos se cultivaron sin aditivos extra para 5 días.

Para probar el efecto de CPG-ODN o LPS en los macrófagos: monocitos se cultivaron sin aditivos adicionales por 5 días, seguida por la adición de CpG ODN-2135 (10 μ g / ml) o LPS (12,5 μ g / ml) al medio de 14-16 horas.

Célula de viabilidad (> 90%) y la morfología (formación de dendritas) fueron probados en un 0,2% Trypan azul (Gibco BRL, Grand Island, NY) la exclusión y la microscopía de contraste fase, respectivamente. Una porción de las células cultivadas se realizarán las pruebas de la superficie celular de moléculas de expresión usando citometría de flujo. Las células se adhirieron fueron separados de los pozos utilizando 5 mM EDTA en medio de 5-10 minutos a 37 ° C, y lavarse con PBS fresco. Las placas fueron evaluadas después de asegurar todas las celdas fueron retirados para su análisis. En general, los macrófagos presentan moderada adhesión a las placas, mientras que las células dendríticas fueron sueltos o poco adjuntan al presente informe. La otra porción fue instantánea congelada en nitrógeno líquido y se almacenan a menos 80 ° C para: a) la extracción de RNA, y la posterior medición de la expresión génica utilizando en tiempo real de RT-PCR, o b) la medición de NF-κ B activación mediante un ensayo de quimioluminiscencia .

Unmethylated citosina-fosfato de guanosina oligodeoxynucleotides (CPG-ODN) motivos

En este estudio, hemos utilizado la síntesis CpG ODN-2135 (TCGTCGTTTGTCGTTTTGTCGTT) (Merial, EE.UU.), que ha demostrado inducir equina mononucleares de sangre periférica la proliferación celular in vitro [27]. Para confirmar el reconocimiento de este CpG ODN-motivo por el caballo de leucocitos de sangre periférica y reunir datos preliminares sobre la respuesta a los potros, 2 días de edad Potro (n = 5) y caballos adultos (n = 5) aisladas de sangre periférica de células mononucleares, y una de 5 días de edad, potro aislados mesentérica ganglio linfático de células mononucleares (n = 1) han sido cultivadas en la presencia o ausencia de 5 μ g / ml o 10 μ g / ml CpG ODN-2135, el 12,5 μ g / ml LPS o no estimulado . Aproximadamente un 4 × 10 5 células / así se cultivaron en una placa de 96 pocillos y medio se ha descrito anteriormente. Las células fueron incubadas durante 3 días a 37 ° C en el 5% de CO 2, pulsátil y con 0,8 μ Ci [3 H]-timidina por así durante los últimos 8 horas de incubación. Bueno contenidos fueron cosechadas en los filtros de fibra de vidrio y [3 H]-timidina incorporación se midió utilizando un líquido beta scintillation counter. La estimulación índice fue calculado dividiendo el promedio de los cargos por minuto a partir de células estimuladas por el medio por minuto cuenta de no estimuló las células.

Análisis de citometría de flujo de marcadores celulares de superficie

Marcadores celulares de superficie de los monocitos-macrófagos derivados de países en desarrollo y se evaluó por citometría de flujo después de 5 días de cultura (Día 5) y después de la noche a la mañana con la estimulación-CpG ODN o LPS (día 6). El ensayo se realizó de acuerdo a Flaminio et al. [28], y los anticuerpos monoclonales utilizados se describen en la Tabla 1 [29 - 31]. Subpoblaciones de leucocitos se muestran en un punto parcela y con acceso controlado de acuerdo al tamaño basa en la dispersión de luz (FSC), y de acuerdo con granularidad sobre la base de 90 grado de dispersión de luz lateral (SSC). La población celular de interés fue cerrada lejos de las pequeñas y células muertas, incluidos eventos superiores a 400 FSC y la cooperación Sur-Sur 200. Tanto el porcentaje de células positivas y media de fluorescencia se mide de expresión.

Real-time RT-PCR reacciones de expresión mRNA de citoquinas

Análisis cuantitativo de la expresión mRNA de citoquinas se realizó como se describe en el Flaminio et al. [32]. Aislamiento de ARN total de derivados de los monocitos y macrófagos países en desarrollo se realizó a través RNeasy ® Mini Kit (Qiagen, Valencia, CA), y la calidad de RNA se puso a prueba de 260/280 nm. El ARN del producto fue tratado con DNasa para eliminar posibles ADN genómico de las muestras, y la falta de amplificación de genes en las muestras sin la adición de la transcriptasa inversa confirmó la pureza del RNA. Una misma cantidad (0,01 μ g en 1 μ l) de ARN de cada muestra fue utilizado para la prueba de la expresión de citoquinas. Las citocinas (IL-10, IL-12p35, IL-12p40 e IFN α) y Toll-like receptor 9 (TLR9) la expresión génica en estimulado y no estimulado las células se midió por triplicado Taqman ® utilizando un solo paso RT-PCR Master Mix reactivos, y los primers específicos diseñados utilizando sondas publicado equina secuencias (Tabla 2], y la ABI Prism ® 7700 Sistema de Detección de Secuencia (AB Biosystems, Foster City, CA). En un pequeño subconjunto de células caballo adulto (n = 3), la expresión de mRNA del TNF α se puso a prueba a 14-16 horas de la cultura. El análisis de los datos fue realizado por la normalización de la meta de amplificación de genes de valor (Meta C T) con su correspondiente control endógeno (β actina, de referencia T C). La cantidad de la meta de genes en cada muestra se calculó en relación con el calibrador de muestra (más veces Día 5 no estimuló las células).

Para determinar el tiempo de punto de partida para la recolección de células que correspondían a la aproximación de pico de expresión de citoquinas en CpG ODN-estimulado las células, las muestras de 3 caballos adultos se pusieron a prueba en diferentes puntos temporales de expresión mRNA de citoquinas. Los resultados indicaron que el pico de IL-12p40 expresión se observó a entre 12 y 24 horas de estimulación (datos no presentados).

Toll-like receptor 9 (TLR9)

Consenso secuencia fue obtenida a través de la aproximación de los recursos humanos, los animales bovinos, ovinos, caninos, felinos y murino TLR9 secuencias de genes utilizando el gen alineación NTI software. Primers para la secuencia de consenso se han diseñado y utilizado para la amplificación por PCR de cDNA caballo purificado obtenido a partir de sangre periférica de leucocitos RNA. Electroforesis en gel del producto de PCR utilizando bajo punto de fusión en gel de agar reveló una sola banda del tamaño esperado. El producto de PCR fue purificado utilizando QIAquick PCR purificación kit (Qiagen, Valencia, CA). El producto de PCR fue ligated pUnidad en la clonación de vectores, seguida por transformación de Quiagen EZ químicamente las células competentes (Qiagen, Valencia, CA). Colonias seleccionadas se cultivaron durante la noche y el ADN plásmido se aisló con el QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA). Inserta se han confirmado con restricción de digerir y / o PCR. Deseado clones fueron secuenciados con los primers universales en la Universidad de Cornell de Secuenciación del Centro. Primers y sondas fueron diseñadas para la composición cuantitativa RT-PCR utilizando la secuencia equina y la PrimerExpress software (ABIPrism). El equino TLR9 secuencia parcial se presentó a GenBank en virtud del número de DQ157779 .

Nuclear factor-kappa B (NF-kB)

La activación de NF-kB se midió utilizando la venta en el comercio de quimioluminiscencia TransAM ™ NF-kB factor de transcripción kit que mide el NF-kB p65 subunidad (Active Motif, Carlsbad, CA). El kit contiene una placa de 96 pocillos recubiertos con ADN que contiene una NF-kB consenso sitio (5'-GGGACTTTCC-3 '). Sólo la forma activa de NF-kB (es decir, no vinculados a inhibidor de INF-kB) se une específicamente a este oligonucleótido. Por lo tanto, la purificación nuclear no es necesaria para este ensayo porque inactivada frente al citoplasma de NF-kB no puede obligar a la secuencia de inmovilizado. Una de las principales anticuerpo que reconoce la subunidad p65 epítopo se utiliza posteriormente para la incubación con extracto celular, que se obtiene utilizando los buffers incluido en el kit. Un rábano picante-y conjugado con peroxidasa anticuerpo secundario se utiliza para el ensayo de quimioluminiscencia. Una curva estándar, se ha generado utilizando diluciones de la NF-kB nivel de proteínas (Active Motif, Carlsbad, CA). Los resultados se expresaron en ng / μ l.

Análisis Estadístico

Estadística descriptiva y se generaron distribuciones de los datos fueron analizados mediante el software comercial (PROC univariante, SAS Institute, versión 9,1, Cary, NC). Box y bigotes parcelas fueron producidos utilizando software comercial (KaleidaGraph, versión 4,01, Synergy Software, Reading, PA). Box parcelas representan los datos recogidos. La caja incluye 50% de las observaciones con la línea superior que indica el cuartil superior, la línea media que muestra el valor medio, y la línea inferior, indicando el cuartil inferior. Las líneas se extienden desde la caja ( "bigotes") marca el máximo y mínimo de valores observados que no son anómalos. Anómalos son representadas por los círculos son los valores que son mayores que el cuartil superior + 1,5 * la distancia intercuartil (CIE) o inferior al cuartil inferior - 1,5 * CIE. No distribuido normalmente datos fueron analizados utilizando no paramétrico de las técnicas (es decir, Kruskal-Wallis y Wilcoxin la suma de rangos de, o Wilcoxin firmado rango en función del número de comparaciones y / o la independencia de las observaciones) realizado por el software disponible comercialmente (PROC Npar1way, SAS Institute, versión 9,1, Cary, NC). General de regresión lineal se utilizó para examinar la asociación entre la superficie celular marcador de expresión y la edad (PROC Reg, SAS Institute, versión 9,1, Cary, NC). El nivel de significación se fijó en p <0,05.

Resultados
Efecto de CpG ODN-2135 en la sangre periférica de células mononucleares de potros y caballos adultos

En un estudio piloto, hemos probado la respuesta proliferativa de 2 días de edad Potro (n = 5) y caballos adultos (n = 5) aisladas de sangre periférica de células mononucleares, y una de 5 días de edad, potro aislados mesentérica los ganglios linfáticos las células mononucleares (n = 1) a CpG ODN 2135-o no-estimulación. Estos incluyen los leucocitos y las células B, monocitos, que potencialmente expresar TLR9 y responder a CpG ODN-estimulación. Nuestros resultados indican que CpG ODN-2135 proliferación inducida por motivo de los ganglios linfáticos potro leucocitos in vitro con mediana de los índices de estimulación igual a 2 y 3 cuando las células se estimularon con 5 μ g / ml o 10 μ g / ml CpG ODN-2135 concentración final, respectivamente, mediana versus la estimulación índice de 0,8 cuando las células fueron estimuladas con 12,5 μ g / ml LPS. Además, Potro de sangre periférica de células mononucleares respondió a 10 μ g / ml-CpG ODN o 12,5 μ g / ml LPS con la proliferación de las células mediana de los índices de estimulación igual a 1,2 y 2,5, respectivamente. Adultos caballo células presentan índices de estimulación mediana de 7,3 y 16,3, respectivamente.

Cultivo celular

Nuestro ex vivo propagadas caballo adulto derivados de los monocitos y macrófagos en países en desarrollo Día 5 de la cultura mostraron una superficie similar antígeno fenotipo al descrito por Hammond et al. [26] y Mauel et al. [33]. El día 5 de la cultura, adultos caballo y potro parecía ronda los macrófagos y que se adjunta a la parte inferior de plástico de la cultura placa (Figura 1]. Potro macrófagos tienden a convertirse en células gigantes con más frecuencia en 2-3 meses de edad potro muestras. En contraste, los adultos caballo y potro células dendríticas son alargados. Después de la estimulación (día 6), ocasionales células dendríticas con stellate forma se observaron, mientras que muchas células separadas de las de plástico, aisladas o formando bosquetes, pero el mantenimiento de las dendritas.

Aproximadamente el 30% y el 19% de los derivados de los monocitos y macrófagos países en desarrollo, respectivamente, expresaron el marcador CD14. Aproximadamente el 61% y 77% de los derivados de los monocitos y macrófagos países en desarrollo, respectivamente, expresaron la CD172a marcador. En general, no estimula las células dendríticas expresó 1,4 y 1,2 veces la mediana intensidad de fluorescencia (de ahí la expresión molecular) para MHC clase II y CD86, respectivamente, que los macrófagos (Figura 2]. Los porcentajes de CD8 + o CD4 + en rEqIL-4 + rHuGM-CSF, las células fueron estimuladas menos del 3% y 9%, respectivamente. Potro células presentan fenotipo similar a las células adultas caballo.

Superficie celular marcador expresión en estimulado y no estimulado las células

La mediana de intensidad de fluorescencia de MHC clase II expresión fue mayor pero no estadísticamente significativa diferente (p> 0,05) en los países en desarrollo que en los macrófagos de caballos adultos y potros (Figura 3]. Aunque no hubo efecto específico de CpG ODN-estimulación en adultos caballo y potro células, hubo una edad que dependen de la limitación en la expresión de MHC clase II (fluorescencia) en los macrófagos y los países en desarrollo de los potros (p <0.035). La mediana de fluorescencia de la CMH clase II en la molécula no estimulado potro macrófagos y países en desarrollo en el momento del nacimiento fueron 12,5 veces (p = 0,009) y 11,2 veces (p = 0,009) inferior, respectivamente, a caballo de células adultas. A los 3 meses de vida, no hubo diferencias estadísticamente significativas en la expresión de MHC clase II molécula entre adultos y potro caballo macrófagos (2,6 veces, p = 0,31) y las células dendríticas (1,3 veces, p = 0,37). El porcentaje de MHC clase II células positivas se mantuvo constante a través de cierta edad. CPG-ODN o LPS tratamiento no promover cambios específicos en MHC clase II expresión en los macrófagos o países en desarrollo y, sin embargo, una diferencia estadísticamente significativa en el MHC clase II expresión se observó en células estimuladas en un dependiente de la edad en forma. La expresión de CD86 la co-estimuladoras molécula fue comparable en los adultos caballo y potro macrófagos y países en desarrollo, independiente del tratamiento.

MRNA expresión de citocinas en estimulado y no estimulado las células

Adultos caballo países en desarrollo el aumento de la mediana de IL-12p40 e IFN α mRNA expresión 53 y 23 veces, respectivamente, a CpG ODN-estimulación, en comparación con los no-estimulado países en desarrollo (p = 0.078). Adultos caballo-CpG ODN estimulada macrófagos no cambió su expresión mRNA de citoquinas en comparación con los no-estimulado las células (Figura 4]. Potro vehículos blindados no cambió de expresión mRNA de citoquinas en una edad que dependen de manera a-CpG ODN estimulación hasta 3 meses de edad, sino que, al azar veces se observaron diferencias en los datos con ambos CpG ODN-LPS y estimulación (Figuras 5 y 6] . La expresión de IL-12p40 e IFN α en caballos adultos no estimulado países en desarrollo son comparables a países en desarrollo potro en el momento del nacimiento (p> 0,05). A pesar de los distintos valores medios, no hubo una diferencia estadísticamente significativa en CpG ODN-estimulado las células entre ambos grupos. Con el fin de evaluar si se LPS inducir un patrón diferente de expresión de citocinas que CpG ODN-, hemos probado TNF α mRNA expresión en un pequeño subconjunto de las muestras de caballos adultos: a las 14-16 horas, CPG-ODN estimulada países en desarrollo reveló a 5 veces aumento en comparación con los no-estimulado países en desarrollo, mientras que el LPS-estimulado países en desarrollo-1 puso de manifiesto una disminución veces. Estimulado y no estimulado macrófagos no mostró diferencias en sus TNF α mRNA expresión.

TLR9 y NF-kB vía de señalización

TLR-9 expresión mRNA en potro países en desarrollo y los macrófagos fueron comparables (p> 0,05) a las células adultas caballo, y CPG-ODN upregulation inducida por el tratamiento de un 1 veces en comparación con los no-estimulado y LPS-estimulado las células (Figura 7 ). Los valores de NF-kB activación (NF-kB p65) fueron comparables (p <0,05) en adultos caballo y potro macrófagos y países en desarrollo, independiente del tratamiento.

Discusión
Edad dependiente de los aspectos de vehículos blindados en el caballo

Limitaciones en el sistema inmunológico del Potro podría estar asociada con la edad de desarrollo dependiente de interacción célula primaria de la respuesta inmune. La baja expresión de MHC clase II en equinos recién nacido y jóvenes potro linfocitos de sangre periférica ha sido bien documentado, pero la expresión de esta molécula esencial en vehículos blindados no se había estudiado antes en el potro [34, 35]. Nuestra investigación reveló 2 observaciones importantes: a) existe una diferencia estadísticamente significativa en la fluorescencia de expresión de MHC clase II en macrófagos y los países en desarrollo de los potros con la edad, y b) la mediana de MHC clase II en expresión de fluorescencia no estimulado macrófagos y de los países en desarrollo potrillo al nacer fueron 12,5 veces y 11,2 veces inferior, respectivamente, a caballo de células adultas. La mediana de MHC clase II en expresión de fluorescencia no estimulado países en desarrollo, de 3 meses de edad-los potros es comparable a caballos adultos, lo que sugiere una mayor competencia para el cebado de las células T a esa edad. En los fetos humanos, el porcentaje de MHC clase II-positivas monocitos aumenta considerablemente durante la gestación, pero sigue siendo inferior al de adultos humanos a plazo [36]. Limitación en el número de APC y en función de corta edad se ha demostrado que contribuyen a una mala protección de la respuesta inmune celular [37 - 39]. Humanos de sangre de cordón países en desarrollo son menos eficaces en la activación de células T in vitro y la instrucción a un tipo 1 respuesta inmune, probablemente debido a su menor superficie celular MHC de clase I y II, co-estimuladoras (CD86), y la molécula de adhesión que los niveles de expresión adultos células de la sangre humana [40].

Del mismo modo, la expresión de citoquinas y co-estimuladoras moléculas (señal II) en vehículos blindados no se había estudiado antes en potros. Estos importantes mediadores inmunes son fundamentales para la imprimación y la expansión clon de células T ingenuas. No hubo diferencias estadísticamente significativas en la expresión de CD86 en macrófagos y potro países en desarrollo. Además, no hay edad que dependen de los cambios en la expresión de CD86. Es importante destacar que estos valores son comparables a las de adultos caballo, y sugieren que vehículos blindados de los potros son competentes en la expresión de los CD86 co-estimuladoras molécula.

Respuesta al estímulo

CpG ODN-2135 es una herramienta funcional para evaluar la respuesta inmune innata en los potros, y comparar esos resultados para adultos caballo respuesta. Hemos aprendido que los adultos caballo países en desarrollo, pero no los macrófagos, un aumento de la IL-12p40 e IFN α mRNA expresión 53 y 23 veces, respectivamente, en comparación con los no-estimulado países en desarrollo, mientras que el potro países en desarrollo no respondió específicamente a ese estímulo hasta 3 meses de vida. A pesar de la falta de diferencia estadística, el contraste entre el potro y caballo de células adultas de citoquinas respuestas a CpG ODN-no debe pasarse por alto, pero más perseguidos para una mejor comprensión de potro respuesta a los distintos tipos de agentes patógenos y vacunas o los adyuvantes. Otros CpG ODN motivos-podría inducir a los diferentes tipos y la magnitud de la respuesta de los adultos caballo y potro células. Sin embargo, la CPG-ODN motivo se utiliza en este documento puso de manifiesto una diferencia entre adultos caballo y potro DC respuesta. De hecho, en nuestros estudios piloto, este mismo CpG ODN-inducida por una mayor proliferación en los índices de adultos caballo leucocitos de sangre periférica de células potro.

Interleucina-12 es una molécula compuesta heterodimeric de P35 y p40 subunidades. Al CpG ODN-estimulación, los adultos caballo países en desarrollo aumentó la expresión de IL-12p40, que no se vio acompañada por la magnitud de IL-12p35. Holscher et al. [41] demostró una protección y agonística papel de la IL-12p40 en infección por micobacteria en IL-12p35 knockout mouse. Este efecto podría inmunológico se han asociado con la expresión de IL-23, que comprende la misma subunidad p40 de la IL-12, pero otra subunidad p19. Por lo tanto, es posible que la IL-12p40 respuesta a CPG-ODN en adultos caballo países en desarrollo pueden reflejar la expresión de IL-23, en su lugar, y que necesita ser probado. Considerando que IL-12 promueve el desarrollo de células T ingenuas, IL-23 participa en la activación de células T de memoria y la inflamación crónica, y esta diferencia es relevante al estudiar el desarrollo de respuesta inmune primaria en potros [42].

Los dos IL-12 e IFN α promover la activación de células T de tipo 1 en la respuesta inmune, con la activación, proliferación y producción de IFN γ [43, 44]. Posteriormente, CD40-ligando compromiso y IFN γ de las células T activadas facilitar la producción de IL-12 de vehículos blindados [45, 46]. De hecho, un ratón convencional países en desarrollo requieren IFN-γ co estímulo para la producción de la forma activa de IL-12 a TLR estimulación [47]. Por lo tanto, una alteración de citocinas de señalización adecuado para la activación de APC en los potros no sólo podría dificultar una posterior Tipo 1 respuesta inmune primaria, sino también la correcta activación de vehículos blindados. De hecho, esto puede ser un factor limitante en los potros porque Breathnach et al. [48] han demostrado que el neonato equino de sangre periférica y pulmonar linfocitos presente una marcada baja respuesta para la producción de IFN γ, lo que mejora constantemente con la edad.

Comprometida Th1 diferenciación también se ha observado cuando hay CD4 + T cell hyporesponsiveness a IL-12 [49]. A temprana edad, DC maduración y producción de citocinas puede requerir específicos y co-estimuladoras estímulos, que pueden llegar a ser menos crucial de una forma más desarrollada (para adultos) del sistema inmunológico. Además, IL-12 puede ser la producción que antagoniza con la presencia de los anti-inflamatorios citocinas IL-10 y TGF β [50]. Potro países en desarrollo no alteró la expresión de IL-12 a la estimulación y, sin embargo, las células no se alteró la expresión de IL-10 tampoco. Por lo tanto, es poco probable la falta de IL-12 de respuesta se debió a un sesgo de la Potro células hacia un anti-inflamatorio estado, sino que es posible que esas células tienen una disminución global de respuesta al estímulo de hasta 3 meses de vida a través de TLR9 la vía de señalización [51].

Al igual que en CPG-ODN, LPS ha demostrado inducir la maduración DC con la producción de citocinas, sobre regulación de co-estimulantes moléculas y la activación de células T. Estos efectos no se observaron en nuestros datos. LPS estimulación inflamatoria involucra tanto comunes como las diferentes vías hacia la CPG-ODN, y distinta expresión de citoquinas cinética se ha observado [17, 52]. Para investigar si se LPS inducir un patrón diferente de respuesta de citoquinas, que evaluó el TNF α mRNA expresión en un subconjunto de muestras de caballos adultos. A las 14-16 horas de estimulación, CPG-ODN-o LPS-estimulado países en desarrollo expresaron TNF α mRNA con una mediana de 5 veces mayor y el 1 º de veces una disminución, respectivamente, en comparación con los no-estimulado las células. Es posible que los picos de expresión de citoquinas LPS-estimulado países en desarrollo se perdieron en el momento en que las células han sido recolectados, y la medición de los niveles de proteína habría sido una mejor comparación.

Dos clases de CpG se han descrito para inducir efectos diferentes en las células humanas: CpG-A y B-CpG. El primero tiene una phosphodiester básico con motivos CpG, flanqueado por phosphorothioate poli (G), tanto en las secuencias de los 3 'y 5' termina; este último se debe principalmente a phosphorothioate, nucleasa resistentes espina dorsal [53, 54]. CpG-A ha sido conocida originalmente para estimular plasmacytoid países en desarrollo para expresar grandes cantidades de IFN α y CpG-B como un potente estimulador de la proliferación de las células B y la secreción de IL-10 [1, 3, 55, 56]. Ambos tipos de CpG para exigir TLR9 estimulación inmunitaria [57]. Sin embargo, sólo CpG-B se ha demostrado que activar NF-kB, mientras que CpG-A induce una respuesta mínima [58]. En nuestros estudios, la mediana TLR9 expresión es comparable a CPG-ODN tratada con LPS o macrófagos tratados con países en desarrollo y de potro y caballo de células adultas. NF-kB en la activación de macrófagos y potro países en desarrollo era comparable a las células adultas caballo, y CPG-ODN o LPS tratamiento no revelaron un efecto en cualquiera de los grupos. Por lo tanto, esos análisis no son informativos de los mecanismos implicados en la activación de las células a CpG ODN-estimulación.

Estructuralmente, las CpG ODN-se utilizan en estos experimentos es de clase B. Sin embargo, su efecto sobre las células caballo se asemejaba a la de clase A en otras especies por el aumento de IFN α expresión y la falta de tratamiento concomitante incremento en la expresión de NF-kB en el caballo adulto las células dendríticas. Distintas respuestas a CpG ODN-se han descrito en diferentes especies. Mena et al. [59] han puesto de manifiesto un propósito específico y dependiente de la dosis de IFN α respuesta a la clase B-CpG ODN motivo estimulada ovina, bovina, pero no, la sangre periférica de células mononucleares. Además, la clase B-CpG ODN ha demostrado inducir in vitro la producción de IFN α en los corderos recién nacidos, lo que parece contrastar con nuestros hallazgos en potros [60]. Sin embargo, es posible que el IFN α equina expresión en las células es mayor cuando las células son estimuladas con la clase A-CpG ODN. Wattrang et al. [19] demostraron que la clase A-CpG ODN de hecho IFN α induce la expresión de equinos de sangre periférica de células mononucleares.

La maduración de países en desarrollo medido por MHC clase II expresión a CpG ODN-estímulo no fue evidente en células adultas caballo, posiblemente porque las células ya expresar altos niveles de esa molécula en la superficie celular en el Día 5 de la ex vivo la cultura. Por otra parte, hubo mixta etapa de maduración en las células de cultivo celular así, y sólo una fracción de esas células se convirtieron en una mayor madurez con MHC clase II expresión. Nuestro análisis de citometría de flujo para MHC clase II expresión no incluye áreas específicas con acceso a la DC para mantener la población en consonancia con los datos del mRNA de citoquinas, que se generó a partir de la población de células enteras. Sin embargo, una subpoblación de células con una elevada lado y hacia adelante dispersa en el punto parcelas expresaron los más altos niveles de MHC clase II, y CPG-ODN estimulación inducida puede tener distintas incremento en la expresión de que la molécula en comparación con los controles.

Categorización de los derivados de los monocitos macrófagos y células dendríticas

El ex vivo modelo que aquí se presenta producido derivados de los monocitos y macrófagos países en desarrollo con características comparables a los resultados publicados [26, 33, 61, 62]. El Día 5 de cultivo celular, rEqIL-4 + rHuGM-CSF induce un ligero aumento en la expresión de MHC clase II molécula (fluorescencia), mientras que el número de células (porcentaje) que expresan CD14 molécula se redujo en comparación con el control. Estos resultados sugieren la generación de inmaduros países en desarrollo, lo que se desea para nuestros experimentos. Sin embargo, es poco probable que este sistema produce macrófagos o DC en las poblaciones de células sincrónica etapas de desarrollo. Tanto los macrófagos y los países en desarrollo se deriva principalmente de adherentes de sangre periférica de células mononucleares, y un alto porcentaje de células que expresan la molécula CD172a estuvo presente en el cultivo celular. Aunque CpG ODN-puede no haber inducido DC maduración de por sí, ya que clásicamente se mide (es decir, el aumento de MHC clase II expresión), sólo estimulado países en desarrollo (y no no estimulado países en desarrollo y estimuló macrófagos) inducida por IL-12p40 e IFN α expresión de citoquinas.

La clasificación de países en desarrollo es bastante compleja: la heterogeneidad de los países en desarrollo está determinado por el precursor de población, localización anatómica, función, y el resultado final de la respuesta inmune [15, 63]. Varios DC subconjuntos se han identificado en humanos y ratón, y algunas similitudes y diferencias existen entre las especies [64]. Dos grandes categorías, convencionales plasmacytoid países en desarrollo o países en desarrollo, pueden describirse en función de la célula origen, TLR expresión de citoquinas y perfil. El marcador de superficie celular CD11c ha sido un parámetro importante en la identificación de los países en desarrollo; sin embargo, un anticuerpo monoclonal que reconoce este marcador se carece de la especie equina. En general, los países en desarrollo convencional y TLR4 expresar plasmacytoid expresar TLR9 países en desarrollo, y otros TLRs puede o no ser expresados en los mismos tipos de células en ambas especies [65]. Además, convencionales países en desarrollo son conocidos por producir altos niveles de IL-12, mientras que plasmacytoid países en desarrollo producen IFN tipo I (IFN α) e IL-12 [16].

Hasta la fecha, no existe un único método fiable para la caracterización y clasificación de los países en desarrollo equina derivados de la sangre periférica o de periféricos o tejidos linfoides. Por lo tanto, la combinación de marcadores de superficie celular de expresión, utilizando los anticuerpos monoclonales disponibles para el caballo especies, y la expresión de citocinas a la estimulación preliminar puede revelar características de las células. No está claro a partir de nuestros análisis si las células productoras de IFN α e IL-12 fueron positivos o no para la CD172a y los marcadores CD14. Esta cuestión requeriría un doble tinción de citoquinas y marcadores celulares de superficie, y los reactivos no están ampliamente disponibles para las proteínas caballo a esta fecha. Por otra parte, este sistema genera un tipo de CC que no se ajusta a un determinado sistema de clasificación, como el descrito por Asselin-Paturel et al. [66], un único subconjunto de inmaduros murino con vehículos blindados plasmacytoid morfología que secretan IFN α e IL-12 tras la estimulación con virus y CPG-ODN.

Conclusión

Los resultados de nuestro sistema ex vivo sugieren que el potro vehículos blindados no responden al estímulo comparable a las células adultas caballo en la expresión de citoquinas. Además, esta investigación puso de manifiesto una edad que dependen de la limitación en la expresión de MHC clase II en la molécula de vehículos blindados del recién nacido y el potro joven, aunque la expresión de la co-estimuladoras molécula CD86 parece estar presente ya a principios de la vida. Nuestros estudios no son de carácter general para determinar los aspectos relacionados con el desarrollo intrínseco de los vehículos blindados potro, pero que aportan nuevas observaciones para apoyar futuros estudios en la competencia del potro células para obtener una respuesta inmune primaria, y en la elección de los adyuvantes para su uso en los jóvenes edad. CPG-ODN ha demostrado efectos positivos en DC maduración y activación de células neonatales de otras especies. Además, diferentes CPG-ODN motivos tienen efecto en las células inmunitarias. Otros tipos de estimulantes (por ejemplo, toda la inactivada Gram positivos o negativos organismos, virus inactivados, o distinto de CpG ODN motivos) puede indicar además los niveles de respuesta, las limitaciones y el potencial de vehículos blindados a las células T señal de una respuesta inmunitaria primaria a temprana edad.

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Autores de las contribuciones

MJBFF concebido el diseño del estudio, coordinado el estudio, realizado la extracción de sangre, y análisis de citometría de flujo. HCH realizado el cultivo celular, las células de recolección y congelación. ASB realizó el aislamiento de ARN, en tiempo real cuantitativa RT-PCR, ensayo y quimioluminiscencia. DWH siempre orientación técnica y los reactivos para el cultivo celular. RH determinado y siempre que el motivo para ser utilizados en los experimentos. MJBFF ASB y preparó el proyecto del manuscrito. DVN y ASB realizó el análisis de datos. Todos los autores leer y contribuyó a la versión final del manuscrito.

Agradecimientos

Los autores desean agradecer a Carol Collyer y personal de la Universidad de Cornell Equinos Parque para facilitar el manejo de los potros. También damos las gracias al doctor Philip J. Griebel Veterinaria de la Organización de Enfermedades Infecciosas (VIDO), Saskatchewan, Canadá por su perspicaz comentarios y sugerencias. Este estudio fue apoyado por el Harry M. Zweig Memorial Fund para Equinos de Investigación y CAPES de Brasil de becas (ASBorges).