BMC Microbiology, 2007; 7: 9-9 (más artículos en esta revista)

El virus dengue tipo 2: la replicación y en tropisms infectados oralmente los mosquitos Aedes aegypti

BioMed Central
Ma Isabel Salazar (isalazarsan@yahoo.com) [1], Jason Richardson H (jrichardson@wrp-ksm.org) [1], Irma Sánchez-Vargas (irsava8@yahoo.com) [1], Ken Olson E (kolson @ colostate.edu) [1], Barry Beaty J (bbeaty@colostate.edu) [1]
[1] sufragados por artrópodos y Laboratorio de Enfermedades Infecciosas (AIDL). Departamento de Microbiología, Inmunología y Patología, Universidad del Estado de Colorado, Fort Collins, Colorado. 80523-1692, EE.UU.

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

Para ser transmitida por su mosquito vector, el virus del dengue (DENV) midgut debe infectar las células epiteliales, reproducir y difundir en la hemocoel, y finalmente infectar las glándulas salivales, lo que es esencial para la transmisión. El período de incubación extrínseco (PAE) es muy pertinente epidemiológicamente y es el tiempo necesario de la ingestión de virus hasta que se puede transmitir a la próxima huésped vertebrado. El PAE está condicionada por la cinética y tropisms de la replicación del virus en su vector. En este sentido, el documento virogenesis de DENV-2 en recién colonizados los mosquitos Aedes aegypti de Chetumal, Mexico, a fin de comprender mejor el efecto de virus-vector interacciones en la transmisión del dengue.

Resultados

Después de la ingestión de DENV-2, midgut infecciones en Chetumal mosquitos se caracterizaron por un pico en los títulos de virus entre 7 y 10 días post-infección (dpi). La cantidad de antígeno viral y los títulos virales en la midgut luego disminuyó, pero los niveles de ARN viral se mantuvo estable. La presencia de DENV-2 de antígenos en la tráquea se correlacionó positivamente con el virus de la difusión de la midgut. DENV-2 antígeno se encontró en tejido glandular salival en más de un tercio de los mosquitos a las 4 ppp. A diferencia de la midgut, la cantidad de antígeno viral (así como el porcentaje de infectados glándulas salivales) ha aumentado con el tiempo. DENV-2 también antígeno y el aumento acumulado en el tejido neural a lo largo del PAE. DENV-2 antígeno fue detectado en múltiples tejidos del vector, pero a diferencia de otros arbovirus, no se detectó en el músculo.

Conclusión

Nuestros resultados sugieren que las PAE de DENV-2 en su vector puede ser más corto que el de informes anteriores y que el sistema traqueal puede facilitar DENV-2 difusión de la midgut. Mosquito órganos (por ejemplo, midgut, de tejidos neural, y las glándulas salivales) difieren en su respuesta a DENV-2 infección.

Fondo

El dengue es una artrópodos cargo enfermedad viral de gran importancia para la salud pública en todo el mundo. Actualmente, la pandemia de dengue afecta a más de 100 países, entre ellos naciones en África, las Américas, el subcontinente indio, el sudeste de Asia, el Mediterráneo Oriental y el Pacífico Occidental [1]. La Organización Mundial de la Salud (OMS) estima que hay 50 millones de casos anuales de infección por dengue en todo el mundo, alrededor de 500000 ingresos hospitalarios, el dengue y 22000 muertes relacionadas con el. A nivel mundial, más de 2,5 millones de personas están en riesgo de esta enfermedad. La aparición del dengue en las Américas ha sido especialmente dramático [2, 3].

El virus dengue (DENV) se compone de cuatro estrechamente relacionados, pero antigénicamente diferentes serotipos (DENV-1, DENV-2, DENV-3 y DENV-4), varios genotipos adjunta a cada serotipo [4]. El mosquito Aedes aegypti es el principal vector de los cuatro serotipos. Los mosquitos se infectan después de alimentar a una persona viremic, informó entonces un EIP de 7-14 días se necesita antes de que los mosquitos pueden transmitir el virus a un nuevo huésped [2, 5]. Los factores ambientales (incluida la temperatura y humedad), así como factores intrínsecos (como vector de la competencia y genotipo viral) afecta a la PAE [6].

Anfitrión de órganos y células susceptibilidad y permisividad condición tropisms virus en un organismo [7]. Un número de estudios han investigado DENV-la interacción vector [8 - 14], y el importante papel del virus genotipo eficaz en la infección por Aedes aegypti se ha puesto de manifiesto [15]. En este estudio, hemos querido determinar el virogenesis de DENV-2 en la infección recientemente colonizado los mosquitos vectores del dengue de un área endémica, que anteriormente se había demostrado que son muy susceptibles a la infección DENV [16].

En el curso natural de la infección por el virus, DENV se ingiere en la harina de sangre, entonces los encuentros y deben vencer midgut infección y escapar de los obstáculos [17], que varían entre las poblaciones de mosquitos. La infección del mosquito midguts se sabe que ocurren en un dependiente de la dosis de manera [16]. Elucidación de la cinética de replicación y tropismo del virus en recién colonizados (campo pertinente) los mosquitos Aedes aegypti proporcionaría una mejor comprensión de la transmisión potencial y virus-vector interacciones que condicionan la epidemiología del dengue y potencial epidémico. En este estudio, se determinó: 1) la cinética de DENV infección por mosquitos infectados por vía oral, 2) el DENV-2 tropisms de mosquitos diferentes tejidos y órganos, 3) una posible explicación anatómica para la difusión del virus de la midgut, y 4) la mínimo tiempo necesario para la infección de las glándulas salivales en poco colonizados los mosquitos Aedes aegypti de Chetumal, Mexico y en una larga colonizados o un seleccionado Aedes aegypti cepa.

Resultados
Mosquito Aedes aegypti susceptibilidad a DENV-2 Jam1409

Los tres mosquito Aedes aegypti cepas probadas fueron sensibles a DENV-2 Jam1409 midgut infección y difusión, tal como se determina mediante la detección de DENV-2 de antígenos en midguts y tejidos cabeza a los 14 días post infección de la sangre (dpi) (Figura 1]. El midgut las tasas de infección (MIR) fueron similares entre Chetumal (87 ± 8%) y D2S3 (90 ± 7%), mientras que fueron menores a Rex-D (70 ± 7%) mosquitos. La difusión tasas (DR) en Chetumal mosquitos fueron mayores (78 ± 10%) que en el laboratorio adaptado Rex-D mosquitos (57 ± 10%). Como era de esperar, los mayores índices de difusión se observaron en los D2S3 mosquitos (90 ± 7%). Un ANOVA de una manera análisis indicó que los medios fueron significativamente diferentes para los MIR (P = 0,006), así como para DR (P = 0,002) entre las tres poblaciones de mosquitos. El MIR y RD entre Chetumal y D2S3 mosquitos no difirió significativamente.

DENV-2 Jam1409 inicial de la infección, replicación, y la modulación de la infección en midguts

Después de la ingestión de DENV-2, midguts fueron los primeros a convertirse en tejidos infectados. En 2 dpi, unos individuo infectado las células epiteliales se distinguen en ~ 30% de midguts. Al día 3, midgut focos de infección que participan múltiples células. Infección propagación lateral de esta etapa inicial a las células vecinas (probablemente debido al virus de liberación en ciernes como se observa en las células de invertebrados), con frecuencia la participación de todo el órgano de 7-10 dpi. Luego, a partir de día 10, pero más notablemente a los 14 dpi, la cantidad de antígeno vírico en el midgut comenzó a declinar. A las 21 dpi antígeno viral fue casi indetectable, ya sea por la policlonales o monoclonales anti-dengue anticuerpos, en midguts de Chetumal (Figura 2] y en Rex-D de control de los mosquitos (datos no presentados). En contraste, otros órganos y tejidos, incluyendo la grasa corporal, las glándulas salivales, y el sistema nervioso en el mismo Chetumal mosquitos contenían gran cantidad de antígeno del virus durante el transcurso del tiempo.

DENV-2 + ARN sentido, así como virus infeccioso en Chetumal mosquito midguts se cuantificó por Q-PCR y el punto final de titulación, respectivamente, a las 7, 14 y 21 dpi. En este marco de tiempo, el ARN del virus se mantuvo estable (entre 7,2 y 7,6 log 10 copias de ARN / midgut) según lo determinado por Q-PCR (Figura 3-A]. En contraste, entre 7 y 21 dpi, el virus de títulos se redujo de 6 a 4 Log10 TCID 50 / midgut (P <0,001) según lo determinado por el punto final titulaciones (Figura 3-B].

La presencia de antígeno vírico en el sistema traqueal se correlaciona con DENV-2 difusión en Chetumal mosquitos

Análisis de los mosquitos entre el 2 y 10 dpi reveló la presencia de DENV-2 antígeno en partes del sistema traqueal a 35 ± 5% de la sangre alimenta los mosquitos. La detección temprana de DENV-2 de antígenos en el sistema traqueal se produjo a las 2 dpi, seguido a 3, 4, 5 y 7 dpi y luego disminuyó notablemente. Antígeno viral no se detectó a través del sistema traqueal, sino que más bien se limitaba a pequeñas secciones de tráquea su mayoría procedentes de la zona abdominal y que muestra una característica patrón de distribución (Figura 4]. La presencia de antígenos virales en la tráquea y la difusión del virus de la midgut en Chetumal mosquitos fueron fuertemente correlacionada a los 2, 3 y 5 dpi (cuadro 1]. Esta asociación se había ido de 7 dpi (cuadro 1] y, posteriormente, (datos no presentados). El criterio para la infección diseminada es la presencia de antígeno vírico en cualquier órgano o tejido que no sea el midgut o el sistema traqueal: la pronta difusión se detectó con mayor frecuencia en throracic abdominal y la grasa corporal, las glándulas salivales y las células nerviosas y los tejidos. En contraste con los mosquitos Chetumal, antígeno viral rara vez se asocia con infección de la tráquea Rex-D mosquitos.

DENV-2 difunde rápidamente a las glándulas salivales de los mosquitos Chetumal

DENV-2 se detectó en las glándulas salivales del 36% de la sangre alimenta a los mosquitos Chetumal 4 dpi. En el Rex-D mosquitos, esta glándula salival tasa de infección no se produjo hasta el 10 dpi y en sólo 7 ppp <15% de las glándulas salivales de Rex-D mosquitos que figura antígeno vírico. Temprano por la infección, la región distal de los lóbulos laterales con frecuencia la zona de la glándula salival que contienen el antígeno viral; medial y proximal lóbulos se infectaron más tarde. Las células en el lóbulo lateral distal puede contener DENV receptores o más receptores, pero esto queda por determinar. El porcentaje de infectados glándulas salivales, así como la cantidad de antígeno viral en la glándula aumento de las horas extraordinarias, lo que revela un importante DENV-2 tropismo por este tejido (Figura 5].

DENV-2 tropisms para diversos tejidos y órganos a los mosquitos

El tropisms de DENV-2 a Jam1409 órgano de tejidos que no sean midguts glándulas salivales y se determinó a través del tiempo en Chetumal mosquitos. DENV-2 antígeno fue detectado en los tejidos cabeza a los 5 dpi, y antígeno seguido acumulando en estos tejidos en todo el PAE. Antígeno viral se detectó en la grasa corporal de la abdominal, torácica o regiones cefálica constantemente a lo largo del tiempo. DENV-2 para la difusión de grasa abdominal cuerpo fue detectado en 35% de los mosquitos entre el 2 y 3 dpi (Figura 6, panel A) y en el 62% de los tejidos abdominales a la vez otros puntos. Así, la grasa corporal representa un importante sitio para DENV-2 en la reproducción del vector. Es interesante la grasa corporal también juega un papel clave en el desencadenamiento de la respuesta inmune de insectos contra los agentes patógenos. Por lo tanto, sería importante para determinar los posibles efectos de la infección por el virus de la grasa corporal en vector competencia.

La musculatura que rodea la midgut no contienen el antígeno del virus en cualquiera de los puntos examinados tiempo en ninguna de las poblaciones de mosquitos incluidos en nuestro estudio (Figura 6-C]. Otros órganos y tejidos infectados incluyen: tráquea, esófago (Figura 6-E], hemocitos (Figura 6-F], ommatidia de los ojos compuestos (Figura 6-G], tejido nervioso (Figura 6-H], y malphigian túbulos ( Figura 6-I]. De vez en cuando DENV-2 antígeno se observó en el anterior midgut (Figura 6-D] y no en la hindgut (Figura 6-I] o cardias (Figura 6-E]. En conjunto, estos datos revelan la cinética de infección y tropisms de DENV-2 en mosquitos, como se muestra en la Figura 7.

Cinética de DENV-2 títulos virales en Chetumal mosquitos

Para establecer la cinética de DENV-2 de replicación, los títulos virales se determina por ensayo de placa de cada uno de los mosquitos en diferentes puntos del tiempo (Figura 8]. DENV-2 títulos aumentado con el tiempo, y osciló entre 2,2 a 5,5 Log10 PFU / mosquito. Virus infeccioso fue detectable a las 3 ppp. Dos pequeñas gotas en el conjunto de los títulos virales se observó: uno a 14 dpi y el otro en 21 dpi. Cinética de la replicación del virus durante el DENV-2 infección en varios tiempos se muestran en la Figura 8.

Discusión

Cada una de las cepas de mosquitos examinados son susceptibles de DENV-2. Sin embargo, los Chetumal y D2S3 cepas fueron claramente más susceptibles a DENV-2 la infección que los Rex-D mosquitos (Figura 1]. DENV-2 en la replicación infectados Rex-D mosquitos también fue más lento que en Chetumal mosquitos (datos no presentados). Lamentablemente, no hemos tenido una larga colonizados cepa de mosquitos a Chetumal para comparar la cepa recién colonizados. La colonización se ha demostrado que para seleccionar ciertos genotipos en Aedes aegypti [18]. De este modo, el uso de largo colonizado los mosquitos, así como de alta passaged virus de una zona podría confundir la interpretación de la actual epidemia de DENV potencial en esa esfera. Sería prudente para estudiar el vector de patógenos sobre el terreno utilizando los mosquitos, así como bajo el paso de los virus de un área específica con el fin de sacar conclusiones más precisas acerca del riesgo de transmisión del dengue en esa zona.

Es sorprendente que los mosquitos se Chetumal como permisivo a DENV-2 productivos como la infección por la cepa D2S3, que fue seleccionado para DENV susceptibilidad [19]. El fenotipo susceptible es probablemente condicionada por diferentes mecanismos genéticos, que quedan por determinar. Sin embargo, los resultados confirman estudios previos que demuestran que los mosquitos de la zona oriental de la península de Yucatán (un área endémica para dengue) son extraordinariamente competentes vectores de DENV [16].

DENV-2 infección se detectó en las células epiteliales midgut tan pronto como 2 dpi. Los títulos virales y de antígenos del virus de entonces aumentó hasta el 10 dpi cuando ambos virus título y antígeno disminuyó (Figura 2 y 3]. En contraste, Q-PCR reveló que el ARN del virus de número de copias se mantuvo bastante constante, incluso en fines de la EIP (Figura 3]. Por el contrario, DENV-2 antígeno no se borrará de las glándulas salivales o en los tejidos neuronales tiempo equivalente puntos. El primero es la observación de interés, porque una vez un mosquito infectado es productiva con un arbovirus, ella es capaz de transmitir el virus de por vida. Obviamente, cualquier virus de la modulación en las glándulas salivales se epidemiológicamente importantes desde el rendimiento de transmisión puede reducirse. Modulación de virus en el midgut es provocativo, ya sea el virus o el epitelio está activa en la modulación de la infección por el virus. La presencia continua de DENV-2 ARN sugiere un probable mecanismo de persistencia en vectores. DENV-2 como otros arbovirus pueden infectar persistentemente insectos y líneas celulares humanas y de artrópodos vectores [20 - 23]. Es poco probable que la modulación está condicionada por la actividad metabólica del epitelio midgut, porque un segundo uninfectious harina de sangre siempre 14 días después de DENV-2 infección de Aedes aegypti no para restablecer la producción de virus en la midgut (datos no presentados). La disminución de virus infeccioso y el antígeno viral puede estar asociada con una respuesta antiviral, post-transcripcional o post-translacional la represión, o de otro tipo auto-limitación de factores tales como las células epiteliales estado fisiológico (es decir, envejecimiento celular). Más estudios serán necesarios para dilucidar los factores moleculares determinantes de este fenómeno.

El mecanismo (s) por la que difunde DENV de la midgut no se conocen bien. Este estudio sugiere que el sistema traqueal de mosquitos pueden estar implicados en la difusión DENV (Figura 4 y Cuadro 1]. La presencia del antígeno del virus en el sistema traqueal significativamente correlacionado con DENV-2 difusión, en su mayoría entre 3 y 5 dpi. Tracheoles forman parte del sistema traqueal, son 0,2 a 1 μ m de diámetro, están llenos de fluido, y llegar a todos los tejidos en los insectos. El sistema traqueal se ha informado a actuar como conducto para la difusión de virus diferentes a los insectos. Entre los ejemplos notables son Autographa californica M virus de la poliedrosis nuclear (AcMNPV) infectando Trichoplusia ni, nucleopolyhedrovirus infectar Bombyx mori, y el virus Sindbis en Aedes albopictus [24, 25]. El sistema traqueal también se sospechaba que era el midgut conducto para escapar de la encefalitis equina venezolana virus (VEEV) en Ochlerotatus taeniorhynchus [26]. Sin embargo, este es el primer informe que indica que DENV podrá utilizar el sistema traqueal de mosquitos durante la difusión.

A diferencia de una serie de otros arbovirus, DENV mostradas no tropismo para midgut asociados (Figura 6-C] o los músculos de vuelo. Fiebre del Valle del Rift virus infecta tanto esquelético y visceral músculos [27]. Sindbis virus se replican en los músculos viscerales de Aedes albopictus [28]. West Nile virus infecta a las contiguas músculos de la parte posterior y anterior midgut a los mosquitos Culex [29]. Las razones de mosquito músculo refractariedad a DENV se desconocen y que requieren un análisis más detallado. Fiebre del Valle del Rift y virus Sindbis Alfavirus exposición tropisms para cardias tejido [11, 30], mientras que DENV-2 no se encuentran en este tejido.

Curiosamente, DENV-2 infección se detectó en el 36% de Chetumal glándulas salivales del mosquito de 4 dpi. En contraste, <15% de D-Rex había mosquitos infectados glándulas salivales a las 7 dpi y glándulas salivales de las tasas de infección> 36% no se detectaron hasta 10 ppp. La Chetumal mosquitos que parecen ser más competentes vector que el Rex-D mosquitos. Al parecer el PAE para DENV es entre 7 y 14 días, y que puede verse afectada por condiciones como la temperatura, la humedad y el virus de la dosis [2, 5, 6, 31]. Sangre comidas siempre a los mosquitos en nuestros estudios figuran 1,7 ± 0,7 × 10 7 PFU / ml, es probable que biológicamente relevante, ya que la viremia títulos de DENV-2 en los seres humanos pueden variar entre el 10 de 2 a 10 7 PFU / ml o 10 3 a 10 8 TCID 50 / ml [32, 33]. En nuestras observaciones, los lóbulos laterales distal eran a menudo el primer sitio de la infección en las glándulas salivales, la medial y proximal lóbulos desarrollado la infección más tarde (Figura 5]. Este patrón probablemente se debe a la mayor concentración de virus en los receptores de esta región de las glándulas salivales, pero esto aún no se han determinado. El lateral distal lóbulos participar prominente en la secreción de enzimas y proteínas implicadas en la hematofagia [34, 35], por lo tanto la infección de esta región podría promover la pronta transmisión del virus. Otros estudios han demostrado que DENV-2 puede ser transmitida por los mosquitos con <25% de glándula salival tejido infectado, si la infección se produjo en los lóbulos laterales [31]. Por lo tanto, nuestros resultados sugieren que las PAE para DENVs puede ser más corta que la frecuencia (por lo menos con algunas cepas del vector). No hay sensible y fiable modelo animal de laboratorio para dengue, y que actualmente se utilizan ensayos in vitro para la transmisión podría no detectar pequeñas cantidades pero transmisibles de virus en épocas anteriores. Sin embargo otros estudios será necesario demostrar que el virus infeccioso se transmite a principios de la EIP y que los resultados pueden extrapolarse a la baja passaged DENV cepas.

A más corto EIP para el dengue tendría importantes consecuencias epidemiológicas en la transmisión del dengue. En la naturaleza, Aedes aegypti hembra mosquitos pienso con frecuencia y casi exclusivamente en los seres humanos, lo que confiere una mayor aptitud que se alimentan de otros hosts [36]. Estos mosquitos muy anthropophilic Mayo ingerir 2 a 3 bloodmeals durante un solo ciclo gonadotropic, la alimentación con una frecuencia de 0,63 a 0,76 veces al día [37]. Mosquitos Aedes aegypti, con muy poco EIP, persistentemente infectados glándulas salivales, y la capacidad de la alimentación varias veces dentro de un ciclo gonadotropic, parece ser, en última instancia, DENV vector, lo cual podría ayudar a explicar el potencial de la epidemia de dengue.

Conclusión

Los resultados con el recientemente colonizados Chetumal mosquitos indicar que el PAE para DENVs puede ser más corto que el comúnmente observadas, que podría tener importantes consecuencias epidemiológicas en la transmisión del dengue. El sistema traqueal de mosquitos aparece implicado en la difusión del virus de la midgut, y la infección viral en el vector es modulada diferencialmente a los distintos órganos. DENV-2 muestra las diferencias en algunos tejidos tropisms en su vector, en comparación con otros arbovirus en sus respectivos vectores.

Métodos
La cría de mosquitos

El recién colonizados Aedes aegypti Chetumal cepa se caracterizó por su vector competencia para DENV-2 [16, 38]. Chetumal mosquitos (F3 - F6) fueron originalmente recogidos en el de la Península de Yucatán, Mexico. Los mosquitos se crían rayada y como se informó anteriormente [16, 17, 38]. Después de incubar las pupas son mujeres separadas de los machos de tamaño, ya que los machos son considerablemente más pequeños; transferidos en copas de plástico para envases de cartón y que se les permita salir. Los mosquitos adultos se mantuvieron a 28 ° C, 70-80% de humedad relativa, con un 12-12 h luz-oscuridad fotoperíodo. Los mosquitos utilizan como controles en tropismo experimentos fueron los de Puerto Rico-Rex-D cepa (a largo colonizados cepa de laboratorio) [39] y la cepa D2S3 (un laboratorio seleccionado, altamente susceptibles carece cepa mosquito midgut escapar una barrera) [19].

La propagación de virus

Un alto paso DENV-2 cepa (Jamaica 1409) [40] se obtuvo de los Centros para el Control de Enfermedades y Prevención (CDC-Fort Collins, CO, EE.UU.). El virus ha sido sistemáticamente passaged (> 25 veces) en cultivo de células C6/36, pero sólo había dos cambios relevantes en comparación con la baja passaged virus como el de larga duración se indica la secuencia de análisis [41]. Estos cambios fueron un conservador de sustitución de aminoácidos en la proteína E 6 (Ile → Met) y un cambio de nucleótido en el 3'UTR 143 (G → T). El C6/36 cultivos celulares fueron infectados en una multiplicidad de infección (MOI) de 0,001 y se incuba a 28 ° C durante una semana. Al día 7, el medio fue reemplazado con un nuevo medio, y en 12 días post-infección por virus fue cosechada a preparar bloodmeals infecciosas [16, 42].

Oral infección de los mosquitos con DENV-2

Los mosquitos Aedes aegypti fueron retados con el DENV-2 Jam1409 utilizando una harina de sangre artificial [16]. En pocas palabras, 100-150 Aedes aegypti hembra mosquitos, 4 - 7 días post-emergencia, se ven privados de azúcar durante 24 horas y el agua durante 8 h antes de la bloodfeeding. El virus de monocapas de células infectadas se raspó el frasco de superficie, y 2 ml de esta suspensión fue agregado a una cantidad igual de ovejas eritrocitos lavados para preparar la harina de sangre infecciosas, que fue proporcionada a los mosquitos utilizando una membrana de alimentación del dispositivo. La comida se mantiene a 37 ° C por agua caliente que circula a pesar de una chaqueta externa. Los mosquitos no se les permitía alimentar a más de 45 minutos para evitar una disminución en los títulos virales. Sangre comidas que figuran los títulos virales de 1,7 ± 0,7 × 10 7 PFU / ml. La sangre alimenta los mosquitos fueron separados utilizando una tabla chill, transferidos para limpiar los envases de cartón, y mantiene a como se ha señalado anteriormente.

Ensayos de inmunofluorescencia indirecta (IFA)

Para determinar viral tropisms, mosquito (n = 30-40) se examinaron los tejidos para detectar la presencia de antígeno del virus después de disecar midguts y glándulas salivales y su aplastamiento thoraxes, cabezas y abdomen en diapositivas.

Midguts fueron disecados en PBS y fijadas en paraformaldehído al 4% (Microscopía Electrónica, Hatfield, PA) durante al menos 4 h. El fijador fue retirado, enjuagar una vez en PBS y, a continuación, se incubaron durante 1 h a temperatura ambiente con el constante balanceo en una solución que contenga: 1 × PBS-Ashburner la solución (13 mM NaCl, 0,7 mM Na 2 HPO 4, 1 mM NaH 2 PO 4 a pH = 7,2), el 1% de albúmina sérica bovina, y el 0,1% Tritón X-100, llamado PBT-0.1 (PBS-BSA-Tritón). Normalmente para detectar DENV-2 de antígenos de IFA, que es el principal anticuerpo fue el serotipo específico de ratón 3H5-1 anticuerpo monoclonal (ATCC número HB-46). Para confirmar la disminución de DENV-2 en midguts antígeno, un policlonal humano anti-dengue de anticuerpos específicos (Biodesign International, Saco, ME) también se utiliza como el principal anticuerpo. Midguts fueron incubadas con una dilución 1:400 de cabra-antimouse anticuerpo conjugado con Alexa fluorocromo-488 (Molecular Probes Inc, Eugene, Oregón). Midguts se lavaron dos veces con PBT-0,1 con balanceo constante a temperatura ambiente durante 2 horas y se incubaron con una dilución 1:40 de Phalloidin-Alexa 546 (Molecular Probes Inc, Eugene, Oregón) por 20 min. Midguts se enjuagarse con PBS y se coloca en diapositivas, cubierto con Vectashield ® (Vector Laboratories Inc, Burlingame, CA), y un cubreobjetos se selló con esmalte de uñas en la diapositiva. Los preparativos fueron examinados usando la Olympus BH2-RFCA epifluorescente microscopio o un microscopio confocal (FVX-IHRT Fluoview confocal, LSM, Olympus).

Glándulas salivales fueron disecados en PBS en Vectabond ® (Vector Laboratories Inc, Burlingame, CA) pretratados diapositivas, fijados en acetona fría o fija en el 4% de paraformaldehído-2% glutaraldehído, y mantiene a 4 ° C hasta immunosassay. Abdomen, thoraxes y jefes fueron aplastados en vidrio Vectabond ®-pretratados diapositivas, fijados en acetona fría durante 15 minutos, y se mantiene a 4 ° C

IFA se utilizó para detectar DENV-2 de antígenos en las glándulas salivales, thoraxes, abdomen y cabeza. El principal serotipo monoclonal específico de DENV-2 anticuerpo 3H5-1 fue diluido 1:200 en PBS e incubadas durante 1 h en el tejido. Diapositivas fueron lavados dos veces por 5 min con PBS, y de cabra anti-ratón conjugado avidina-anticuerpo secundario que contenga 0,01% Evans Blue (1:200; Amersham Pharmacia Biotech, Piscataway, NJ) fue añadido. Después de 40 min, las muestras se lavaron 2 × en PBS e incubadas durante 20 minutos con una dilución de 1:200 fluoresceína streptavidina (Amersham Pharmacia Biotech, Piscataway, NJ). Tras otros dos lavados de PBS de 5 minutos cada uno y una con agua destilada, DABCO petróleo se añadió a los tejidos y se añadieron cubreobjetos. Todas las incubaciones se realizaron a 37 ° C. Un Olympus BH2-RFCA microscopio de fluorescencia se utilizó para examinar las diapositivas.

Determinación de midgut infección y difusión tasas

La tasa de infección midgut (MIR) se determinó como el número de midguts que contengan DENV-2 antígeno dividido por el número de midguts examinados. La tasa de difusión (DR) se determinó como el número de mosquitos con detectables DENV-2 de antígenos en midgut no tejidos (por ejemplo, jefe de squash tejidos, glándulas salivales, la grasa corporal, etc), dividido por el número de mosquitos con virus detectables antígeno en la midgut.

Virus titulación

Los títulos virales en midguts se determinó el punto final de titulaciones (TCID 50) en células C6/36. Los títulos se establecieron utilizando la placa microtiter titulación ensayo descrito por Schoepp y Beaty [43], y criterios de valoración fueron calculadas por el método Karber [44] y expresó como log 10 TCID 50 / ml. Para determinar los títulos virales en su conjunto los mosquitos, así como en algunos midguts, la placa de ensayo titulaciones en LLC-MK2 se utilizaron células modificando el protocolo inicialmente comunicados por Malewicz y Jenkin [45].

DENV-2 cuantitativa en tiempo real RT-PCR (Q-PCR)

DENV-2 el número de copias del genoma se determinó Q-PCR en homogeneizado y filtrado de tejidos de mosquitos individual o midguts [38] [46]. ARN para ensayos de PCR fue extraído por medio de QIAamp ® Viral RNA Kit (Qiagen Ciencias, Maryland, MA). La mezcla de reacción se preparó con 1 × DyNAzyme ® buffer (Finnzymes, Espoo, Finlandia), 0,2 mM dNTP mix, 0,5 × SYBRGreen I (Molecular Probes Inc, Eugene, Oregón), 2,5 mM de MgCl 2, 10 μ M de adelante y atrás primers (5'CAAGTCGAACAACCTGGTCCAT3 'y 5'GCCGCACCATTGGTCTTCTC3 », respectivamente), 0.4U DyNAzyme II polimerasa de ADN recombinante (Finzymmes, Espoo, Finlandia), y 2 μ l cDNA en un volumen final de 20 μ L. El SYBR Green I 10000 × existencias se diluye en DMSO a una solución de trabajo de 100 ×, que se almacenó a -20 ° C en 15 μ l alícuotas para minimizar la exposición a la luz y congelar y descongelar los ciclos. Las reacciones se realizaron en un microseal 96 microplacas cubiertas con gorros ópticamente claro (MJ Research, Waltham, MA) y se coloca en el Opticon 2 termociclador. Configuración fueron: 95 ° C durante 10 min, seguido por 40 ciclos de 95 ° C durante 10 segundos, 64 ° C durante 20 segundos, 72 ° C durante 30 segundos, y 84 ° C durante 1 seg para la medición de fluorescencia. Después de una última ampliación a 72 ° C durante 10 min, una curva de fusión se determinará mediante el programa: 70 ° C a 95 ° C, 0,2 ° C / leer, 1 seg celebrar para confirmar la especificidad del producto.

Los primers utilizados orientados una región de 177 bp de la DENV-2 NS5 gen y cuantificados (+) capítulo DENV-2 ARN en la muestra. Las curvas de calibración se generaron en cada plato por el análisis de 2 × 10 2 a 2 × 10 8 copias / reacción de DENV-2 de plásmido.

Autores de las contribuciones

MIS realizó la mayor parte de los experimentos de laboratorio, analizó los datos y escribió el manuscrito. JHR participó en el Q-PCR experimentos y análisis de datos. ISV contribuido en la glándula salival en los estudios y experimentos con el control de Rex-D mosquitos. KEO supervisado el progreso de la investigación y editado el manuscrito. BJB estableció la colaboración internacional, coordinó el proyecto, y editado el manuscrito. Todos los autores leído y aprobado el manuscrito final.

Agradecimientos

Esta investigación fue apoyada por NIH AI45430 y AI48740. MIS se le concedió un Centro Internacional Fogarty de becas (TW1130).