Immunome Research, 2007; 3: 2-2 (más artículos en esta revista)

Una nueva estrategia para la identificación de los antígenos que son reconocidos por los bovinos de MHC de clase I restringido las células T citotóxicas en la infección por un protozoario utilizando vacunología reversa

BioMed Central
P Simon Graham (s.graham @ vla.defra.gsi.gov.uk) [1], Yoshikazu Honda (pikipiki.honda @ nifty.com) [1], Roger Pellé (r.pelle @ cgiar.org) [1 ], M Duncan Mwangi (d.mwangi @ cgiar.org) [1], Jane E Glew (Jane.Glew @ chiltern.com) [1], P, Etienne de Villiers (e.villiers @ cgiar.org) [1] , Trushar Shah (tm.shah @ cgiar.org) [1], Richard Bishop (r.bishop @ cgiar.org) [1], Pierre van der Bruggen (Pierre.vanderbruggen @ bru.licr.org) [3], Vishvanath Nene (nene@tigr.org) [2], Evans LN Taracha (e.taracha @ cgiar.org) [1]
[1] International Livestock Research Institute, PO Box 30709, 00100 Nairobi, Kenia
[2] El Instituto de Investigación Genómica, 9712 Medical Center Drive, Rockville, MD 20850, EE.UU.
[3] Ludwig Institute for Cancer Research - sucursal Bruselas, Avenue Hippocrate 74 - UCL 7459, B-1200 Bruselas, Bélgica

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

La inmunidad contra el parásito protozoario bovina Theileria parva ya ha sido demostrado ser mediada a través de la lisis del parásito de las células infectadas por MHC de clase I Restringido CD8 + linfocitos T citotóxicos. Es la hipótesis de que la identificación de CTL objetivo schizont antígenos se ayuda al desarrollo de una sub-unidad de vacunas. Hemos explotado la disponibilidad de la secuencia del genoma completo de datos y herramientas bioinformáticas para identificar los genes que codifican secretada o anclado proteínas de membrana que puede ser procesado y presentado por el MHC de clase I moléculas de las células infectadas a CTL.

Resultados

De los 986 predijo marcos de lectura abierta (ORFs) codificada por el cromosoma 1 de la T. parva genoma, 55 fueron seleccionados sobre la base de la presencia de un péptido señal y / o una hélice de dominio transmembrana. Treinta y seis seleccionados ORFs fueron clonados con éxito en un vector de expresión eucarióticos, transfectadas transitoriamente inmortalizado en fibroblastos de piel bovina y selección in vitro utilizando T. Parva-CTL específicos. Reconocimiento de los productos génicos de CTL se evaluó utilizando un IFN-γ ELISPOT ensayo. Un par base 525 de codificación de un ORF 174 aminoácidos de proteínas, designado TP2, fue identificado por T. parva-CTL específicos de 4 animales. Estos CTL reconocido y sometido a lisis TP2 transfectadas fibroblastos de piel y reconoció distintos epítopos 4. Significativamente, TP2 específicos CD8 + T cell respuestas se observaron durante la respuesta inmune protectora contra el esporozoito desafío.

Conclusión

La identificación de un antígeno que contienen múltiples epítopos CTL y su aparente immunodominance durante una protección contra el parásito respuesta hace TP2 un atractivo candidato para la evaluación de su potencial vacuna.

Fondo

Theileria parva es una garrapata de transmisión haemoprotozoan parásito que causa una aguda y con frecuencia fatal enfermedad del ganado denominado Costa Este fiebre (ECF). ECF sigue siendo una importante amenaza para los pequeños agricultores en las zonas oriental, central y meridional de África. Hay por lo menos 28 millones de cabezas de ganado en situación de riesgo, más de un millón de animales mueren cada año, y las pérdidas económicas anuales se calculan en dólares de los EE.UU. 189 millones [1]. El multinucleadas schizont fase del parásito tiene la notable capacidad de transformar la acogida de linfocitos infectados en un estado de proliferación incontrolada [2]. Aunque esto permite la rápida propagación del parásito que también conduce a la patología y, en última instancia la muerte a los animales sensibles [3]. El ganado puede ser inmunizados contra la infección simultánea por la infección de los animales utilizando la garrapata de origen infeccioso esporozoito fase del parásito y el tratamiento con acción prolongada tetraciclina [4]. Esta infección y el tratamiento régimen genera una sólida y duradera inmunidad protectora que está mediada por MHC de clase I Restringido CD8 + citotóxicos los linfocitos T (CTL) contra el schizont de linfocitos infectados [5 - 7].

El puesto era de la genómica ofrece la oportunidad de desarrollar nuevas estrategias para el desarrollo de una vacuna. En particular, se ha producido un cambio de paradigma en el enfoque de descubrimiento del antígeno como se destaca por el uso de la secuencia completa del genoma de Neisseria meningitidis para identificar y poner a prueba una lista de antígenos de la vacuna candidata contra la meningitis meningocócica [8]. El éxito de este enfoque, denominado «vacunología reversa ', junto con el número cada vez mayor de bacterias y protozoos están genomas secuenciados ha permitido que este concepto se extienda a otros agentes patógenos [9 - 11]. El éxito de la aplicación de vacunología inversa depende de la disponibilidad de un elevado rendimiento del sistema a prueba de antígenos candidato, pero se ha visto obstaculizada por la falta de una buena correlación in vitro de inmunidad. Protección contra la enfermedad en desafío a los pequeños modelos animales es normalmente la única lectura disponible a cabo [12]. La correlación entre la inducción de respuestas de CTL y la inmunidad a T. parva que ofrece un sistema con el que se aplican para revertir vacunología a un complejo de patógenos donde se inmunidad mediada por células.

La estrategia en materia de analizar el genoma para identificar los genes que codifican secretada o proteínas de membrana obligado. Dado que los genes fueron expresados por el intra-linfocítica schizont fase de estas proteínas podría estar expuesto a la acogida citosol de la célula y, por tanto, disponible para su presentación a CTL CD8 + a través del MHC de clase I de procesamiento y presentación vía. Selección de genes que someterse a las pruebas in vitro para el reconocimiento de T. Parva CTL específicos. Este informe describe la aplicación con éxito de este novedoso enfoque para identificar a una vacuna contra el candidato de antígenos de T. parva que es el objetivo de schizont-CTL específica inmune de ganado.

Resultados
Proyección de genes seleccionados a partir de datos del genoma

La secuencia de datos preliminar de T. parva (Muguga) cromosoma 1 [13] se ha ejecutado a través de los programas de búsqueda de genes GlimmerM [14] y Phat [15], y las proteínas codificadas por el predicho T. parva genes sometidos a diversos análisis para determinar secretada o membrana de proteínas ancladas. Cincuenta y cinco ORFs codificación antígenos candidatos fueron seleccionados para el cribado, de los cuales 36 fueron clonados con éxito en pTargeT [16]. Cada uno de los 36 ORFs fueron transfectadas transitoriamente en la piel autóloga inmortalizado fibroblastos (ISF) y examinados con un grupo de schizont policlonales específicos o líneas de CTL CTL clones generados a partir de 13 T. parva inmune de ganado que representan un espectro de las especies bovina antígeno leucocitario (Bola) clase I genotipos. CTL de cuatro animales (BW002, BW013, BW014 y D409) que presentan una alta actividad contra lítico autólogo schizont infectados lymphoblasts (Fig. 1A], todos mostraron un importante IFN-γ ELISPOT respuestas a ISF transfectadas con cDNA Tp01_56 (Fig. 1B, p < ; 0,01). CTL líneas de los otros nueve ganado no reconocer ISF transfectadas con alguno de los seleccionados de la ORF y no falsos positivos fueron detectados durante el examen (datos no presentados). La capacidad de CTL a lyse ISF transfectadas con cDNA Tp01_56 se evaluó a través de una participación del 51 Cromo liberación de ensayo (Fig. 1C]. CTL específicos expuestos lisis contra cDNA Tp01_56 transfectadas las células y no en contra de las células transfectadas con un irrelevante cDNA clonado en el mismo vector. Lisis de cDNA Tp01_56 transfectadas las células de CTL se inhibió de pre-incubación de las células diana con un bloqueo contra MAB MHC de clase I (IL-A88; ILRI, Nairobi, Kenia). Esta observación, junto con la incapacidad de CTL a lyse cDNA Tp01_56 alogénico las células transfectadas sugirió que el reconocimiento y la lisis se MHC de clase I Restringido. El gen que codifica cDNA Tp01_56 se le asignó el nombre TP2 (GenBank número XM_760490 ).

Caracterización molecular de T. Parva CTL antígeno objetivo TP2

TP2 El gen codifica 174 residuos de aminoácidos, tiene una masa calculada de 19141Da y un N-terminal del péptido de señal con un sitio predicho división entre los residuos 23 y 24. La proteína madura predijo contiene doce aminoácidos cisteína residuos de lo que sugiere que la estructura terciaria puede depender de di-sulfuro de vínculos. Los nucleótidos y deducir las secuencias de aminoácidos de la TP2 gen se muestra en la Fig. 2A. La transcriptasa inversa (RT)-PCR reveló la transcripción de esporozoito a TP2, schizont y Piroplasma fases del ciclo de vida de T. parva (Fig. 2B] y del Norte blots detectado la presencia de ~ 1 kb transcripción en schizont Piroplasma y ARN (Fig. 2C]. Transcriptome análisis de T. parva utilizando masivamente paralelo firma indicó que la secuenciación TP2 se expresa en un nivel relativamente alto (1069 TPM) en la etapa schizont [17]. El cDNA clon fue aislado de la biblioteca de cDNA schizont contiene una insertar bp 1026 con 105 y 396 pb 5 'y 3' UTR's, respectivamente. Las búsquedas de proteínas y de ADN utilizando bases de datos BLAST identificado un homólogo de TP2 en Theileria annulata, una molécula descrita como una membrana de antígenos asociados, Tad [18].

Mapeo de epítopos CTL en TP2

El CTL epítopos en TP2 fueron asignadas mediante una biblioteca de 12-mer superposición de péptidos sintéticos que abarcan toda la longitud del TP2 proteína. El reconocimiento de péptidos TP2 fue evaluada por el IFN-γ ELISPOT ISF autólogo utilizando como antígeno de células presentadoras. Fig. 3A muestra los resultados de la detección de la biblioteca TP2 péptido con CD8 + CTL policlonales líneas de animales BW002, BW013, BW014 y CTL T29.10 clon de animal D409. Esto permitió la identificación de cuatro epítopo que contienen las regiones. Longitud mínima péptidos antigénicos fueron definidas por todos los posibles cribado 8 -, 9 -, 10 - y 11-dores que cubren las regiones señaladas anteriormente. Los cuatro longitud mínima péptidos antigénicos reconocidos por CTL 11-dores, SHEELKKLGML (BW002) y KSSHGMGKVGK (BW013) y la superposición de 9-dores, FAQSLVCVL (D409) y QSLVCVLMK (BW014) (datos no presentados).

TP2 respuestas específicas en la inmunidad protectora

Como preludio a las pruebas directamente el potencial de la vacuna contra el antígeno TP2 en el ganado bovino, se realizó un experimento para buscar un TP2-componente específico dentro de la protección CD8 + T cell respuesta tras el desafío de tres ECF inmune ganado con una dosis letal de sporozoites . Todos los animales fueron sólidamente resistente a impugnar, exhibiendo sólo una transitoria detectable parasitosis y no fiebre (datos no presentados). Linfocitos T CD8 + enriquecido a partir de sangre periférica respondió a péptidos antigénicos TP2, medido por el IFN-γ ELISPOT ensayo (Fig. 4]. Las respuestas a las TP2 péptidos antigénicos fueron significativamente mayores que las de péptidos de otras regiones del TP2 de 9-11 días post-desafío (Fig. 4A-C, p <0,05). Tanto la cinética y la magnitud de la respuesta se correlaciona bien con los anteriormente descritos para schizont-CTL específicos en eferentes linfáticos y la sangre siguientes reto de animales inmunes [5]. Los intentos para detectar schizont y TP2 actividad citotóxica específica directamente en la sangre del ganado después de desafío no pudo demostrar de manera significativa la lisis (datos no presentados). Sin embargo, 14 días post-desafío, BW002 PBMC estimuladas in vitro con autólogos irradiados schizont de las células infectadas y la prueba de citotoxicidad 7 días más tarde presentó más actividad citolítica contra ambos schizont de las células infectadas y la ISF pulsos con el TP2 péptidos antigénicos SHEELKKLGML (Fig. 4D P <0,001). Este hallazgo es consistente con la hipótesis de que el CTL precursor frecuencia en sangre periférica era demasiado bajo para ser medido directamente, pero podría aumentar a niveles detectables después de una sola re-estimulación in vitro.

Discusión

De los 986 predijo ORFs en el cromosoma 1, la bioinformática se utilizó para seleccionar 55 genes que codifican las proteínas que potencialmente podrían acceder al citosol de la célula huésped. De los genes seleccionados, 36 fueron clonados con éxito en un vector de expresión eucarióticos y pruebas de reconocimiento de schizont específicos CD8 + CTL procedentes de 13 bovinos inmunizados contra la T. parva por una infección en vivo y el tratamiento de inmunización régimen. Un antígeno, denominado TP2, fue identificado por CTL a partir del 4 de diferentes animales. Tras el análisis ha definido múltiples epítopes CTL en esta molécula. Otra prueba de la situación de TP2 como objetivo bovina CTL antígeno fue proporcionada por el temporal de correlación detectable TP2 específicos CD8 + T cell respuestas con el inicio y la liquidación de T. parva schizont parasitosis siguiente reto infección.

El éxito de este enfoque ha sido sustentada por el desarrollo de un sensible CTL ensayo con el cribado para detectar que el reconocimiento de los antígenos seleccionados expresadas por transfectadas transitoriamente antígeno-células presentadoras. El actual sistema de selección se basa en el mismo principio que un ensayo para identificar los antígenos objetivo de tumor de células de melanoma humano CTL específicos [19, 20]. Este sistema utilizado WEHI el TNF-α bioensayo para detectar CTL reconocimiento de COS-7 células co-transfectadas con piscinas de cDNA de células de melanoma y adecuado HLA clase I cDNA [19, 20]. El número limitado de clonado de larga duración Bola de clase I cDNA y la relativa falta de sensibilidad de las células WEHI bovina TNF-α significa que una alternativa de presentación de antígenos de células y lectura de sistema se requiere para la detección de T. parva con antígenos bovina CTL. Autólogo de piel bovina fibroblastos transfectadas establemente con el antígeno T grande de SV40 siempre un sistema que no limitó la Bola haplotipos que podrían ser reclutados para el cribado, evitar las limitaciones prácticas de trabajar con líneas de células primarias y dio significativamente mayor expresión de las proteínas después de transfección transitoria . Todos los bovinos schizont-CTL líneas específicas probado a la fecha secretar IFN-γ y la detección de esta citocina mediante un ensayo ELISPOT [21] siempre muy sensible lectura de sustituir el TNF bioensayo. Proyección de los genes seleccionados con schizont-CTL específicas identificadas cDNA Tp01_56 como un objetivo de codificación de antígeno. Nos confirmó posteriormente que el reconocimiento se MHC de clase I restringido y han dado lugar a la lisis de las células que expresan. A pesar de la relativa ineficiencia de transfección transitoria, 51 ensayos de liberación de cromo se pueden realizar para confirmar MHC de clase I Restringido lisis de las células transfectadas TP2.

Una ventaja de este enfoque es la habilidad para utilizar schizont-CTL poblaciones específicas que se han mantenido en el laboratorio para la detección de antígenos. Sin embargo, a pesar de CTL líneas presentan un delicado y exquisito herramienta de cribado específicos existe la posibilidad de que los antígenos que se identificarán serán los más immunodominant como resultado de sesgos introducidos durante la in vitro restimulation procedimiento que se requiere para mantener las líneas. Los antígenos identificados pueden representar los que están bien expresadas en schizont infectadas con líneas celulares in vitro y pueden tener poca relevancia para las respuestas de protección CTL in vivo. Como preludio a la prueba esta hipótesis directamente con la protección desafío experimentos, se realizó un experimento para ver a TP2 específicos CD8 + T cell respuestas tras el desafío de animales inmunes con una dosis letal de sporozoites. Ambos, la cinética de la respuesta, observada desde el día 9 post-desafío, y la magnitud de la respuesta, con una frecuencia de respuesta de 1 / 500, se correlaciona muy bien con que anteriormente se ha descrito para schizont-CTL específicos en eferentes linfáticos y sangre periférica siguiente reto de ganado inmune [5] y proporciona pruebas en apoyo de una función para TP2 en la inmunidad protectora. Con este fin, en una primera inmunización y desafío ganado experimento TP2 y la evaluación de otros candidatos, se demostró que este objetivo CTL antígeno tiene el potencial para la vacuna contra la explotación [16].

En última instancia, la vacuna contra la T. parva casi seguro que necesitará incorporar múltiples antígenos y epítopes con el fin de conferir protección a la diversidad genética de los bovinos criados en población expuesta al reto de antigénicamente diferentes poblaciones de parásitos en el campo. Este estudio demuestra la prueba de concepto para la aplicación del enfoque genómico para la identificación de los antígenos para su inclusión en las vacunas diseñadas para inducir CTL basada en la protección. Este enfoque complementa las pruebas aleatorias de detección en las bibliotecas de cDNA que ha sido aplicado con éxito para identificar adicionales CTL objetivo antígenos de T. parva [16] y los melanomas humanos [19, 20]. El principal reto sigue siendo la formulación y ejecución de estos antígenos de una manera que adecuadamente primos de protección de memoria CD8 + T poblaciones de células in vivo.

Conclusión

Este estudio valida la explotación de los datos genómicos para identificar antígenos de la vacuna candidata de un complejo haemoprotozoan parásito utilizando CTL derivados de los rumiantes natural de acogida. La extensión de este enfoque para completar el genoma de T. parva utilizando CTL restringido por el aumento de las especies bovina haplotipos es probable que produzca en la identificación de nuevas vacunas. La identificación de un antígeno que contienen múltiples epítopos CTL hace TP2 un atractivo candidato para su inclusión en un CTL específicas sub-unidad de vacunas y también para el estudio de polimorfismo en epítopos CTL en bovinos y búfalos del Cabo (Syncerus caffer). Una evaluación en profundidad de este antígeno en ganado la participación de una serie de tecnologías de entrega de antígenos a los que tienen el potencial para inducir bovina CTL está en marcha con el fin de evaluar la inmunogenicidad y eficacia protectora de TP2 contra la clínica Costa Este fiebre

Métodos
Generación de lista de genes seleccionados

Contigs preliminares de la T. parva genoma Se realizaron búsquedas en contra de un no-redundante de datos de proteínas extraídas de GenBank. Los resultados de la búsqueda se utilizaron para producir un conjunto de putativo T. parva genes que codifican muy conservadas genes eucariotas. Este conjunto de genes se complementó con una serie completa de genes aislados de una biblioteca de cDNA a partir de schizonts purificado y se utilizaron para capacitar a encontrar el gen programas GlimmerM [14] y Phat [15], que posteriormente se ejecute en contra de todos los del anteproyecto contigs de genes para producir modelos para toda la secuencia del genoma preliminar. Las proteínas codificadas por el predicho T. parva genes en el cromosoma 1 se realizaron búsquedas en contra de un no-redundante proteína base de datos usando WU-BLAST [22], y las predicciones de la señal y péptidos señal anclas [23] y dominios transmembrana [24] analizados. Los resultados fueron revisados y un conjunto de 55 genes que codifican los antígenos candidato fue seleccionado para la clonación y el cribado [16].

La clonación de genes seleccionados

Marcos de lectura abierta (ORFs) menos de 3,1 kb con éxito fueron amplificados por OneStep RT-PCR kit (QIAGEN Ltd, Crawley, Reino Unido), utilizando ARN purificado de T. parva (Muguga) schizont infectados lymphoblasts. Ciclos térmicos fueron los siguientes: Genes hasta 1 kb: 50 ° C 30 minutos, 95 ° C 15 minutos, 94 ° C 30 segundos, 55 ° C 30 segundos, 72 ° C 1 minuto, 35 veces de 94 ° C el ciclo y, por último, 72 ° C 10 minutos. Los genes entre 1 y 2 kb: 50 ° C 30 minutos, 95 ° C 15 minutos, 94 ° C 1 minuto, 55 ° C 1 minuto, 72 ° C 1 minuto, 35 veces de 94 ° C el ciclo y, por último, 72 ° C 10 minutos. Los genes entre 2 y 3 kb: 45 ° C 30 minutos, 95 ° C 15 minutos, 94 ° C 10 segundos, 55 ° C 1 minuto, 68 ° C 3 minutos, 35 veces de 94 ° C el ciclo y, por último, los 68 ° C 10 minutos. Genes amplificados fueron purificados a partir de geles de agarosa de QIAquick Gel Extracción kit (QIAGEN) y clonado en eucariotas expresión T-pTargeT vector (Promega, Madison, WI, EE.UU.). Ligated muestras fueron electroporated en JM109, y las colonias fueron seleccionadas por PCR utilizando genes específicos interior hacia adelante y los primers específicos vector primer inversa (5'GAGCGGATAACATCACACAGG3 '). Positivo colonias se cultivaron en 2 ml y purificado de los plásmidos QIAprep Spin Miniprep Kit (QIAGEN) y secuenciado por ABI PRISM 377 secuenciador de DNA (Applied Biosystems, Foster City, CA, EE.UU.). Aunque 51 de 55 genes seleccionados fueron amplificados, 36 fueron clonados con éxito en pTargeT [16]. Algunos de los genes clonados fueron sistemáticamente equivocada en la orientación que sugiere el gen productos tóxicos para la E. coli. Algunos genes se veían multiplicados por el primer invertir y sólo perdió los 5 'finales.

Análisis de la expresión temporal de TP2

Total RNA de sporozoites, schizonts y piroplasms inversa-se transcribe en ss de cDNA de la transcriptasa inversa utilizando oligo (dT) como primer siguiendo la recomendación del proveedor (Invitrogen). Tras la eliminación de ARN complementarios a los cDNA de tratamiento con RNasa H y purificación con fenol-cloroformo, la SS-fue cDNA PCR-amplificación en presencia de primers específicos utilizados para generar la TP2 ORF (5'-ATGAAATTGGCCGCCAGA-3 'y 5 '-CTATGAAGTGCCGGAGGCTTCTCC-3'). Del Norte blots de RNA de la schizont y Piroplasma etapas de T. parva se probaron con el TP2 ORF fragmento de ADN. Esta sonda se utiliza también para una pantalla schizont biblioteca de cDNA y la enzima de restricción se realizó un análisis por digestión con Eco RI y Bam HI.

La infección y el tratamiento de inmunización del ganado y la generación de CTL

Todos los animales de experimentación fue examinado y aprobado por el ILRI Institucional Cuidado de Animales y el empleo. Cuatro Boran (Bos indicus), 1 Jersey (Bos taurus), 1-Holstein Friesian (Bos taurus) y 4 crossbreds, seleccionados sobre la base de Bola tipo, fueron inmunizados contra la T. parva Muguga existencias, desafió a los 3 meses y schizont-CTL policlonales específicos y líneas de clones creado tal y como se describe [16].

Transfección transitoria de la piel fibroblastos inmortalizados

Inmortalizada de fibroblastos de piel (ISF) fueron transfectadas en placas de 96 pocillos con clones de cDNA (100 ng / pocillo) mediante Fugene-6 (Roche Diagnostics GmbH, Mannheim, Alemania) y cultivadas durante 24 horas.

IFN-γ ELISPOT y 51 ensayos de liberación de cromo

Transfectants fueron co-cultivadas con schizont-CTL específica y el reconocimiento evaluó utilizando un IFN-γ ELISPOT ensayo [16]. Transfectants y schizont de las células infectadas fueron etiquetados con 51 Cromo (Amersham Biosciences Europe GmbH, Freiburg, Alemania) y la lisis de schizont-CTL específicos líneas evaluadas [25].

Identificación de epítopos CTL con péptidos sintéticos

Un péptido de la biblioteca se generó TP2 que figuran cada 12 mer, la mer 11, 10 y 9 mer mer compensado por 2 aminoácidos de la secuencia de la proteína (exfoliados PepSet; Mimotopes, Clayton, Australia). Los péptidos fueron preparados por truncations dores de 12 a la N-terminal y se suministra con liofilizado cada tubo que contiene un nominal de 12 mer y el 9, 10, 11 mer truncations con el mismo C-terminal. Los péptidos se disolvieron en 400 μ l 50% (v / v) grado de síntesis de ADN acetonitrilo / agua (Applied Biosystems). Los péptidos son más diluida a 10 μ g / ml en completo RPMI-1640 y 10 μ l añadido a tres pozos de una placa de ELISPOT. Autólogo de ISF se ajustaron a una densidad de 4 × 10 5 / ml y 50 μ l añadido a los pozos que contienen péptidos. Las placas fueron incubadas a 37 ° C durante 1 hora antes de 50 μ l de CTL a una densidad de 2 × 10 5 / ml se añadieron a cada pocillo. Las placas fueron incubadas y desarrollado, tal como se describe más arriba. Basándose en los resultados de la detección de la biblioteca de péptidos, los 8, 9, 10 u 11 mer péptidos fueron sintetizados y comprobado como se ha descrito anteriormente. Péptido-pulsado ISF se prepararon como objetivos para la liberación de cromo 51 ensayos de incubación de la noche a la mañana con el péptido a 1 μ g / ml en DMEM completo. Las células fueron cosechadas, etiquetados y ensayadas como se ha descrito anteriormente.

Ex vivo de detección de TP2 específicos CD8 + T cell respuestas

Inmune ganado, BW002, BW013 y BW014, cuya schizont específica CTL ha reconocido TP2, fueron retados con una dosis letal de T. parva (Muguga) sporozoites y sangrado día todos los días de 6 a 13 post-desafío. Linfocitos T CD8 + y CD14 + monocitos fueron purificados a partir de PBMC de MACS magnetico de células clasificar según las instrucciones del fabricante (Miltenyi Biotec, Gergisch Gladbach, Alemania). Linfocitos T CD8 + fueron ordenados indirecta utilizando un anticuerpo monoclonal específico para la especie bovina CD8 (IL-A105; ILRI, Nairobi, Kenia), seguido de incubación con la cabra anti-ratón IgG microbolas (Miltenyi Biotec). CD14 + monocitos fueron ordenados directamente por incubación con microbolas CD14 (Miltenyi Biotec). Linfocitos T CD8 + (2,5 × 10 5 / pocillo) y los monocitos CD14 + (2,5 × 10 4 / así) se han añadido a IFN-γ ELISPOT TP2 placas que contienen péptidos (1 μ g / ml concentración final) y se incubaron y desarrollado, tal como se describe [21]. Para recordar TP2 CTL respuestas concretas, PBMC fueron estimulados con autólogos infectados lymphoblasts 14 días post-desafío, células viables se cosecharon 7 días post-estimulación y actividad contra lítico infectados lymphoblasts y TP2 péptido pulsos ISF evaluarse como se ha descrito anteriormente.

El análisis estadístico

Análisis de varianza (ANOVA) fue utilizado para el análisis de efectos fijos en diferentes rasgos usando SAS versión 8.2 (SAS Institute Inc, Cary, EE.UU.).

Conflicto de intereses

Los autores declaran que no tienen intereses en conflicto.

Autores de las contribuciones

SG llevaron a cabo los ensayos inmunológicos y redactó el manuscrito. EPdV, TS y RB anotada y analizó los datos relativos al genoma. YH clonado los genes seleccionados. RP realizó el análisis molecular del TP2. DM y EJG llevado a cabo algunos de los ensayos inmunológicos. PvdB participado en el diseño del estudio. VN y ELNT concibió el estudio y participó en el diseño y la coordinación, y ayudó a redactar el manuscrito. Todos los autores han leído y aprobado el manuscrito final.

Agradecimientos

Queremos reconocer la contribución de todos el personal técnico de la vacuna contra el ECF a Proyecto ILRI excelente aporte técnico y al personal del ILRI gran animal y marque las unidades para una excelente ganadería y la prestación de los parásitos. Damos las gracias a la Unidad de Biometría, ILRI, en materia de asesoramiento sobre el análisis estadístico. Este trabajo fue financiado con la subvención No R8042 del Departamento para el Desarrollo Internacional, Reino Unido. Esta publicación es ILRI no 200690. YH fue apoyado en parte por el Departamento de Asuntos Exteriores del Gobierno japonés.