Genetic Vaccines and Therapy, 2007; 5: 4-4 (más artículos en esta revista)

El virus sincitial respiratorio infección en ratas Fischer 344 es atenuada por ARN corto de interferencia contra el RV-gen NS1

BioMed Central
Xiaoyuan Kong (xkong@health.usf.edu) [1], Zhang Weidong (wzhang@health.usf.edu) [1], Richard Lockey F (rlockey@health.usf.edu) [2], Alexander Auais (aauais @ med.miami.edu) [3], Giovanni Piedimonte (giovanni.piedimonte @ hsc.wvu.edu) [4], Shyam S Mohapatra (smohapat@gmail.com) [1]
[1] Universidad de South Florida College of Medicine, Florida, EE.UU.
[2] James A Haley VA Hospital, Tampa, Florida, EE.UU.
[3] Batchelor Children's Institute, University of Miami, Miami, Florida, EE.UU.
[4] West Virginia University, Morgantown WV, EE.UU.

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

El virus sincitial respiratorio (VSR) causa bronquiolitis grave y es un factor de riesgo para el asma. Dado que no existe una vacuna disponible comercialmente contra el RSV, un corto de ARN de interferencia contra el RV-NS1gene (siNS1) fue desarrollado y su potencial para disminuir la infección por VRS y la infección asociada a la inflamación en ratas se puso a prueba.

Métodos

Plásmidos codificación siNS1 o un no vinculados siRNA fueron complejos con una nanopartícula quitosán agente de entrega y administrado por vía intranasal. Los controles recibieron un plásmido para un no-específica siRNA. Después de expresión del plásmido en las células pulmonares de 24 horas, las ratas fueron infectados por vía intranasal con RV.

Resultados

La profilaxis con siNS1 significativamente reducido de los pulmones y los títulos de RV hiperreactividad de las vías respiratorias methacholine desafío en comparación con el grupo control. Lung secciones de siNS1-ratas tratadas mostraron una considerable reducción de copa en la hiperplasia de las células del pulmón y en la infiltración de células inflamatorias, dos características de asma. Además, el lavado broncoalveolar de siNS1 muestras de los animales tratados tienen menos eosinófilos. El tratamiento de ratas con siNS1 antes de la exposición RV fue eficaz en la reducción de títulos de virus en el pulmón y en la prevención de la inflamación y la hiperreactividad vías respiratorias asociadas con la infección que ha estado vinculada al desarrollo de asma.

Conclusión

El uso de la profilaxis siNS1 puede ser un método eficaz para la prevención de bronquiolitis por VRS y potencialmente reducir el posterior desarrollo de asma asociadas con las infecciones respiratorias graves.

Fondo

El virus sincitial respiratorio (VSR) es la principal causa de la grave neumonía y bronquiolitis en los lactantes de todo el mundo y también los resultados más bajos en infecciones de las vías respiratorias en inmunodeficientes adultos y personas mayores [1]. Los niños que nacen prematuramente o con anormalidades congénitas del corazón son especialmente en alto riesgo de su vida en peligro las infecciones respiratorias por virus tales como VRS. Graves del tracto respiratorio inferior en los niños la infección puede ser fatal y con frecuencia conduce a la costosa estancia en el hospital. La bronquiolitis RSV en la infancia es también un factor predisponente para el desarrollo del asma más adelante en la vida [2]. No hay ninguna vacuna eficaz disponible comercialmente contra RV y la relativa debilidad de la respuesta inmune en la población destinataria de los lactantes y los ancianos hace que esta posibilidad aún menos probable.

Una de las más prometedoras estrategias actuales para la protección contra la infección de las vías respiratorias es el tratamiento intranasal con vectores capaces de generar RNAs que bloquean la replicación viral. Interferencia por ARN (RNAi) es una defensa natural del sistema inmune innato contra los virus [3]. Doble viral RNA hundidos producidos durante la replicación viral es reconocido por el sistema de acogida RNAi cleaves que en breve Oligonucleótidos, 20-30 bases de largo. Estas corto de interferencia ARN's (siRNAs) y luego activar la célula del ARN división de maquinaria (la interferencia por ARN silenciar complejo, o RISC) para destruir el ARN viral. El RSV es un genoma único hundidos, capítulo negativo-ARN que es copiada por un virus ARN-dependiente del RNA polimerasa en muchas vertientes (sentido) los mensajes que luego se traducen en proteínas virales. Con la introducción de siRNAs complementarias a determinados viral mRNAs, doble hundidos activación de ARN se pueden generar que se convierte en el sistema RISC división y destruye el mensaje viral. Esta estrategia antiviral ha sido probado con éxito en cultivos celulares y modelos animales en contra de un número de patógenos humanos incluyendo la gripe [4, 5], la hepatitis A y C [6, 7], el Virus del Nilo Occidental [8] y el VIH [9, 10] . El campo de siRNA antiviral ha sido revisado recientemente por Manjunath et al. [11].

Nosotros y otros han demostrado la eficacia antiviral de siRNA utilizando un BALB / c modelo de ratón para RV [12, 13] y la infección por el virus del dengue [14]. La RV genoma codifica 10 proteínas, y los dos primeros genes transcritos nonstructural generar proteínas conocido como NS1 y NS2 que no forman parte de la cápside viral. RV se ha desarrollado un mecanismo para contrarrestar el cuerpo del interferón inducible programa antivirus y esto se demostró la participación de NS1 y NS2 [15].

El NS1 ARNm es el primer mensaje producidos durante la transcripción viral, y fue elegido como el objetivo de siRNA porque es conocida para inhibir la acogida antiviral sistema de defensa mediante la reducción de la síntesis de interferones de tipo uno, IFN-α y IFN-β [16]. Pérdida de la producción de interferón previene la activación de 2'-5 'oligoadenylate sintasa, el inductor de RNasa L que degrada viral RNAs. Otros antivirales enzimas bloqueadas por NS1 la inhibición de IFN-α, - β incluir la doble hundidos RNA-dependiente de la proteína quinasa y indoleamine 2,3-dioxygenase que normalmente el virus de reducir la producción de interferir con la traducción [12].

Supresión de humanos mutantes que carecen de RV NS1 o NS2 mostró unas 10 veces atenuada replicación en células Vero, pero cuando inoculados por vía intranasal algodón en ratas, la NS1, NS2-o defectuosos virus se redujo de 100 veces en relación a su forma natural [17]. Un recombinante RV deficiente en NS1 también fue mal infeccioso sólo en los chimpancés [18]. Esto sugiere que las proteínas de NS RV, especialmente NS1, son esenciales para la replicación in vivo del virus y que la interferencia por ARN la orientación de estas proteínas debería dar como resultado una reducción significativa en RV infectividad.

Una parte integral de siRNA es el método de entrega de la interferencia del ARN. Aunque desnudo RNA se ha utilizado eficazmente para desactivar la expresión de genes específicos, se piensa que un vector de expresión de ARN sistema puede dar lugar a una más estable y duradera inhibición. Nuestro laboratorio ha desarrollado un plásmido-sistema de entrega de la utilización de nanopartículas biocompatibles a partir de la glucosamina desacetilizado polímero, quitosán, un derivado natural de la quitina de conchas de crustáceos. Chitosan se ha utilizado para la entrega de drogas y el ADN complexation durante varios años [19] y se ha demostrado segura para uso humano [20]. Expresión plásmidos de gen deseado producto o siRNA pueden ser adsorbidos en las nanopartículas a través de la interacción con la carga positiva en los grupos de amina quitosán, y el complejo puede ser infundido por vía intranasal en ratones o otros animales [21, 22]. Chitosan ha mucoadhesive propiedades que sirven para orientar administrada por vía intranasal-quitosán plásmido nanopartículas a la mucosa pulmonar, donde podrá ser adoptada y se expresa en los macrófagos y células epiteliales [23]. Expresión de proteínas de los complejos de nanopartículas se ha encontrado a persistir en vivo durante 2 a 3 semanas, y los ratones tratados con una quitosán interferón gamma-plásmido complejo fueron resistentes a infecciones repetidas RV [resultados no publicados].

Aquí nos informe sobre los efectos profilácticos de un siNS1 construir en la prevención de la infección por VRS en ratas. Plásmidos expresar anti-NS1 ARN o una secuencia no relacionada con complejos se nanopartículas de quitosano inculcado por vía intranasal y un día antes de la infección intranasal con RV. El siNS1 tratamiento redujo significativamente RV títulos y ha impedido el daño pulmonar que acompaña a las vías respiratorias y la hiperreactividad.

Materiales y métodos
Animales

Fischer 344 ratas (14 semanas de edad) fueron adquiridos de Jackson Laboratory (Bar Harbor, ME) y mantenido en un libre de agentes patógenos medio ambiente. Todos los procedimiento fueron revisados y aprobados por la Universidad de Miami Comisión de Investigación Animal.

Líneas celulares y la producción de virus

El HEp-2 y la línea celular RV-A2 cepa VR-1302 se obtuvieron a partir de la American Type Culture Collection (ATCC, Rockville, MD). La línea celular fue cultivada en Earle's modificados a medio Eagle (EMEM), completado con un 10% de suero fetal bovino a 37 ° C en el 5% de CO 2 / 95% aire. Para la producción de RV, células HEp-2 en un 60% confluencia estaban infectados con VRS en una multiplicidad de infección (MOI) de 0,1 a 0,2 en OptiMEM (Invitrogen, Carlsbad, California) durante 2 h a 37 ° C. El medio fue reemplazado con OptiMEM más 2% de SFB y la infección se permitió que los progresos hasta citopatológicas fueron evidentes los efectos de examen microscópico. Las células fueron recogidas por raspado y se centrifuga a 2100 × g durante 10 min a 4 ° C. Se mezclaron con una décima parte del volumen 1 M MgSO 4, en capas en un 30% en glicerol 50 mM HEPES (pH 7,5) y se centrifuga en un rotor SW 28 a 24000 × g durante 3 horas a 4 ° C. El virus fue precipitado suavemente enjuagarse con OptiMEM, resuspendido a 4 ° C en 750 μ l de 50 mM HEPES (pH 7,5), 0,01 M MgSO 4 y 150 mM NaCl (aunque filtrada 0,22 μ m de poro de filtro), aliquotted, y almacenados en nitrógeno líquido .

Construcción de plásmidos siRNA

El Ambion Meta Buscador de siRNA y herramienta de diseño se utilizó para encontrar los posibles objetivos a lo largo de siRNA la NS1 secuencia y la forma más eficaz de una transcripción in vitro análisis fue seleccionado para su uso en los experimentos informó aquí. Un oligonucleótido fue sintetizado que contiene una secuencia de 24 nt de RV NS1 (GGCAGCAATTCATTGAGTATGCTT), seguido por un 8 nt bucle secuencia inversa y el complemento de la secuencia objetivo NS1. La secuencia de nucleótidos de este oligo es 5'-GGC AGC AAT TCA AGT TTG ATG CTT CTC GAA ATA ATA AGC AAT CTC GAA TTG CTG AAC TTT TG-3 '. Cuando transcritas, la transcripción forma un tallo-bucle estructura. Un segundo oligo fue sintetizado complementaria de la primera enzima de restricción con sitios de Apa -1 y Eco-R1 a los 5 'y 3' extremos, respectivamente. Los oligos se annealed y ligated en el siRNA vector de expresión, pSilencer 1.0-U6 (Ambion) para generar la construcción, pSMWZ-1. El tamaño exacto de la siNS1 después Dicer transformación no se haya determinado. Para los no vinculados construir, siE7 (siRNA contra la proteína E7 del virus del papiloma humano, VPH 18) es la secuencia 5'-GAT GAA AAC ATA GAA GAT GTT CAA GAG ACA TCT TCA TCG ATT TCT TTT TTT TT-3 '. Para determinar la posibilidad de fuera de objetivo, a una búsqueda BLAST de ratón y humanos bases de datos se realiza utilizando el siRNA y secuencias importantes homologías no se encontraron. Immunoblots utilizando anticuerpos específicos de la NS1 se realizaron sobre las proteínas aisladas de las células transfectadas para verificar desmontables de NS1 de construir el siRNA.

Preparación de quitosán nanocomplexes y el tratamiento con siRNA y RV

Plásmidos son complejos con nanopartículas de quitosano como anteriormente se ha descrito para aumentar la estabilidad y la orientación de ADN a las células epiteliales del pulmón [21]. Plásmidos fueron disueltos en 25 mM de sulfato de sodio y se calienta a 55 ° C durante 10 min. Alto MW quitosán (Protasan CL113, Novamatrix, Noruega) fue disuelto en 25 mM de acetato de sodio (pH 5.5) a una concentración de 0,02% y se calienta a 55 ° C durante 10 min. El plásmido solución fue mezclada con una cantidad igual de solución de quitosano (5:1, peso a peso de quitosano para el ADN) y vortexed a alta velocidad durante 30 segundos. Fischer 344 ratas (14 semanas de edad, n = 6 en cada grupo) recibieron una sola dosis intranasal de 200 μ g de siNS1 control plásmido o complejos con una cantidad igual de quitosán. Después de 24 h, fueron inoculados por vía intranasal con 1,4 × 10 7 PFU de RV y la infección se permite que continúe durante 5 días momento en el que los animales fueron sacrificados. RV títulos se midieron en homogeneizado de pulmón.

Medición hiperreactividad de las vías respiratorias (AHR)

El día 4 de la infección por VRS, la AHR en respuesta al desafío methacholine se midió por libre, todo el organismo pletismografia (Buxco Instrumento Co, Wilmington NC). Las ratas fueron colocadas dentro de Plexiglas cámaras y su tasa de respiración y el volumen fue supervisado por la presión que tengan en cuenta tranducers ingresando la amplificación de las señales en el software propietario que ha sido calibrada para las condiciones experimentales (Buxco). Después de un período de aclimatación de unos 5 minutos, la línea de base mayor pausa (Penh), una medida de resistencia de las vías respiratorias, fue determinada por exponer a los animales a un aerosol de solución salina y el cálculo Penh de acuerdo con un algoritmo desarrollado por Buxco. Methacholine específicamente medido en tasas de dosis se incorporan después en las cámaras y los Penh medido. El valor final Penh para cada rata es la media de todas las lecturas tomadas durante un período de 5 minutos, y se expresa como porcentaje del nivel básico. Un promedio de la Penh para todos los animales se utilizó para comparar la respuesta de los controles a siNS1 de ratas tratadas.

RV título en el pulmón

Al final de los 5 días de la infección por VRS período, las ratas fueron sacrificados, los pulmones se retiraron y homogeneizada a 4 ° C utilizando un POLYTRON (Brinkmann, Westbury, NY). Lung homogeneizado se centrifuga y cantidades iguales (basado en el peso de pulmón homogeneizada) de sobrenadantes fueron diluidas 1:4 en medio de cultivo EMEM. El homogeneizado se han añadido a células HEp-2 (80% confluente) e incubadas a 37 ° C, con mecedoras cada 15 min. Después de 2 h, el medio fue reemplazado con un nuevo EMEM incrementado en un 10% de SFB y las células fueron incubadas por un nuevo 16 h. El título viral se midió por inmunofluorescencia utilizando un conjugado con FITC-anticuerpo para RV (Chemicon, Temecula, CA). El etanol-fijo células fueron teñidas por 30 min a 37 ° C-RV y las células infectadas fueron contados por microscopía de fluorescencia.

Lavado broncoalveolar (BAL) de células diferencial

Al final de los 5 días de la infección por período, las ratas fueron sacrificados y los pulmones se lavaged intratracheally con dos lavados de tampón fosfato-salino (PBS). El líquido recuperado BAL fue centrifugada a 700 × g durante 5 min a 4 ° C y el pellet de células fue resuspendido en 200 μ l de PBS. El BAL sobrenadantes se utilizaron para el análisis de citoquinas por ELISA (véase más adelante). Las suspensiones de células fueron centrifugadas diapositivas en vidrio utilizando una centrífuga Cytospin (Shandon Instrumento Co, Pittsburgh, PA) a 1000 × g durante 5 min a temperatura ambiente. Alícuotas de cada muestra de líquido BAL se aplicaron a tres diapositivas. Las diapositivas se seca al aire y las células fueron teñidas con una modificación de la tinción de Wright (Leukostat, Fisher Científico, Atlanta, GA), que permite el recuento diferencial de monocitos y linfocitos. Un mínimo de 300 células por muestra fueron contados por observación microscópica directa.

IFN-γ e IL-4 análisis

IFN-γ e IL-4, se midieron los niveles en BAL sobrenadantes y fluido en los pulmones de ratas homogeneizado (para la preparación de la muestra, véase más arriba) a través de kits de ELISA de acuerdo a las instrucciones del fabricante (Quantikine Rat colorimétrico Sandwich ELISA Kits, R & D Systems, Minneapolis, MN).

La tinción de secciones de pulmón de células CD4 y linfocitos CD8

Lung secciones de siNS1 tratados de control de ratas y se fija en el 4% tamponado paraformaldehído entonces manchadas de PE-etiquetados anti-CD4 y marcado con FITC anti-CD8. Las secciones fueron examinadas por microscopía de fluorescencia y fotografiados.

El análisis estadístico

Los valores de los datos experimentales son el promedio de al menos dos y, por lo general tres experimentos y se expresan en los medios ± SEM (error estándar de la media). Las comparaciones se realizaron utilizando la t de Student y prueba de las diferencias con p <0,05 se consideró significativo.

Resultados
siNS1 reduce la infección por VRS y la patología pulmonar

Las ratas recibieron profilaxis anti-VRS tratamientos consistentes en nanopartículas de quitosano complejos con siNS1 plásmido o un plásmido no vinculados inculcado por vía intranasal. Plásmido de expresión se le permitió proceder durante 24 horas a la vez que las ratas estaban infectados con VRS.

Los animales se sacrificaron cinco días después de la infección pulmonar y las secciones se examinaron microscópicamente para detectar signos de RV inducida por la patología pulmonar. SiNS1-ratas tratadas mostraron una menor copa hiperplasia de las células en los bronquiolos (fotos superiores) y un menor número de infiltrarse en las células inflamatorias en las regiones intersticial (fotos inferiores) en comparación con los controles. (Fig. 1A]. El número de la placa-RV unidades formadoras en homogeneizado de pulmón también se redujo significativamente en las ratas tratadas con siNS1 (Fig. 1B].

siNS1 aumenta IFN-γ expresión, pero no IL-4

Broncoalveolar lavages se realizaron en ratas tratadas con nanopartículas llevar siNS1 plásmido o control, e IFN-γ e IL-4, se midieron en el fluido BAL sobrenadantes por ELISA. Los datos mostraron que el IFN-γ, fue significativamente superior (p <0,05) en siNS1 ratas tratadas con los pulmones (Fig. 2A], pero no hubo ningún cambio significativo en IL-4 niveles siNS1 entre el grupo y los controles (Figura 2B].

siNS1 turnos de la población de linfocitos T de Th2 a Th1

La relación de IL-4 a IFN-γ es un indicador del fenotipo alérgicas en el pulmón-el más alto sea el ratio, más T helper de tipo 2 (Th2) es la respuesta [24]. En la Fig. 2C, se puede observar que la expresión de siNS1 conduce a una menor de IL-4: IFN-γ ratio; por lo tanto, un más Th1-como respuesta a la infección por VRS se observó en los ratones que reciben tratamiento. De acuerdo con el pasar de un Th2 a un fenotipo Th1, encontramos que el tratamiento siNS1 reducido sustancialmente el número de eosinófilos pulmonares (Fig. 2D]. El cambio de un Th2 a Th1 tipo de respuesta resultante de siNS1 tratamiento reduce RV inducida por eosinofilia, presumiblemente mediante la inhibición de expresión en el pulmón de quimiocinas como eotaxin e IL-8 que atraen a los glóbulos blancos [25].

Rat las vías respiratorias del pulmón es la disminución de la reactividad de siNS1

El efecto del tratamiento siNS1 hiperreactividad en las vías respiratorias (AHR) a methacholine se midió como el cambio en el aumento de pausa (Penh) en relación al valor basal de todo el organismo pletismografia. siNS1-ratas tratadas mostraron significativamente más bajos AHR (Penh%) en comparación con los controles (Fig. 3].

La infiltración de linfocitos T en los pulmones se ve alterado por el tratamiento siNS1

RV infección generalmente se traduce en una migración de células CD4 + T las células al pulmón y la infiltración intersticial de los tejidos circundantes. Administración intranasal de siNS1 reducido el número de CD4 + células T en los pulmones, pero no altera significativamente la infiltración de las células CD8 + (Fig. 4]. El CD4 + T, infiltración de células asociadas a la infección por VRS puede promover el aclaramiento del virus, pero a expensas de una mayor daño al epitelio pulmonar y parénquima. La disminución de los CD4 + T el número de células en el pulmón producida por siNS1 tratamiento cuando se combina con una mayor actividad antiviral interferón genera un alto grado de eficacia viral de limpieza sin dañar tejidos de las vías respiratorias.

Discusión

RSV es un virus ubicuo de distribución en todo el mundo, y la infección por VRS es un grave riesgo para la salud de bronquiolitis y neumonía entre los niños de menos de seis meses de edad. Es una de las principales causas de hospitalización en este grupo de edad. La dificultad de producir una vacuna eficaz contra el VRS en los lactantes se debe a la inmadurez de su sistema inmune que se encuentra en una etapa de desarrollo que excluye a gran escala la respuesta inmune. Por lo tanto, la profilaxis antiviral eficaz en los lactantes deben utilizar un enfoque diferente. Interferencia por ARN de tumbar clave viral genes necesarios para la replicación es una estrategia prometedora para lograr esa reducción en la incidencia o severidad de la infección por VRS. En nuestros experimentos con roedores, el tratamiento profiláctico lo antes tres días antes de la infección por VRS todavía ofrece cierta protección contra el virus. SiNS1 aplicaciones terapéuticas también pueden ser eficaces para atenuar una infección por VRS existentes mediante el bloqueo de la replicación del virus adicionales.

La respuesta inmune a la infección viral implica la proliferación de linfocitos específicos y la diferenciación de los cambios definidos por el T helper fenotipos de células Th1 o Th2 y sus asociados expresión de citoquinas. La infección por VRS se asocia con un desequilibrio Th1/Th2 que se desplaza hacia el fenotipo Th2 caracterizada por la disminución de IFN-γ y el aumento de la producción de IL-4. IFN-α es conocido por promover un tipo Th1-respuesta [26] y la inhibición del IFN-α de la proteína NS1 puede estar asociado con esta polarización Th2. El bloqueo de la síntesis NS1 desplaza la balanza a un fenotipo Th1 y previene la RSV inducida por embotamiento de la acogida de la respuesta inmune mediante la mejora de IFN-γ producción y, por tanto, potencialmente permitiendo la plena expresión de antivirales interferones y el 2 ', 5'-oligoadenylate sintasa y RNasa L sistemas de defensa.

La asociación entre CD4 + T, infiltración de células y patología pulmonar durante la infección por VRS se ha documentado [27]. La introducción pasiva de CD4 + células T aisladas de infección por VRS en ratones ratones ingenuo seguido por la administración intranasal de VRS dado lugar a graves daños pulmonares y eosinofilia [28]. La observación de que el bloqueo de la expresión de la proteína NS1 RV disminuyó CD4 + T cell niveles en el pulmón es un importante hallazgo que sugiere NS1 puede tener efectos sobre el sistema inmune adaptativo, además de su papel en subvertir la respuesta innata interferón. La interacción entre las células T reguladoras y efectoras de células T en la respuesta inmune a la infección por VRS puede ser otro espacio de participación de las proteínas NS [29].

Conclusión

Interferencia por ARN se está agresivamente a prueba como una nueva y eficaz forma de silenciar específicamente genes implicados en la patogénesis de enfermedades. Actualmente hay tres ensayos clínicos en curso para poner a prueba la seguridad y la eficacia de siRNAs-dos para la degeneración macular y otro en contra RV inducida por neumonitis. La técnica de interferencia por ARN tiene prácticamente ilimitado potencial, pero el éxito de su aplicación dependerá en gran medida a la continua esclarecimiento de las proteínas y las interacciones vías de señalización implicadas en la etiología de las enfermedades complejas como el cáncer y el asma. El uso de siRNA como un agente antiviral implica una relativamente sencilla ataque a uno o más genes virales esenciales y deben ser efectivas contra muchos patógenos humanos incluyendo la gripe y el VIH, así como RV. El uso de la no integración de vectores del plásmido se evite el riesgo de mutagénesis posicional causados por algunos vectores virales, así como el desarrollo de drogas específicas-los sistemas de suministro como la nuestra a base de quitosano nanopartículas pueden proporcionar orientación eficaz a las células infectadas. En este informe, la eficacia de interferencia por ARN en la reducción de la infección por VRS y la patología pulmonar se demostró en un modelo animal. Se espera que esta estrategia pueda aplicarse para poner fin a todo el mundo la morbilidad y mortalidad asociada con la infección por VRS en los lactantes y los adultos inmunodeficientes que la vacunación es ineficaz.