PLoS ONE, 2007; 2(4): (más artículos en esta revista)

Evolución del Eje Especificación de los mecanismos en Jawed Vertebrados: Análisis de un condrictios

Biblioteca Pública de la Ciencia
Marion Coolen [1], Tatjana Sauka-Spengler [2], Delphine Nicolle [1], Chantal Le Mentec-[2], Yvan Lallemand [5], Corinne Da Silva [3], Jean-Louis Plouhinec [1], Benoît Robert [5], Patrick Wincker [3], De-Li Shi [4], Sylvie Mazan [1]
[1] Equipe Développement et Evolution des Vertébrés, UMR 6218, Université d'Orléans, Orleans, Francia
[2] Equipe Développement et Evolution des Vertébrés, UPRES-A 8080, Université Paris-Sud, Orsay, Francia
[3] Genoscope y UMR Centre National de la Recherche Scientifique (CNRS) 8030, Evry, Francia
[4] UMR7622, Université Pierre et Marie Curie, París, Francia
[5] Unité de Génétique Moléculaire de la Morphogenèse, URA Centre National de la Recherche Scientifique (CNRS) 2578, Institut Pasteur, París, Francia
Resumen

Los mecanismos genéticos que controlan el establecimiento de principios de polaridad y su relación con el eje embrionario y la especificación del patrón parecen diferir sustancialmente entre los vertebrados. En teleósteos y anfibios, el establecimiento de una pronta dorso-ventral polaridad determina tanto el lugar de eje y la formación de su rostro-caudal de orientación. Por el contrario, amniotes mantener una considerable plasticidad de su lugar de formación hasta el eje blástula etapas y se basan en señales extraembryonic secretada por los tejidos, que no tienen claro equivalentes a los primeros, para el establecimiento de su rostro-caudal patrón. La razón de estas diferencias aún se desconoce. A través de detallados análisis de expresión de genes clave del desarrollo en un condrictios, LA PINTARROJA Scyliorhinus canicula, hemos reconstruido el modelo ancestral de eje jawed especificación en los vertebrados. Se demuestra que LA PINTARROJA obligar muestra similitudes con amniotes a principios de blástula y gástrula etapas, incluida la presencia de una clara homólogos de la hypoblast y extraembryonic ectodermo. En el estado ancestral, estos territorios se especifican en polos opuestos de una pronta eje de simetría bilateral, homólogas a las dorso-ventral del eje de anfibios o teleósteos, y alineados con la posterior formación de eje embrionario, desde la cabeza a cola. Las comparaciones con amniotes sugieren que una expansión dorsal de extraembryonic ectodermo, por lo que al parecer en una simetría radial en las etapas finales de blástula, ha tenido lugar en su linaje. La síntesis de estos resultados con los de análisis funcionales en organismos modelo evolutivo apoya un vínculo entre el dorso-ventral polaridad de los anfibios y los teleósteos y embrionarias-extraembryonic organización de amniotes. Esto conduce a un modelo general de eje en gnathostomes especificación, que establece un marco comparativo para una reevaluación de conservación, tanto entre los vertebrados y con más distantes metazoos.

Introducción

En la actualidad está claro que el control genético del desarrollo de metazoos se basa en un número limitado de vías de señalización y la amplia familia de factores de transcripción, organizada en al menos parcialmente conservadas redes reguladoras, que han sido repetidamente reformado y reutilizados durante la evolución celular en diferentes contextos [ 1]. El descubrimiento de estos conservación tenido un fuerte impacto en el aumento de la embriología moderna, abriendo la posibilidad de incorporar los resultados obtenidos en un determinado modelo de organismo, como la drosófila, a una gama mucho más amplia de especies, por ejemplo, los vertebrados. Por otra parte, las comparaciones entre el modelo alejadas organismos han demostrado que incluso más inesperada, las similitudes no se limitan a los módulos de regulación propios, sino que se extienden a los procesos de desarrollo o los fenotipos celulares que están bajo su control [2], [3]. Sin embargo, la conservación de las complejas secuencias de celulares y el control de interacciones genéticas los procesos de desarrollo pueden ser difíciles de evaluar, incluso entre los relativamente especies estrechamente emparentadas. Diferentes razones cuenta de esta limitación. En primer lugar, las de conservación de los procesos de desarrollo pueden ser oscurecidos por el uso de diferentes enfoques experimentales, poniendo de relieve los distintos aspectos del mismo fenómeno, o por la presencia de paralogous genes, lo que resulta en función revolver [4], [5]. En la ausencia sistemática de análisis comparativos, las lagunas en nuestro conocimiento de las redes reguladoras y los sucesivos eventos de inducción que controlan los procesos de desarrollo también complicar considerablemente las comparaciones entre los organismos modelo, algunos aspectos están particularmente evidente en una especie pero menos fácilmente reconocible en otro [6 ]. Por último, la acumulación durante la evolución de las especies o grupos taxonómicos específicos de características morfológicas, como resultado de los cambios propios en el nivel molecular, puede hacer que sea muy difícil de definir homologías entre las poblaciones de células y, por tanto, establecer el vínculo entre los organismos modelo en bases sólidas [7] .

Los mecanismos que subyacen a principios de especificación en el eje vertebrados proporcionar un ejemplo de tales dificultades. Nuestra comprensión actual de este proceso, que se basa principalmente en estudios realizados en el pollo, ratón, Xenopus y pez cebra, sugiere muy divergentes entre los mecanismos de amniotes, anfibios y teleósteos. Los dos últimos comparten una serie de características importantes. Ambos principios de mostrar un dorso-ventral de polaridad, que es el momento de la fecundación establecido por la relocalisation de los factores determinantes de la madre hacia el lado dorsal del embrión. Esto se traduce en una compleja cascada de eventos de inducción genética y las interacciones entre la dorsal y ventral lados, lo que conduce a la formación del organizador y de las tres capas germinales en el inicio de la gastrulación [revisado en 8], [9]. La conservación de estos principios de interacciones genéticas en amniotes sigue siendo una cuestión abierta. Hasta hace poco, en general se considera que la simetría radial fue roto sólo en relativamente tarde, antes de la gastrulación en las etapas de pollo y ratón, por un coexpression de Vg1 y Wnt8 a nivel posterior de la zona marginal (PMZ) en la ex [10 ], [11] y por la polarizada, la parte anterior del desplazamiento de una población celular extraembryonic, el endodermo visceral anterior (AVE), en este último [12], [13]. Este punto de vista ha sido cuestionado recientemente en el ratón y actualmente es claro que el embrión está dotado de una simetría bilateral tan pronto como la etapa de blastocisto [14] - [17]. Sin embargo, la relación de esta polaridad a principios de la posición y antero-posterior orientación del eje embrionario sigue siendo una cuestión abierta. Por otra parte, al menos en el pollo, esta polaridad se mantiene una considerable plasticidad hasta antes de la gastrulación etapas, como se desprende de manipulaciones experimentales de la blastoderm [18], [19], [revisado en 20]. Una complicación adicional para un fin de unificar los mecanismos de formación en eje vertebrados proviene de la observación de que en amniotes, extraembryonic tejidos (epiblast sino también trophectoderm derivados en el ratón), desempeñan un papel importante a principios de antero-posterior del patrón [21] -- [26]. Estos tejidos no tienen claros homólogos en Xenopus y pez cebra, aunque candidato AVE equivalentes se han propuesto [27] - [32].

Con el fin de entender mejor el vínculo entre amniotes, anfibios y teleósteos, hemos utilizado una evo-Devo, dirigidos a la reconstrucción de los mecanismos moleculares ancestrales controlar principios de especificación en el eje jawed vertebrados. La justificación de este enfoque se basa en el hecho de que todas las especies están unidas por la ascendencia común de los ancestrales gnathostome estado. Una mejor comprensión de este estado, por lo tanto, puede ayudar a identificar las especies o taxones de características específicas, que oscurecer las relaciones entre los actuales organismos modelo. En este enfoque, se optó por centrarse en un condrictios, LA PINTARROJA Scyliorhinus canicula. Tres razones principales subyacen en esta elección. En primer lugar, como la hermana grupo de osteichthyans, chondrichthyans proporcionar la más cercana a amniotes afuera, anfibios y actinopterygians. Esta posición filogenética morfológicos permite comparaciones fiables con los organismos vertebrados modelo, lo cual es importante para identificar gnathostome características primitivas y es menos evidente con chordates más distantes, como ascidias o cephalochordates. Del mismo modo, a nivel molecular, relativamente baja las tasas de divergencia de secuencias y la presencia de clases compartidas orthology permitir robusto reconstrucciones filogenéticas y la identificación inequívoca de orthologues de los genes caracterizados en los organismos vertebrados modelo [33]. En segundo lugar, la serie de embriones puede ser relativamente fácil de obtener a partir de las primeras etapas de desarrollo y los cuadros se han establecido en esta especie [34]. Por último, LA PINTARROJA embrión se desarrolla como una amplia plana blastoderm acostado en una gran masa de yema indivisa y muestra ampliada, distinta, extraembryonic tejidos, lo que puede facilitar las comparaciones con amniotes [34], [35]. El detalle histológico y caracterización molecular de LA PINTARROJA embrión temprano se destacan similitudes sorprendentes no sólo con los anfibios y los teleósteos, sino también con amniotes. Tomados en conjunto, nuestros datos sugieren una inesperada conservado patrón molecular, que puedan reflejar los ancestrales jawed estado de los vertebrados, y dar lugar a un modelo, que proporciona una base para una síntesis de principios de vista antero-posterior del patrón mecanismos entre los vertebrados.

Resultados
Histológico caracterización DE LA PINTARROJA embrión en pre-gastrulación y gastrulación etapas

Hemos informado anteriormente las principales características morfológicas DE LA PINTARROJA antes y durante la gastrulación [36]. Con el fin de obtener una caracterización detallada histológico, se realizó secciones seriadas de embriones a partir de la 10 ª etapa, que precede al inicio de la gastrulación, etapa a 14, caracterizado por la individualización de la anterior-la mayoría de somites (Fig. 1]. Como se informó anteriormente [36], la aparición de un engrosamiento en el margen posterior de la blastoderm es un sello distintivo de la etapa 10 (Fig. 1A1, A3]. En esta etapa, el blastoderm consiste en un epitelio cuboidal simple superpuestos a una población mesenquimal de células con forma redonda (Fig. 1A1-A3]. Anterior a la blastocoel, mesénquima esta forma una densa población de células (Fig. 1A2], mientras que posteriormente las células aparecen más dispersos (Fig. 1A3]. En la 11 ª etapa, el epitelio cuboidal persiste en la fracción anterior de la blastoderm y se extiende por más de epibolia la yema, concomitantemente con un marcado adelgazamiento de las células mesenquimales población (Fig. 1B1, B2]. Por el contrario, la estructura histológica de la blastoderm sustancialmente los cambios en su posterior mitad. En este nivel, la capa superficial del epitelio se convierte en pseudostratified y plegado hacia adentro más de un 60 ° sector de la margen posterior (Fig. 1B3, B4]. Por tanto, forma una pendiente, que superposiciones de la que forman parte anterior del archenteron. En la parte anterior del involuted capa de células, las células epiteliales ahora mostrar una forma piramidal, que recuerda la de Xenopus botella población celular (Fig. 1B3]. Otra población de células dispersas alargada se hace visible adyacente a la antigua. Estas células se carece de manchas phalloidin cortical, en consonancia con un cambio de la estructura del citoesqueleto (Fig. 1B4]. Junto con la característica anterior posterior a la orientación de sus procesos (Fig. 1B3], esto es sugestivo de un epitelio a mesénquima transición se producen en este nivel. Etapa 12 se caracteriza por la primera aparición clara de la eje embrionario y la segregación de las tres capas germinales en el margen posterior (Fig. 1C1, C2]. A diferencia mesodermo y endodermo capas son visibles junto a la margen (Fig. 1C4], mientras que en la anterior línea media, una sola capa mesendoderm anterior overlies la punta de la archenteron (Fig. 1C3]. Mesendoderm Esta capa es continua con la suelta mesenquimales población de células alargadas, que se extiende sobre la yema de membrana (Fig. 1C2]. En esta etapa, la placa neural se convierte en distinta de la superficie adyacente ectodermo neural y los pliegues elevar. Estas grandes rasgos persisten en etapas posteriores (Fig. 1D, E], que se caracterizan por la extensión del eje embrionario y la individualización de la primera somites (etapa 14). Ambos anterior y lateralmente, el ectodermo embrionario y mesendoderm se continua con presumiblemente extraembryonic exterior epiteliales y mesenquimales capas interiores, tendido sobre la yema.

La regionalización de la parte posterior de armamentos durante la extensión del eje embrionario

Análisis de expresión en Brachyury S. canicula nos ha llevado a punto para la posterior margen como el principal sitio de mesodermo internalización durante la gastrulación [36]. Para seguir haciendo frente a esta hipótesis, hemos analizado la expresión de marcadores moleculares de axial, paraxial y lateral durante la gastrulación mesodermo (etapas 12 a 14). Al igual que en osteichthyans [37] - [41], dogfish FoxA2, Wnt8, Gata6 y MafB se expresan en diferentes mesodermal componentes de la recién formada eje embrionario (etapa 14). FoxA2 expresión se detecta en todos los tejidos línea media, así como la totalidad la formación de intestino (Fig. 2c, c ']. Wnt8 expresión territorio se encuentra lateral a la línea media FoxA2 positivo tejidos, tanto en el mesodermo paraxial y neuroectoderm, con exclusión de la ampliación cefálica (Fig. 2i, i']. Gata6 comparte con sus osteichthyan orthologs [42] - [44] una expresión concreta en el mesodermo lateral, en el nivel precardiac y posterior a él (Fig. 2L, l ']. Por último, MafB comparte con Gata6 una expresión en el mesodermo lateral, pero se extiende también a las mesodermo intermedio (Fig. 2o, o »]. En todos los casos, estos territorios dentro de la formación de embriones eje se continua con expresión concreta dominios a lo largo de la margen posterior. En este nivel, la medial a lateral alcance de estos dominios se diferencia entre los marcadores estudiados, lo que refleja su axial lateral a la distribución en el recién formado mesodermo. En la etapa 14, la expresión marginal de FoxA2 es, pues, limitarse a la notochordal triángulo (Fig. 2c], en los que aparece en gran medida la coincidencia con la expresión territorio de otro organizador marcador, Lim1 (Fig. 2f, f '] [45] - [ 47]. En esta etapa, Wnt8 expresión de dominio se encuentra en cada una de las partes de este territorio, en el abultamiento de armas posterior (Fig. 2i]. MafB y Gata6 transcripciones son en gran medida excluidos de este presunto mesodermo paraxial territorio y están restringidos a más partes laterales de la parte posterior del margen (Fig. 2L, o]. Esta regionalización de la parte posterior del margen ya observado en anteriores etapas, desde la etapa 12 a 13 (Fig. 2a, b, e, g, h, j, k, m, n]. También tomamos nota de que la expresión de MafB se extiende lateralmente a lo largo de la margen, incluido su anterior aspecto-la mayor parte (Fig. 2n]. Del mismo modo Bmp4, otro marcador de mesodermo ventral en anfibios [48], puede detectarse a lo largo de la parte anterior y lateral del margen (Fig. 2p, q, r, r '], lo que sugiere que un menor mesodermo población celular también puede ser internalizados en estos niveles.

Un temporal de regulación de embriones eje de formación rostral caudal a niveles

Con el fin de comprender mejor la formación del eje embrionario en el PINTARROJA COMUN, el próximo analizó la relación momento de expresión de marcadores moleculares expresadas en diferentes antero-posterior niveles alargándose en el eje embrionario, a partir de su aspecto morfológico (etapa 12) a somite etapas (estadios 14-15). En todos los casos estudiados, la aparición de la expresión de los marcadores estudiados rostral (Otx1, Otx2, SGC) precedió a la una de más caudal marcadores (HoxB1, CDX2, Mox1). En las etapas 13 a 14, Otx1 y Otx2 expresión territorios se superponen en gran medida a la anterior placa neural, con un marcado límite posterior, más tarde coincidiendo con el mesenphalon-metencephalon frontera (Fig. 3 b, c, e, f, f ']. Esta característica expresión de dominio, que se ha observado en todas las especies de vertebrados estudiados [49] - [53], ya está establecido por la 12 ª en una discreta población de células de la parte superior prospectivo neuroectoderm capa, alrededor de 10 diámetros de células muy lejos del margen posterior ( Fig. 3a, d, d ']. Del mismo modo, en la PINTARROJA COMUN, SGC comparte con sus homólogos osteichthyan [54] - [57] una expresión concreta en el territorio prechordal placa, que puede ser identificado sin ambigüedad a partir de la etapa 13 (Fig. 3 h, i, i ']. Esta expresión SGC territorio es ya evidente en la etapa 12 en la capa de células mesendoderm en que se basa la Otx territorio positivo (Fig. 3g, g '], lo que sugiere que la especificación de los posibles forebrain y neuroectoderm cerebro medio y la subyacente mesendoderm ha tenido lugar. En contraste, ninguno de los marcadores moleculares tronco estudiado puede ser detectada en el recién formado eje embrionario en esta etapa. HoxB1 transcripciones se limitan a un 90 ° en forma de media luna sector de la margen posterior (Fig. 3j] y sólo aparecen en la parte posterior adyacentes parte del eje embrionario alargándose a partir de la etapa 13, con la misma transcripción de distribución como en osteichthyans (prospectivo hindbrain, mesodermo paraxial [58], [59]] (Fig. 3k, l, l ']. Del mismo modo, al igual que en osteichthyans [60] - [62], CDX2 et Mox1 expresiones se limitan a la parte posterior de la mayor parte de la formación de embriones eje (neuroectodérmico endodermal y capas para la antigua; mesodermo paraxial para estos últimos) (Fig. 3 m, n, o, p, m ', p']. En ambos casos, de expresión es detectable en la primera etapa 13. Estos datos sugieren que, al igual que en osteichthyans, el eje embrionario también alarga a raíz de una rostral caudal para la progresión en LA PINTARROJA. Este proceso puede ser sometido a un estricto control temporal de esta especie. Por lo tanto, observar que las tres capas germinales están plenamente establecidos a muy corta distancia del margen posterior internalización mesendoderm donde se lleva a cabo.

Expresión de hypoblast y organizador de marcadores en el margen posterior de la blastoderm a pre-gastrulación etapas

En amniotes, jefe formación requiere secretada señales procedentes de dos centros de señalización, la hypoblast (o anterior endodermo visceral en el ratón) y los principios de gástrula organizador, también caracteriza a todos los organismos vertebrados modelo. Estas dos poblaciones de células comparten un conjunto de marcadores genéticos específicos incluidos Lim1, FoxA2, SGC y Otx2 homeodominio genes [revisado en 63]. Con el fin de identificar posibles homólogos en los territorios LA PINTARROJA embrión, hemos analizado la expresión de estos marcadores, entre ellos los tres dogfish Otx paralogues. Se realizó este análisis en las fases 10 y 11, que preceden a la formación de cabeza. En la 10 ª etapa, los cinco marcadores genéticos mostrar una expresión muy similar territorio que abarca un amplio sector en forma de media luna del margen posterior (Fig. 4A a-f]. Sus patrones de expresión segregar a la 11 ª etapa (Fig. 4A h-n], cuando se convierte en expresión Brachyury primera detectable en un anillo en forma de ectodermal dominio de terrenos colindantes, con exclusión de la blastoderm margen (Fig. 4A O, O ']. En esta etapa, todos, con la notable excepción de Otx2, comparten un territorio de expresión en el estrato inferior (Fig. 4A h'-n ']. Las señales obtenidas con estos marcadores no son totalmente superponibles, pero todos presentan la misma dinámica. Se caracterizan por una convergencia, a lo largo del margen y hacia la línea media posterior, de la señal en forma de media luna anteriormente, y un posterior desplazamiento anterior del etiquetado en la capa inferior, a una distancia de la margen posterior. Una segunda etiqueta territorio, compartida por Otx2, Otx5 y FoxA2 (Fig. 4A i'-k '], persiste en el margen, que se concentran en la línea media en el lugar donde el triángulo notochordal formas más tarde. Este sitio es expresión continua con el primer territorio en el caso de Otx5 (Fig. 4A j '], pero claramente distintas en el caso de FoxA2 (Fig. 4A k']. Lim1 y SGC también se expresan en esta ubicación, pero con características diferentes . El triángulo Lim1 notochordal expresión sólo es detectado en una fase posterior, a partir de la etapa 13 (Fig. 2e], mientras que el segundo sitio SGC expresión se inicia en la capa superior epiblast (Fig. 4A n '], observó transitoriamente al margen y más tarde se encuentran en la placa prechordal prospectivo como se ha descrito anteriormente (Fig. 3g-i]. En conjunto, estos datos destacan la presencia en la 11 ª etapa de dos territorios distintos, respectivamente, ubicados en el estrato inferior y en el margen posterior, mostrando gran superposición Lim1, SGC y FoxA2 señales y expresando diferentes combinaciones de Otx paralogues (Fig. 4B]. Además, Otx2 muestra un generalizado epiblast expresión que es de dominio exclusivo de esta paralogue. Este dominio se extiende a la parte central de la blastoderm pero excluye sus partes laterales, así como la anterior-la mayoría de epitelio cuboidal (Fig. 4A b, i].

Un solo Otx paralogue, Otx2, se expresará durante y antes de la gastrulación ratón [64]. Los patrones de expresión observados en LA PINTARROJA sugieren que, en contraste, a principios de funciones puede ser dividido entre las tres paralogs de esta especie. Con el fin de comprobar si dogfish paralogous proteínas están dotados diferentes propiedades bioquímicas, hemos utilizado microinyección de dogfish Otx1 sintéticas, Otx2 y Otx5 mRNAs en Xenopus embriones. No hay indicación de que esas diferencias pueden ser obtenidos mediante esta prueba experimental. Dorsal inyecciones de las tres formas paralogous a las cuatro de células etapa dio lugar a fenotipos idénticos, que se caracteriza por truncations posterior (Fig. 4C] se inyecta en todos los embriones (Tabla 1]. Para un estudio más a fondo los efectos de la sobreexpresión, ensayadas en embriones inyectados la expresión de Xnot2, Xbra y chordin, que son, respectivamente, tailbud, mesodermo y presunto organizador de marcadores (Fig. 4D]. La expresión de Xnot2 estar ausente o muy reducido en 9 de cada 10 embriones inyectados con dogfish Otx1 y Otx2 ARNm, y en 6 de cada 10 embriones inyectados con dogfish Otx5 ARNm, que proporciona una indicación de truncations posterior en los tres casos. Más del 90% de los embriones inyectados con dogfish Otx1 (n = 20), Otx2 (n = 20) o Otx5 (n = 21) mostraron mRNAs local Brachyury represiones de expresión a lo largo de la zona marginal. Por el contrario, chordin expresión no se afectó en todos los embriones a prueba (n = 20 para los tres paralogs). Estos resultados sugieren fuertemente que la sobreexpresión de los tres paralogs induce posterior truncations, relacionados con la inhibición de la convergencia de los movimientos de extensión. Del mismo modo, las inyecciones ventral llevado en todos los casos de embarazo ectópico anterior inducciones de las estructuras, según la evaluación de expresión de la glándula de cemento marcador XCG (Fig. 4D m-p]. Estos fenotipos son idénticas a las que ya se ha informado a la sobreexpresión de proteínas osteichthyan Otx [65], lo que sugiere una equivalencia funcional de los tres dogfish Otx proteínas.

Altamente dinámico patrones de expresión de moléculas de señalización antes de la formación del eje

Con el fin de seguir haciendo frente a los centros de señalización LA PINTARROJA embrión, el próximo analizó la transcripción de distribución de cinco moléculas secretadas por las que se sabe están involucrados en la especificación en el eje osteichthyans: Vg1, Wnt8, nodal, Bmp4 y Lefty. Este análisis se llevó a cabo en las primeras etapas de formación de eje (las etapas 9 a 12). Los cinco marcadores de exposición altamente expresión concreta a estos territorios etapas. Vg1, Wnt8, nodal territorios se solapan en la parte posterior margen en la etapa 9 (Fig. 5a, b, c] y segregar a las fases posteriores. En la 11 ª etapa, Wnt8 expresión de dominio se extiende por una amplia parte posterior y lateral sectores de la margen, pero excluye su parte medial, positivo para el organizador y hypoblast marcadores (Fig. 5g]. La señal se convierte entonces en limitarse a la formación posterior de armamentos en la etapa 12 como se ha descrito anteriormente (Fig. 5L, l ']. Vg1 expresión en la 11 ª etapa es muy diferente, que abarca toda la periferia de la blastoderm con la más alta intensidad de la señal en el margen posterior (Fig. 5f, f ']. Este periférico expresión persiste en la etapa 12, aunque con una menor intensidad de la señal (Fig. 5k]. Nodal territorio, que se limita a una estrecha hilera de células en la etapa 9 (Fig. 5c], se amplía notablemente a formar un amplio anillo marginal en la 11 ª etapa (Fig. 5h, h ']. Un gradiente de la intensidad de la señal se observa de posterior a anterior, las transcripciones, sin embargo, está excluido de la línea media posterior, con fronteras nítidas (Fig. 5 h "]. Esta expresión territorio persiste en etapas posteriores, aunque con una menor intensidad de la señal (Fig. 5m]. Lefty expresión, que es observado por primera vez en la 11 ª etapa (Fig. 5i, n, n '], en gran parte de los paralelos que nodal a lo largo de la margen . Bmp4 patrón de expresión difiere sustancialmente de los formadores. En la 10 ª etapa, que abarca una amplia zona de exclusión de blastoderm una posterior forma de media luna, territorio con fronteras difusas posterior (Fig. 5e]. Estos límites notablemente a agudizar la 11 ª etapa (Fig. 5j, j ']. En esta etapa, Bmp4 nodal expresión y territorios parecen en gran medida complementarios. En la etapa 12, Bmp4 persiste en los niveles más bajos en la capa superior epiblast, pero está excluido de la formación de placa neural y posterior armas. También pasa a ser detectable a lo largo de la anterior blastoderm margen de la posterior exclusión de armas (Fig. 5o; véase también la Fig. 2p].

Una de las primeras bilaterales eje definido por Bmp4 contrario Otx5/Nodal y territorios a partir de blástula etapas

La caracterización molecular de LA PINTARROJA embrión que muestra una clara asimetría molecular de la blastoderm, lo que refleja la última antero-posterior de polaridad del embrión propiamente dicho, se ha establecido en el pre-gástrula etapas. Con el fin de abordar esta asimetría cuando se estableció por primera vez, ampliado nuestra caracterización molecular de LA PINTARROJA embrión a fases anteriores a la formación de Blastocele (etapa 5 / 6) o ligeramente posterior (Etapa 7 / 8) (Fig. 6A h]. Expresión permanecido indetectable para la mayoría de los marcadores se ha descrito anteriormente, con excepción de tres de ellos, Bmp4, nodal y Otx5. En las dos etapas estudiadas, nodal y Otx5 pantalla prominentes y muy específicos señales restringidas a una discreta población de células situadas en el borde posterior de la blastoderm, junto a la Blastocele cuando se hace visible (Fig. 6A a, c, d, f] . Bmp4 expresando dominio abarca un amplio sector blastoderm (Fig. 6A b, e], situada frente a la Otx5 nodal positivo y margen posterior (Fig. 6A g]. En el PINTARROJA COMUN, Bmp4, nodal y Otx5 expresión territorios por lo tanto, definir una primera polaridad, que precisamente refleja la posterior antero-posterior de polaridad del eje embrionario.

Esta característica de los embriones dogfish nos llevó a probar una posible participación de Bmp4 en antero-posterior del patrón en osteichthyans, utilizando Bmp4-/ - embriones de ratón. En el inicio de la gastrulación, Otx2 transcripciones, que inicialmente se presente en todo el epiblast, normalmente un retroceso para el futuro parte anterior del embrión y se retire de la región proximal posterior cuando el nodo primitivo formas (Fig. 6B]. Este desplazamiento anterior de la etiqueta no se observó en ninguna de las Bmp4-/ - embriones analizados (3 / 3) (Fig. 6B b]. Además, todos estos embriones muestran una ausencia de Otx2 señal discreta en una población celular distal del endodermo visceral (Fig. 6B e]. Hemos analizado la próxima expresión de Dkk1, que es un antagonista selectivo Wnt expresada en el AVE (Fig. 6B c]. Todos los Bmp4-/ - embriones (2 / 2) mostró la espera anteriorisation de Dkk1 señal a 6,5 DPC (Fig. 6B d]. Sin embargo, una importante expansión distal de las transcripciones también se observó en todos los casos. Estos datos siguen siendo prelimary y tendrá que ser ampliado utilizando una amplia gama de marcadores genéticos. Sin embargo, las predicciones indican que inferirse a partir de una inesperada característica DE LA PINTARROJA puede utilizarse para hacer frente a nuevas hipótesis en un organismo modelo.

Discusión

Ante la falta de desarrollo de la genética y la embriología experimental técnicas, abordar los mecanismos que controlan el desarrollo temprano sigue siendo difícil en LA PINTARROJA. Teniendo en cuenta estas limitaciones, un enfoque alternativo es el estudio de la dinámica de los patrones de expresión génica en blástula y gástrula temprana stages.This enfoque no proporciona información sobre la conservación de los mecanismos adecuados, pero permite las comparaciones de las sucesivas especificación establece que son anteriores a la formación de eje. En el presente estudio, LA PINTARROJA embrión temprano resultó ser muy adecuado para tal enfoque comparativo, debido a una excelente resolución espacial y temporal de los perfiles moleculares observada. Las comparaciones de este muy dinámico patrón molecular con los organismos vertebrados modelo de relieve las similitudes inesperadas y proporcionar nuevos conocimientos sobre el estado gnathostome ancestrales.

Similares modos de gastrulación en chondrichthyans y en amniotes

Análisis de expresión en Brachyury LA PINTARROJA nos ha llevado a punto para la parte posterior de armamentos como el principal sitio de mesodermo internalización durante la elongación del eje embrionario [36]. Esta hipótesis se perfecciona por el estudio de marcadores regionales mesodermo. Los patrones de expresión de FoxA2, Wnt8 y Gata6 apoyar la conclusión de que la internalización de presunto axial, paraxial y lateral mesodermo contribuir al embrión adecuado se limita a la parte posterior de armas, con excepción de la lateral y anterior lados de la blastoderm, que se extendió por más de la epibolia yema de huevo. Esta conclusión se basa en la sorprendente continuidad entre los territorios de estos marcadores específicos de medial a lateral a los niveles de margen de la parte posterior y en el recientemente formado eje embrionario, que es sugestivo de celulares caminos que podría ir seguida de mesodermo células hacia su destino final. Sin embargo, no excluye la posibilidad de que un menor de edad, extraembryonic, mesodermo población de células también pueden ser internalizados en el anterior y lateral de los niveles blastoderm margen, donde los movimientos de células epibolia prevalecer. En realidad, observamos que estos territorios transitoriamente expresar Brachyury en las primeras etapas embrionarias eje de formación [36 y este estudio]. Además, MafB y Bmp4 expresión territorios a estos niveles reflejan con precisión el lugar donde extraembryonic sangre diferenciar las islas más tarde en LA PINTARROJA [34]. En conjunto, estos datos apoyan la opinión de que durante el eje de elongación, el margen blastoderm se divide en dos sectores, uno de embriones, limita a la parte posterior de armamentos, y un extra-embrionarias, que los excluye. El primero expresa marcadores de axial, paraxial y mesodermo lateral, que abarca en gran medida exclusiva, más y más territorios lateral de la parte posterior del margen, mientras que el segundo es sólo positivo para los marcadores de sangre islas. Esta regionalización del margen pueden ser fácilmente relacionados con la observada a lo largo de los anfibios blastoporo anillo y teleosteos blastoderm margen, dorsal y ventral de estos taxones correspondientes a posterior y anterior a LA PINTARROJA (ver Fig. 7A]. También es claramente una reminiscencia de la regionalización del nodo primitivo en el pollo y el ratón (Fig. 7A]. Mapas detallados suerte de estas especies han demostrado una correlación entre el destino final de las células en los distintos axial, paraxial, lateral y extraembryonic mesodermo componentes, y su posición a lo largo de las estrías, de anterior a posterior los niveles [66] - [68]. Esta distribución se corresponde exactamente a la que se infiere de posterior a lateral anterior y, a continuación, los niveles de margen en blastoderm LA PINTARROJA (Fig. 7A]. Como tal, las grandes características de gástrula LA PINTARROJA inesperadamente se recuerdan de aquellos mostrados por un reptil similar a la hipótesis de amniote antepasado de Arendt y Nübler-Jung [69] para tener en cuenta la transición de un anfibio a amniote de tipo gastrulación. La principal diferencia es que un residual mesodermo población celular, que puedan contribuir a extraembryonic sangre islas, persiste en LA PINTARROJA. En conjunto, estos datos sugieren que el aumento de nuevas modalidades de adaptación, como el aumento de la cantidad de yema de huevo, pueden tener forma independiente implicados convergentes modificaciones de la gastrulación en el proceso de condrictios y amniote linajes. Desde un punto de vista de desarrollo, también observamos que LA PINTARROJA embrión es susceptible de interpretaciones muy sencilla, la medial a lateral distribución de presunto mesodermo deducirse de la caracterización molecular a lo largo de la parte posterior de armamentos, precisamente, reflejo de su posterior ubicación en el eje embrionario. El proyecto de enlace con amniotes, por lo tanto, proporciona un marco comparativo para comprender la célula relativamente complicada y los movimientos contra-intuitiva de distribución axial mesodermo lateral a lo largo de progenitores anterior posterior a nivel de las estrías de amniotes [66].

Evolución de los mecanismos de inducción forebrain en jawed vertebrados
Una secuencia conservada de inducciones mesendoderm especificación anterior a la posterior margen de LA PINTARROJA blastoderm

Análisis genéticos en organismos modelo proporcionar cada vez más evidente que la inducción de mesendoderm se basa en una compleja cascada de reglamentación, con la participación de FGF, Wnt y TGF-β relacionados con las señales [revisado en 102]. La secuencia temporal de la correspondiente pliego de medidas ha sido mejor descrito en el pollo. En esta especie, la coexpression de Wnt8 y Vg1 a nivel de la zona marginal posterior corresponde a la primera asimetría molecular indicativa del lugar de eje y formación es necesaria para inducir a las expresiones de ambos nodal y Brachyury adyacentes a la posterior epiblast [10] , [103]. Esta inducción no inmediatamente como resultado la formación de nodo primitivo, debido a una complicación transitoria de la represión de señalización nodal de la hypoblast subyacente a nivel de la hoz Koller [75]. El desembolso de esta inhibición por el anterior desplazamiento de la hypoblast conduce a la formación del nodo primitivo y la expresión de Lefty, un inhibidor nodal comentarios [75]. En el PINTARROJA COMUN, el cierre temporal entre la sucesión transitoria Vg1 y Wnt8 co-expresión en la fase posterior margen, la marcada intensificación de expresión nodal en el presunto mesendoderm y la aparición de Brachyury y Lefty expresiones en la periferia de la blastoderm es sorprendente que recuerdan de la secuencia genética de las interacciones descritas en el pollo. Junto con la acumulación de pruebas funcionales en los organismos vertebrados modelo [102], esto sugiere que la inducción mesendoderm se basa en una gran red genéticos conservados participación de Vg1, nodal y Lefty actividades de señalización. Por otra parte, observamos una marcada, transitorios nitidez de las fronteras del territorio Bmp4 expresión en LA PINTARROJA la 11 ª etapa del embrión concomitante con la aparición de expresión nodal en el presunto mesendoderm adyacentes. Esta correlación, que no ha sido reportado hasta ahora ni en Xenopus o pez cebra, es coherente con una estimulación de la expresión de Bmp4 nodal señales adyacentes, según se informa en el ratón [104] - [106]. La caracterización molecular de LA PINTARROJA embrión, por lo tanto, se destacan fuertes similitudes con amniotes en la secuencia temporal de la genética inducciones que se llevan a cabo no sólo durante, sino también antes de la gastrulación. También sugiere que estas interacciones, que tienen lugar entre la zona marginal posterior y adyacente Koller la hoz en el pollo, seguir unos a otros, con un fuerte temporal de regulación, a LA PINTARROJA margen posterior.

Temprano en polaridades LA PINTARROJA blástula: implicaciones para la evolución de los primeros dorso-ventral del eje

En el PINTARROJA COMUN, el Blastocele se asocia, a partir de las primeras etapas de su formación, a la parte posterior de la blastoderm [34], donde el organizador y el eje posterior de embriones. Expresión análisis de Bmp4, nodal y Otx5 muestran que una asimetría molecular define el organizador lado de la blastoderm antes de la primera aparición de esta morfología histórica. Esto significa que mucho antes de la inducción de Vg1 y Wnt8 en el margen posterior y la aparición del eje embrionario propiamente dicho, LA PINTARROJA blastoderm ya exhibe una simetría bilateral, por el contrario se define Otx5 / nodal Bmp4 expresión y territorios. Esta primera polaridad, lo que refleja el organizador después de aborganizer eje, es claramente una reminiscencia de los primeros dorso-ventral del eje de anfibios y teleósteos [9], [107] - [109]. Un enlace con amniotes también puede ser propuesto. En el ratón como en el pollo, Bmp4 se expresa en un territorio que sólo contribuye a extraembryonic tejidos en las etapas finales de blástula [110], [111]. En el PINTARROJA COMUN, morfológico análisis sugieren que la expresión territorio Bmp4 principalmente contribuye de manera similar a la extraembryonic ectodermo que se extiende por más de epibolia la yema en las etapas finales de blástula (etapas 9-10). Sin embargo, si bien presenta una simetría radial, en torno a embriones, Otx2 nodal positivo y territorios en los amniotes, se limita a lo contrario, ab-organizador, parte del blastoderm en LA PINTARROJA (ver Fig. 7B, comparar la columna 2 en LA PINTARROJA , Pollo y ratón). Las comparaciones entre estos dos modos de desarrollo sugieren que amniote evolución puede tener en una posterior ampliación y fusión de Bmp4 positivo extraembryonic tejidos, tal y como previsto por el modelo teórico propuesto por Arendt y Nübler-Jung [69]. Un proceso en realidad también se lleva a cabo en LA PINTARROJA aunque en etapas mucho más tarde, el saco de yema de huevo extraembryonic expansión lateral y posteriormente lo largo de la yema para fusionar posteriormente al saco vitelino que une el embrión a la yema [34]. Este escenario evolutivo implica que en las etapas blástula, Bmp4 positivo jawed territorios de los vertebrados, como las de anfibios o teleosteos ventral cap animal, el ratón extra-ectodermo embrionario, el pollo y zona opaca LA PINTARROJA ab-organizador de la fracción blastoderm, derivan todos de la misma territorio ancestral, es decir, son homólogas, aunque más tarde seguir muy diferentes destinos (ectodermo embrionario superficie en Xenopus y pez cebra, extraembryonic propios tejidos que exhiben muy diversificado las vías de diferenciación en el PINTARROJA COMUN, ratón y pollo). Otro resultado es que en las etapas blástula, la genética mecanismos que pauta el embrión a lo largo del dorso-ventral (u organizador-aborganizer) El eje de anfibios, teleósteos y chondrichthyans, podrían estar relacionados con los que actúan a lo largo de las embrionarias-extraembryonic (distal-proximal en el ratón) El eje de amniotes, sus similitudes que reflejan las características ancestrales conservadas. Un elemento esencial restantes cuestión planteada por este modelo es para saber si la expansión radial del territorio ancestral ventral es completa en amniotes sea cual sea el escenario, lo que dará lugar a una verdadera simetría radial, o si un vestigio del sitio posterior fusión de las hojas una asimetría ( véase la Fig. 7B]. La acumulación de datos que muestran una simetría bilateral del blastocisto [15] - [17] y lo que sugiere que el ratón extraembryonic ectodermo podrían estar dotado de una pronta polaridad [26], prestará apoyo a esta última opinión.

Un vínculo ancestral entre el organizador-aborganizer polaridad de la blástula y el antero-posterior de polaridad del eje embrionario

Una característica notable de LA PINTARROJA embrión es que los primeros Bmp4 - Nodal/Otx5 eje es precisamente alineados con el futuro jefe de cola eje del embrión (ver Fig. 7B]. Estas correlaciones sugieren que los primeros modelos de LA PINTARROJA blastoderm puede transmitir una información sobre la posición controlar el rostro-caudal polaridad del eje embrionario en las primeras etapas de su formación. Esta hipótesis es coherente con los datos disponibles funcionales en organismos modelo, teniendo en cuenta el territorio propuesto homologías entre LA PINTARROJA y otros vertebrados. En los anfibios y el pez cebra, un vínculo entre principios de dorso-ventral y más tarde antero-posterior del patrón es claro, dorsalised y ventralised fenotipos que se caracterizan respectivamente por cabeza o tronco-cola expansión a expensas de los demás [112] - [115]. Sin embargo, sigue siendo difícil saber si el primer antero-posterior asimetrías se establecen antes de la gastrulación mesodermo o si es necesario para este proceso. En el ratón, nuestro modelo evolutivo plantea la posibilidad de un vínculo entre conservan la embrionaria-extraembryonic organización (distal-proximal eje en el ratón, que se propone aquí a estar relacionado con el dorso-ventral del eje de anfibios o teleósteos) y más tarde el rostro - patrón caudal del embrión propiamente dicho. Esta idea está saliendo de varios análisis recientes de ratones mutantes, lo que demuestra que los defectos a lo largo de la proximo-distal eje del conceptus a principios de post-implantación y las etapas a lo largo de la antero-posterior del eje del embrión adecuado al comienzo de la gastrulación son con frecuencia asociados [17] [25] y también cuenta con el apoyo de la radialisation de expresión Otx2 territorio observado en Bmp4-/ - mutantes (este estudio). El principal mecanismo involucrado puede ser una restricción del alcance de la anterior endodermo visceral de extraembryonic ectodermo antes de la gastrulación, como se muestra directamente la ablación de los experimentos [24] - [26]. Estos datos apoyan la opinión de que en el ratón, a principios de interacciones genéticas a lo largo del proximo-distal del eje de control de asignación de células a la cabeza frente al tronco y la cola territorios. En el PINTARROJA COMUN, la ubicación relativa de la propuesta de los equivalentes de la anterior endodermo visceral (la 10 ª etapa posterior margen) y extraembryonic ectodermo (Bmp4 territorio positivo) a polos opuestos de la blastoderm apoya la posibilidad de interacciones antagónicas homóloga. También es coherente con una función conservada de la primera fase nodal en la especificación de la anterior endodermo visceral homólogo en el PINTARROJA COMUN, como se ha demostrado en el ratón [104], [116]. Así, a pesar de las amplias diferencias morfológicas entre las especies, la caracterización molecular de LA PINTARROJA embrión y análisis funcionales en organismos modelo se pueden integrar en un modelo coherente de principios de antero-posterior especificación eje fundamental que afecta a dos pasos. En una primera, los mecanismos genéticos que actúan en etapas blástula determinar la expansión de una dorsal y ventral territorio, respectivamente homóloga a la anterior endodermo visceral y extra-ectodermo embrionario en el ratón. En un segundo paso, al inicio de la gastrulación, estos dos territorios, a su vez, el control de asignación de células a la cabeza del tronco versus-cola embrionarias territorios. La relativa posición filogenética DE LA PINTARROJA amniotes apoyo y la ancestralidad de este proceso de dos pasos en jawed vertebrados.

Conclusión

En este trabajo, hemos utilizado un enfoque comparativo sistemático, destinado a comprender el vínculo que existe entre los vertebrados, como complemento a los enfoques mecanicista llevado a cabo en organismos modelo. Un punto crucial ha sido la utilización de un modelo no organismo, elegido tanto por su posición filogenética clave entre los vertebrados y sus características de desarrollo. El modelo resultante integra los mecanismos de principios de cabeza y antero-posterior del eje especificación propuesta en el modelo de los organismos vertebrados en un punto de vista y unificar también conduce a predicciones apoyada por los resultados preliminares obtenidos en un ratón mutante. Las cuestiones importantes será la de evaluar cómo los diferentes organismos modelo, o no han divergentes general de este modelo básico y para obtener conocimientos en el gen regulador de red o contrataciones, que representan para las especies o taxones de adaptaciones específicas. Será igualmente importante a prueba directamente hasta qué punto los mecanismos genéticos que controlan el establecimiento de este patrón se conserva, se conservan a través de sí mismos y más allá de los vertebrados.

Materiales y Métodos
Nomenclatura

A lo largo de este manuscrito, anterior y posterior se refieren a la futura ubicación relativa de cabeza versus tronco y la cola territorios, pero no a la correspondiente presunción de territorios. En el último párrafo del debate que prefiere el uso de dorsal y ventral, respectivamente, para referirse a la parte posterior y anterior organizador y / ab-organizador lados de la blastoderm, al igual que en Xenopus o pez cebra. Esta terminología se ha elegido aquí para evitar cualquier confusión con el rostro-caudal (cabeza-cola) de polaridad del embrión propiamente dicho.

PINTARROJA embriones

Recién establecido S. canicula huevos se obtuvieron de la Estación Biológica de Roscoff y se mantiene a 15 ° C oxigenada en agua de mar. Los embriones fueron disecados y por etapas de acuerdo a [34].

Histológico descripción de S. canicula embriones

Por hematoxilina / eosina tinción, S. canicula embriones fueron fijadas en paraformaldehído al 4% en PBS (PFA 4%), deshidratados en metanol, butanol incubadas en la noche a la mañana y embebidos en parafina para micrótomo en secciones de 5 μ m La tinción se realizó en el 5% de hematoxilina / eosina solución durante 1 minuto. Diapositivas fueron montadas en Eukitt.

Por rodamina phalloidin-tinción, los embriones fueron fijadas en PFA 4% y embebidos en la gelatina antes de criostato a la sección 10 μ m. Diapositivas fueron posteriores a los fijados en PFA 4%, enjuagarse dos veces en PBS 0,1% Tritón, y se incubaron en una solución de rodamina-phalloidin (Molecular Probes) a 5u/ml en PBS / BSA 1% durante 20 minutos. Después de dos lavados en PBS, fueron montadas utilizando Vectashield (Vector), complementado con DAPI.

La clonación de las sondas S. canicula
Análisis de Bmp4 ratón mutante nulo-embriones

Ratones de la línea B6.129S2-Bmp4 tm1Blh / J fueron obtenidos por cortesía del Dr Robert Benoit y se describen en [120]. Mus musculus Dkk1 y Otx2 sondas fueron amplificados por RT-PCR a partir de cDNA de embriones de ratón (fase 6.5-7.5 DPC ), Utilizando respectivamente los siguientes pares de cebadores: TCTATGAGGGCGGGACA / ATTGCTGGCTTGATGGTGA y ATGATGTCTTATCTAAAG / TCACAAAACCTGGAATTT. Productos de PCR fueron subcloned en un HindIII EcoRI-o-EcoRI BamHI digerido PTZ19R vector.

Todo el montaje in situ hybrization de dogfish y embriones de ratón

Digoxigenina-11-UTP (Roche) etiquetados antisens sondas de ARN S. canicula Otx1, Otx2, Otx5, Lim1, FoxA2, SGC, MafB, Lefty y Mus musculus Dkk1 y Otx2, fueron sintetizados de linearized plasmid utilizando plantillas T7 ARN polimerasa. Para los marcadores recuperados de la biblioteca de cDNA, una plantilla de PCR se obtuvo a partir de un plásmido de ADN minipreparation, utilizando los siguientes primers: AAAGCTGGTACGCCTGCA y TAATACGACTCACTATAGGGAGAG CGTACGTAAGCTTGGATC , Lo que conduce a la adición de un promotor T7 (subrayado) en orientación antisentido.

Todo el montaje in situ hibridaciones se realizaron de acuerdo a procedimientos estándar. Por doble hibridación in situ, una sonda fue marcada con digoxigenina-11-UTP y el otro con fluoresceína-12-UTP (Roche). RNA fueron detectados utilizando secuencialmente-fosfatasa alcalina-junto anti-DIG anticuerpos (Roche) con el BM púrpura (Roche) como sustrato, y junto HRP-anti-anticuerpo de fluoresceína (Roche) con el DAB (Vector) como sustrato. Para el análisis histológico siguiente conjunto de montaje en hibridaciones, los embriones fueron embebidos en parafina antes de micrótomo sectionning a 10 μ m. Las diapositivas se counterstained con eosina (2%).

Xenopus embriones y microinyección

Xenopus huevos se obtuvieron de mujeres inyectadas con 500 UI de gonadotropina coriónica humana (Sigma), y fertilizados artificialmente. Los huevos fueron dejellied con un 2% de clorhidrato de cisteína (pH 7,8) y los embriones se organizaron de acuerdo a [121].

Tope mRNAs fueron sintetizados de linearized plásmidos usando SP6 RNA polimerasa (Roche) en presencia de 500 μ M 5'-mGpppG-3 "tope analógico, 500 μ M cada rUTP, RATP, rCTP y 50 μ M rGTP. MRNA sintético fue purificado utilizando una Sephadex G-50 la columna (Pharmacia). Microinyección de embriones se realizó a 0,1 × Modificado Barth's Solution (MBS) que contiene 3% Ficoll 400. Ellos se mantuvieron en esta solución durante tres horas y luego cultivadas en 0,1 × MBS para las fases oportunas.

Apoyo a la Información

Damos las gracias a Sébastien Paturance (UPS 44, Orléans) que optimizar las condiciones para el mantenimiento de embriones dogfish, Lévèque Laurent y Bernard Kloareg (Estación biologique de Roscoff), que siempre dogfish embriones. También damos las gracias a Fabrice Girardot para iniciar el análisis de expresión Otx1 y Otx2 en dogfish embriones, Jim Langeland para compartir conocimientos en la biblioteca de cDNA y la construcción Génoscope personal para tomar a su cargo el análisis transcriptome.