Nucleic Acids Research, 2007; 35(4): e22-e22 (más artículos en esta revista)

Un sistema inducible de expresión y la validación de la especificidad de horquilla corta el ARN en células de mamífero

Oxford University Press
Hoi Ma Tang, Kin El Fan, Yiu Huen Tsang, Randy YC Poon [*]

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Reconocimiento No comercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) que permite sin restricciones el uso no comercial, distribución y la reproducción en cualquier medio, siempre que la obra original esté debidamente citados.

Resumen

Interferencia por ARN (RNAi) por medio de la horquilla a corto RNA (shRNA) se ha convertido en una herramienta de gran alcance por la pérdida de la función de análisis en células de mamífero. El principal problema en experimentos de RNAi está fuera de objetivo efectos, y la más enérgica manifestación de la especificidad de shRNA es el rescate de los efectos RNAi con un shRNA-gen resistente objetivo. Esto presenta sus propios problemas, incluida la relativa impredecible shRNA expresión de cDNA y salvamento en las células individuales, y la dificultad en la generación de líneas celulares estables. En el presente informe, se evalúa la plausibilidad de combinar la expresión de shRNA cDNA y salvamento en el mismo vector. Además de facilitar la validación de shRNA especificidad, este sistema también simplifica considerablemente la generación de shRNA de las líneas celulares que expresan. Desde el cDNA de compensación se encuentra bajo el control de un promotor inducible, estable shRNA de expresar las células se pueden generar ante la desmontables fenotipos se estudian de forma condicional apagar el rescate de proteínas. Por el contrario, el rescate de proteínas puede ser activado después de la proteína endógena es totalmente reprimidos. Este enfoque es particularmente apropiado cuando prolongada expresión de cualquiera de los shRNA o la compensación cDNA es perjudicial para el crecimiento celular. Este sistema permite una sola fase de validación de shRNA y la generación de shRNA estable-expresando células.

INTRODUCCIÓN

Interferencia por ARN (RNAi) es una conservadas evolutivamente la silenciación del gen proceso desencadenado por doble hundidos RNAs (dsRNAs) (1]. El uso de RNAi como una técnica para analizar la pérdida de función fenotipos ha revolucionado la investigación en células de mamífero. Una manera de inducir RNAi en células de mamífero es de transfección de sintéticos pequeños RNAs de interferencia (siRNAs). Estos siRNAs son 19-base-pair (bp) dsRNA con 2-nucleótidos (nt) 3 'domina (2] y, imitan la estructura de Micro RNA (los genes miARN) intermedios de la naturaleza ya la transformación de dsRNA de RNasa III. Un capítulo de los genes miARN siRNA o dúplex (llamada guía capítulo) se ha incorporado al ARN inducida por silenciar complejo (RISC), donde dirige RISC a obligar a ARNm complementarios. Se cree que la otra vertiente de la siRNA o los genes miARN (llamada línea de pasajeros) no se haya incorporado en RISC y se destruye. RISC cleaves los mRNAs de un sitio a 10 nt río arriba de los nucleótidos que complementan la 5'-la mayoría de nucleótidos de la guía capítulo, y los fragmentos de ARNm son degradados por otros nucleasas, lo que resulta en desmontables de expresión (3).

Otra manera de inducir RNAi en células de mamífero es expresión de plásmidos o vectores virales. Un enfoque común consiste en la transcripción de ARN polimerasa III de horquilla corta RNAs (shRNA). El shRNAs consistirá en un tallo de 19-29 pb unidas por un pequeño terminal de bucle (4-6]. La opinión predominante es que shRNAs imitar la estructura de los genes miARN intermedios generados por la enzima RNasa III Drosha. Otro RNasa III enzima llamada Dicer actúa en el shRNAs para producir siRNA / genes miARN duplex, que luego se cargan en RISC para mediar en silenciar (7].

El uso de shRNA ofrece varias ventajas importantes sobre siRNA (8]. En primer lugar, más opciones de entrega están disponibles para shRNA, incluidos transfección, electroporación y la infección con vectores virales. En segundo lugar, sustancialmente más bajo costo se requiere para generar shRNA de siRNA. Por otra parte, mientras que silenciar mediante siRNA es inevitablemente transitorio, shRNA-expresando construcciones pueden ser integrados en establemente el genoma. Por último, si bien los efectos de siRNA después de la entrega es constitutivo, tanto inducibles y constitutivas de sistemas pueden utilizarse para shRNA después del parto.

Es generalmente aceptado que el principal problema de utilizar shRNAs (así como siRNAs) en la experimentación es la posibilidad de fuera de objetivo efectos (9, 10]. Varios métodos se utilizan para confirmar la especificidad del RNAi resultados, incluida la utilización de shRNAs contra los objetivos irrelevante y el uso de múltiples shRNAs contra el mismo gen. Sin embargo, en última instancia el control de shRNA experimento es el rescate de la RNAi efectos de la expresión de los genes objetivo en una forma refractaria a la shRNA (11, 12]. Esto se suele lograrse mediante la introducción de una o más mutaciones puntuales en silencio a la región del cDNA que está dirigido por el shRNA.

El rescate de RNAi fenotipos utilizando shRNA resistentes a cDNA sí pueden presentar varios problemas. Es probable que las células individuales puede durar hasta cantidad diferente de shRNA cDNA-versus-expresando construcciones, dando lugar a un espectro de fenotipos en una población. Por otra parte, no es trivial para obtener estable tanto expresión de cDNA shRNA y al mismo tiempo. Aquí se describe una solución a los problemas utilizando un sistema que expresa tanto la shRNA y el rescate de cDNA a partir de la misma plásmido. Como el cDNA se encuentra bajo el control de un promotor inducible, los efectos del gen desmontables son efectivamente bajo control condicional. Esto simplifica considerablemente la generación de líneas celulares estables cuando prolongada expresión de cualquiera de los shRNA o la compensación cDNA es perjudicial para el crecimiento celular. La eficacia del sistema pKAR se demuestra con ciclina A y MAD2.

MATERIAL Y MÉTODOS
Materiales

Todos los reactivos se obtuvieron de Sigma-Aldrich (St. Louis, MO, EE.UU.), a menos que se indique lo contrario.

Construcciones de ADN

pKAR1 se basa en pUHD-P1/3C (13], que a su vez se basa en la tetraciclina-inducible sistema pUHD10-3 (14] (un regalo del Dr Hermann Bujard, Universidad de Heidelberg, Alemania), y mU6pro (5] (un regalo del Dr David Turner, de la Universidad de Michigan, MI, EE.UU.). El H I Bam-Bam HI fragmento fue removido de pUHD-P1/3C. El plásmido resultante fue cortado con Hind III-Pvu II, y se incluirán con el Hind III-Pvu II fragmento de mU6pro. I BBS sitios fueron destruidas por mutagénesis utilizando los oligonucleótidos 5'CCCTTTCGTCTTTAGTCGAGTTT3 ', 5'CATAGAAGAGACCGGGACC3' y 5'GAGGCGAAGCTTCGGGCGGC3 ' (y sus antisentido). Mutación de la BBS I en el sitio promotor CMV no afectó expresión (nuestros datos no publicados). ShRNA construcciones específicas fueron creadas por recocido los siguientes pares de cebadores en BBS I-Xba I de mU6pro o pKAR1: 5'TTTGGTAGCAGAGTTTGTGTACATTCAAGAGATGTACACAAACTCTGCTACTTTTT3 'y 5'CTAGAAAAAGTAGCAGAGTTTGTGTACATCTCTTGAATGTACACAAACTCTGCTAC3' (corresponde a las posiciones 823-841 de la ciclina A2 ORF); 5'TTTGGAGTCGGGACCACAGTTTATTCAAGAGATAAACTGTGGTCCCGACTCTTTTT3 ' y 5'CTAGAAAAAGAGTCGGGACCACAGTTTATCTCTTGAATAAACTGTGGTCCCGACTC3 '(corresponde a las posiciones 505-523 de MAD2 humanos ORF). Sitio de mutagénesis dirigida se llevó a cabo con QuickChange sitio de mutagénesis dirigida kit (Stratagene, La Jolla, CA, EE.UU.). Plásmidos expresar BANDERA-etiquetados ciclina A (15], GST-3C proteasa (13] y histona H2B-GFP (16] se construyeron u obtenidos de fuentes como descrito anteriormente. Ciclina A resistentes a la shRNA fue creada por la introducción de mutaciones en silencio usando el oligonucleótido 5'CCAGAAGTAGCGGAATTCGTCTACATTACAGA3 'y su antisentido. La ciclina A shRNA (en mU6pro) fue ligated en esta utilizando el plásmido Hind III-Pvu II para crear sitios BANDERA-ciclina A / shRNA en pKAR1. El Bam HI fragmento que contiene el puromycin-gen resistente (un regalo de Katsumi Yamashita, la Universidad de Kanazawa, Japón) se puso en Bam H-I-FLAG corte ciclina A / shRNA en pKAR1 para generar BANDERA-ciclina A / shRNA en pKAR1/PUR . MAD2 en CMV5 fue un regalo de Robert Benezra (Memorial Sloan-Kettering Cancer Center, NY, EE.UU.). El fragmento NCO me fue ligated en pUHD-P2 (15] para generar HA-MAD2 en pUHD-P2. El silencio se introdujeron mutaciones utilizando 5'GAGTCAGGTCCTCAGTTTA3 '(y su antisentido) para crear un shRNA resistentes MAD2. El MAD2 shRNA (en mU6pro) fue ligated en esta utilizando el plásmido Hind III-Pvu II para crear sitios HA-MAD2/shRNA en pKAR1.

Cultivo celular

HtTA1 células son células HeLa (carcinoma de cuello uterino humano) que expresa el represor tetraciclina TTA quimera (15]. Las células fueron cultivadas en la Dulbecco modificado a medio Eagle (DMEM) complementado con un 10% (v / v) de suero de ternera (Invitrogen Life Technologies, Carlsbad, CA, EE.UU.) humidificado en una incubadora a 37 ° C en el 5% de CO 2. A menos que se indique lo contrario, las células fueron tratadas con los siguientes reactivos a la concentración final se indica: blasticidin (5 μ g / ml), doxiciclina (2 μ g / ml), nocodazole (0,1 μ g / ml), y puromycin (1 μ g / ml). Las células fueron transfectadas con la precipitación de fosfato de calcio método (17]. Cell-gratis extractos se prepararon tal como está descrita anteriormente (18]. Por la expresión transitoria de shRNA-expresando plásmidos, un plásmido que expresa la histona H2B-GFP y un blasticidine-gen resistente fue cotransfected y las células fueron cultivadas en un medio que contiene la blasticidin durante 36 h para enriquecer la transfectadas las células. Selección medio se lavan a cabo y las células fueron cultivadas en medio normal para otros 12 h. Para la generación de líneas celulares estables, las células fueron transfectadas con BANDERA-ciclina A / shRNA en pKAR1/PUR y crecido en el medio que contiene puromycin. Después de unas dos semanas de selección, cada uno colonias aisladas y se propaga en ausencia de puromycin. Individual clones fueron modelo de tratados o expuestos a la doxiciclina durante 48 h antes de células libres de extractos fueron preparados. El desmontables endógeno de ciclina A y la expresión inducible de FLAG-ciclina A fueron evaluados por inmunotransferencia para ciclina A.

Citometría de flujo

Las células fueron trypsinized y lavado con buffer fosfato-salino (PBS). Las células fueron fijadas en el helado de etanol al 80% y teñidos con una solución que contenga 40 mg / ml de yoduro de propidio y 40 mg / ml RNaseA a 37 ° C durante 30 min. La distribución del ciclo celular (para 10 000 células) se analizó usando una máquina FACSort (Becton-Dickinson). Para el análisis bivariado de contenido de ADN y la expresión ciclina A, las células fueron cosechadas por trypsinization, fijado en el 1% v / v paraformaldehido durante 5 min a 25 ° C, y resuspendido en hielo-MeOH frío durante 10 min. El pellet de células se lavan dos veces con PBST (PBS + 0,5% Tween + 0,05% w / v BSA), resuspendido en buffer los residuos, y se incubaron con 1 μ g de anticuerpo monoclonal E23 a 25 ° C durante 60 min. Las células fueron lavadas dos veces con PBST, resuspendido en buffer los residuos, y se incubaron con 2,5 μ l de FITC-conjugado de conejo anti-ratón IgG (Dako, Glostrup, Dinamarca) a 25 ° C durante 60 min. Después de lavar dos veces en SAFT, las células fueron procesadas para la tinción de yoduro de propidio y citometría de flujo.

Anticuerpos y métodos inmunológicos

Los anticuerpos monoclonales A17 contra CDC2 (19], E23 contra la ciclina A2 (20], M2 y contra etiqueta BANDERA (21] se obtuvieron a partir de fuentes como descrito anteriormente. Anticuerpo monoclonal contra V152 ciclina B1 fue un regalo del Dr Julian Gannon y el Dr Tim Hunt (Cancer Research UK, Reino Unido). Anticuerpo monoclonal contra MAD2 se obtuvo de BD Biosciences Pharmingen (Franklin Lakes, NJ, EE.UU.). Immunoblotting se realizó tal como está descrita anteriormente (18].

RESULTADOS Y DISCUSIÓN

Hemos construido el pKAR (desmontables y Salvamento) plásmidos sobre la base de un sistema inducible diseñado por Hermann Bujard del grupo (14], y un shRNA-expresando sistema se originó a partir de David Turner del grupo (5] (Figura 1 A). El shRNA se expresó de un ratón U6 ARN promotor, y el rescate de cDNA se expresó bajo el control de doxiciclina. El cDNA de pKAR1 expresó fue diseñada para fusible en la N-terminal con una bandera de etiqueta y una proteasa 3C división sitio (Figura 1 B). Debido al ligero aumento de tamaño conferida por el epítopo etiqueta, tanto la proteína endógena a ser silenciadas y los ectópica expresó versión puede ser detectado de manera simultánea. La etiqueta también permite la proteína recombinante para ser específicamente detectado o immunoprecipitated. Por otra parte, el epítopo etiqueta se puede quitar utilizando 3C proteasas.

Para evaluar si el sistema funciona pKAR en concepto de principal, ponemos a prueba la orientación de dos genes: ciclina A y MAD2. Ciclina desempeña un papel fundamental en la fase S y la mitosis (22], y MAD2 es un componente esencial del husillo puesto de control de montaje (23]. Los oligonucleótidos diseñados para expresar shRNAs en contra de estos genes se pusieron detrás de la U6 promotor. El rescate MAD2 y ciclina A cDNAs se subcloned bajo el control de la tetraciclina elemento de respuesta (TRE) (Figura 2 A). El silencio se introdujeron mutaciones en las regiones que están dirigidos por el shRNAs, que presten sus mRNAs a ser resistentes a la desmontables (Figura 2 B). En este estudio, las células HeLa que expresaban el represor tetraciclina TTA quimera se utilizaron, por lo que la expresión de los cDNAs de rescate fue reprimida por la presencia de doxiciclina.

Para determinar si la ciclina A endógeno podría ser downregulated de la ciclina A / shRNA construir, las células fueron transfectadas con el control de vectores, bien o la ciclina A / shRNA construir. Figura 3 muestra que una expresión de la ciclina A es efectivamente atenuada por la shRNA ( carriles 1 y 2). Como era de esperar, FLAG-ciclina A (que exhibieron un gel ligeramente más lento que la movilidad endógeno ciclina A) se expresa en la ausencia, pero no la presencia de doxiciclina. La expresión de la recombinante BANDERA-ciclina A fue también confirmada por inmunotransferencia para BANDERA. Figura 3 muestra que B-FLAG ciclina A fue reprimida por la doxiciclina progresivamente durante el tiempo del experimento. Estos resultados indican que mientras que el endógeno ciclina A podría ser silenciada por la shRNA, la co-expresó recombinante ciclina A fue refractaria a la desmontables.

A fin de comprobar la versatilidad del sistema pKAR, hemos realizado el experimento de conversar de inflexión en el cDNA de rescate después de la proteína endógena es desmontable por la shRNA. Las células fueron transfectadas con MAD2/shRNA en pKAR1 en presencia de doxiciclina a reprimir la expresión de la MAD2 recombinante. Figura 3 C muestra que la endógeno MAD2 fue efectivamente desmontables por el procedimiento (carriles 1 y 2). Por otra parte, el shRNA resistentes MAD2 (ligeramente más grande que la proteína endógena, debido a la etiqueta epítopo) fue inducida por enérgicamente después de la eliminación de doxiciclina en el medio. En conjunto, estos datos demuestran que el rescate cDNAs podrían activarse o desactivarse después de las proteínas endógenas fueron silenciadas.

Para generar las líneas celulares que expresan establemente ciclina A shRNA y el correspondiente rescate cDNA, un puromycin-gen resistente fue diseñado en la ciclina A / shRNA construir (Figura 2]. Las células fueron transfectadas y seleccionados en soporte de puromycin y en ausencia de doxiciclina. La base de esto fue que la downregulation de ciclina A sin compensación expresión de la shRNA resistentes ciclina A se citotóxica. Después de la selección, individual colonias fueron aisladas y los desmontables de la ciclina A endógeno y la expresión de la ciclina A recombinante fueron analizados (Figura 4]. Hemos sido capaces de generar líneas de células que expresaron BANDERA-ciclina A, sino que son deficientes en la expresión de ciclina endógeno A. También confirmó que la bandera-ciclina A expresión puede ser apagado con la doxiciclina.

Para determinar si el ajuste fino de ciclina Una expresión que se puede lograr la estabilidad en las líneas celulares, las células fueron tratadas con diferentes concentraciones de doxiciclina antes cosechada. Figura 5 A se muestra que una serie de ciclina A expresión, desde un nivel indetectable a un nivel muy overexpressed , Se obtuvo variando la concentración de doxiciclina. La expresión de ciclina FLAG-A podría ser apagado con relativa rapidez (Figura 5 B). Nuestra conclusión es que, si bien el método es bastante robusto, la dosis exacta y la hora de doxiciclina aprobado para ajuste fino de la proteína de rescate tendrá que ser determinada empíricamente (que depende de la vida media de la proteína y su relación con los niveles endógenos proteína).

Aunque el total de ciclina A se redujo a un nivel muy bajo, tanto cuando la endógena y la ciclina A rescate fueron reprimidos, es concebible que una pequeña porción de células expresado todavía altos niveles de ciclina A. Para examinar esta posibilidad, la abundancia de ciclina A en las células individuales se determinará con la citometría de flujo. Varias líneas de evidencia indican que la ciclina A se activa degradados durante la mitosis y la fase 1 G (24]. De acuerdo con esto, dos poblaciones de células con diferentes niveles de ciclina A se detectaron con citometría de flujo (Figura 6 A). Doxiciclina reducido la expresión de ciclina A en toda la población, lo que sugiere que ciclina A fue eliminado no sólo en determinadas células. Después de la tinción con yoduro de propidio, análisis bivariado indicó además que la ciclina A se redujo en diferentes fases del ciclo celular (Figura 6 B).

Células que expresan ciclina A shRNA y el cDNA de compensación que aparece junto relativamente normal del ciclo celular perfil (Figura 6 C). En marcado contraste, un prominente G 2 / M retraso se presentó después de FLAG-ciclina A fue reprimida. De acuerdo con esto, ciclina B1 (que normalmente se acumula durante la fase G 2 y mitosis) también aumentó después de la eliminación de la ciclina A (Figura 5 B). El análisis detallado de la ciclina A desmontables fenotipos se describen en otros lugares. Este breve análisis sirve para ilustrar que el citostático fenotipos de shRNA puede ser rescatado condicionalmente estable en líneas celulares, lo que subraya la utilidad del sistema pKAR.

A fin de validar la eficacia del sistema para desmontables y rescate, el husillo y el ensamblaje de control fue analizada después de los desmontables de MAD2. Las células fueron transfectadas con MAD2/shRNA en pKAR1 y la expresión de la compensación se MAD2 ya sea inducida o reprimida con doxiciclina. Como era de esperar, las células que expresan co-MAD2 shRNA y el rescate MAD2 fueron bloqueadas con 4N contenido de ADN después del tratamiento con el huso de perturbar las drogas nocodazole (Figura 6 D). En marcado contraste, las células que expresan MAD2 shRNA en ausencia de compensación MAD2 no ser detenido por nocodazole, y seguir para volver a replicar su ADN. Estos datos indican que MAD2 desmontables fenotipos podría ser condicional rescatados con la pKAR sistema.

En resumen, hemos elaborado un vector que puede expresar shRNA y las respectivas juntas de rescate cDNA. El vector pKAR1 proporciona una manera conveniente de subclone shRNA y el cDNA de rescate, así como para la generación de líneas celulares estables. Este sistema es especialmente útil cuando la prolongada expresión de cualquiera de los shRNA o la compensación cDNA es citotóxica. En el primer escenario, el shRNA puede permitirse completamente desmontable endógeno proteínas en presencia del cDNA de rescate; el cDNA de rescate puede ser apagado para alcanzar los fenotipos desmontables. En el segundo escenario, el cDNA de rescate se puede activar sólo después de las proteínas endógenas son completamente eliminados. Aquí hemos utilizado una línea celular expresando el represor tetraciclina TTA quimera, de manera que la expresión del cDNA de rescate fue reprimida por la doxiciclina. Del mismo modo, las líneas celulares que expresan el reverso TTA (25] también puede ser aprobado a su vez en el rescate de cDNA con doxiciclina. Otras aplicaciones del método incluyen la eliminación condicional de la proteína de rescate por un período definido de tiempo antes de que el rescate se restablezca la proteína. Se encontró que la pKAR sistema es especialmente adecuado para la generación de líneas celulares estables. Probablemente debido a la toxicidad de ambos ciclina A / shRNA y cDNA, encontramos que todas las colonias aisladas fueron, inevitablemente, sin endógeno ciclina A y expresar BANDERA-ciclina A. Por otra parte, los clones que crecieron a un ritmo normal tienden a expresar el rescate ciclina A a un nivel similar a la de control de las células (nuestros datos no publicados). Por lo tanto, este método parece tener una ventaja adicional de aislar clones que expresan la proteína de rescate a un nivel comparable a la proteína endógena.

En conclusión, el sistema permite pKAR una sola fase de validación de shRNA y la generación de shRNA estable-expresando células.

Damos las gracias a los miembros de la Poon laboratorio, en particular, Anita Lau y Siu Sandy para la asistencia técnica. Esta obra fue financiada en parte por el Consejo de Investigación de subvención HKUST6123/04M y HKUST Alto Impacto Espacio para RYCP de financiación para pagar la publicación de acceso abierto cargo fue proporcionada por la Universidad de Hong Kong de Ciencia y Tecnología.

Conflicto de Intereses Declaración. Ninguno declarado.