Mediators of Inflammation, 2007; 2007: (más artículos en esta revista)

Asociación de polimorfismos de genes GST con el asma en los niños tunecinos

Hindawi Publishing Corporation
Chelbi Hanene [1], Lachheb Jihene [1], Ammar Jamel [1, 2], Kamel Hamzaoui [1], Hamzaoui Agnès [1, 2]

Este es un artículo de acceso abierto distribuido bajo la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original esté debidamente citados.

Resumen

Fondo. Una asociación positiva entre el polimorfismo genético y el asma no puede ser extrapolado de un grupo étnico a otro basado en intra e interétnicos alélica genotipo y frecuencias diferencias. Objetivo. Se evaluó si los polimorfismos de genes GST (GSTM1, GSTT1 y GSTP1) se asocian con atopia y asma entre los niños tunecinos. Métodos. 112 individuos sanos no relacionados y 105 asmáticos (73 atópica y 32 nonatopic) los niños fueron estudiados. La genotipificación, los polimorfismos en el GSTT1 y GSTM1 genes se realizó mediante la PCR múltiple. El GSTP1 ILe105Val polimorfismo se determinó usando PCR-RFLP. Resultados. GSTM1 null genotipo se asoció significativamente con el aumento del riesgo de asma (P = .002). Niños asmáticos tuvieron una mayor prevalencia del alelo GSTP1Ile105 que el grupo control (43,8% y 33,5%, respectivamente, P = .002). Además, la presencia de la GSTP1 homocigoto Val / Val fue menos frecuente en los sujetos con asma que en el grupo control. Nos hemos dado cuenta de que el genotipo GSTT1 nulo (GSTT1 * 0 / * 0) se asoció significativamente con atopia (P = .008). Conclusión. Polimorfismos en genes de la superfamilia GST se asociaron con riesgo de asma y atopia en Túnez.

1. INTRODUCCIÓN

El asma es una enfermedad crónica caracterizada por la obstrucción reversible al flujo aéreo y la inflamación de las vías respiratorias que afectan a muchas personas. Hay pruebas de que una predisposición genética también puede alterar la capacidad de las vías respiratorias para protegerse contra la inhalación de sustancias tóxicas al medio ambiente [1, 2].

Varios genes candidatos estaban implicados en el desarrollo de atopia y asma. Se ha informado de que la prevalencia de estos genes candidatos pueden variar considerablemente de la etnicidad [3, 4]. Por otra parte, habida cuenta de los datos de estudios que sugieren una asociación positiva entre el polimorfismo genético y el asma o atopia no puede ser extrapolado de un grupo étnico a otro basado en intra e interétnicos alélica genotipo y frecuencias diferencia.

En el norte de África, y especialmente en Túnez, los datos de la investigación sobre este tema está ausente. Es por ello que hemos seleccionado entre los asmáticos tres genes candidatos genes que se han conocido a través del notable entre las diferencias y intraethnic [5]. Estos genes son GSTT1, GSTM1 y GSTP1, que son los nombres en clave para las enzimas pertenecientes a la glutation S-transferasa (GST) super familia. En los seres humanos, GSTs representan un amplio y diverso super familia de enzimas, con al menos 13 GST enzimas pertenecientes a cinco familias diferentes: mu, theta, alfa, pi, y gamma. El GSTM1, GSTT1, GSTP1 y pertenecen, respectivamente, a la GSTmu, GSTtheta, y GSTpi categorías de enzimas. GSTs se sabe que juegan un papel importante en el funcionamiento de las defensas antioxidantes a través de especies reactivas del oxígeno (ROS) el metabolismo, en la reparación de ROS dañados y en la desintoxicación de varios xenobióticos como agentes carcinógenos se encuentran en tabaco [6, 7]. El papel desempeñado por GSTs puede ser especialmente importante en respuesta a estrés oxidativo [6, 8]. Común homocigoto supresión de los polimorfismos GSTM1 y GSTT1 genes, así como el polimorfismo GSTP1Ile105, han sido conocidos por la abolición de las enzimas de actividad y aumentar la susceptibilidad al estrés oxidativo [6, 8]. Los estudios han informado hasta el momento resultados contradictorios con respecto a cualquier asociación entre los polimorfismos de genes GST y el asma y / o atopia. De hecho, algunos han informado de la presencia de una asociación entre polimorfismos GSTP1VAL105Ile hiperreactividad bronquial y la respuesta (PER), el asma y atopia [9 - 16]. Sin embargo, otros estudios no han encontrado esas pruebas de cualquier asociación entre el polimorfismo y el asma o atopia [17]. En varios estudios, null alelos en el GSTT1 y GSTM1 genes (GSTT1 * 0 y GSTM1 * 0) se asociaron con el asma infantil [10, 11, 18, 19] pero este hallazgo fue contradicha por otros estudios [17].

Aunque hay una alta incidencia de enfermedades asmáticas en Túnez, los datos no ha sido reportado en este país. En este estudio se evaluará si los polimorfismos de genes GST encontrados previamente a ser asociados con el asma y atopia en caucásicos y asiáticos también están sujetos a ser asociados con el asma y atopia en los niños tunecinos.

2. Sujetos y métodos
2,1. A los sujetos de estudio

Niños asmáticos de la historia se registraron mediante cuestionario estándar categorías: edad, sexo, la exposición al humo de tabaco, y la historia familiar de asma y alergia.

Un total de 105 niños asmáticos de edades que van de 5 a 16 años (media 11,5) se inscribieron en este estudio junto con el control de 112 personas (con edades comprendidas entre 5 y 16 años, con una media de 9,5). Ninguno tenía enfermedades recientes que requieren tratamiento y sin antecedentes de enfermedades crónicas. Todos vivían en el campo, cerca de Túnez, en una ciudad llamada Ariana. Esta región se considera generalmente que es representante de la población tunecina. Nuestro comité de ética nacional aprobó el estudio.

2,2. Total IgE Prick test y ensayos

Atopia fue definida por la sensibilidad cutánea a alergenos específicos (reacción cutánea con una media bien diámetro ≥ 3 mm mayor que el producido con uno o más de antígenos en presencia de histamina control positivo y negativo sin control) y de medición de la IgE total nivel. Los valores positivos se han adoptado para ser ≥ 200 UI / ml.

Entre los 105 niños asmáticos hay 73 atópica y 32 nonatopic los niños que habían negativos prueba cutánea de las respuestas a alergenos comunes. En nuestro estudio, el asma es con frecuencia relacionada con un grupo heterogéneo de trastornos clínicos incluyendo rinitis, sinusitis y dermatitis. Los perfiles clínicos se muestran en la Tabla 1.

2,3. De aislamiento del ADN

El ADN genómico genotipo se aisló de 10 ml de linfocitos de sangre periférica que han sido recogidos, utilizando el método de salting-out procedimiento de extracción de ADN [19], en un EDTA que contiene un vacutainer.

2,4. GSTM1 y GSTT1 genotipos

El GSTM1 y GSTT1 nulo genotipos se detectaron mediante un método de PCR múltiple [20]. En pocas palabras, 100 ng de DNA fueron amplificados en un ul-50 múltiplex mezcla de reacción que contiene 0,90 pmol de cada una de las siguientes primers GSTM1 (GSTM1-F: TTCCTCACTGGTCCTCACATCTC y GSTM1-R: TCACCGGATCATGGCCAGCA) y los primers GSTT1 (GSTT1-F: GAACTCCCTGAAAAGCTAAAGC y GSTT1 - R: GTTGGGCTCAAATATACGGTGG). Como control interno, la albúmina gen también se amplifica con 0,2 pmol de cada primer (AlbF: GCCCTCTGCTAACAAGTCCTAC y AlbR: GCCCTAAAAAGAAAATCGCCAATC) en un medio que consta de 3,5 mm MgCl 2 , 200 uM dNTPs, 5 ul 10X PCR buffer, y 2U TaqDNA polimerasa. El protocolo de PCR inicial incluía una temperatura de fusión de 94 ° C (5 minutos), seguido por 35 ciclos de amplificación (20 segundos a 94 ° C, 20 segundos a 64 ° C, y 30 segundos a 72 ° C). A final de 7 minutos de extensión paso (72 ° C) por concluido el proceso.

Los productos de PCR fueron analizados en geles de agarosa. Un fragmento de 215 pb indica la presencia del GSTM1, un fragmento de 480 pb indica la presencia de GSTT1, y un fragmento de 380 pb indica el positivo de control interno de albúmina. Los sujetos fueron clasificados ya sea como (+), cuando al menos un ejemplar del gen se detectó, o (-) cuando mostró un genotipo nulo. Individuos heterocigotos con GSTM1 (GSTM1 + / - y GSTM1 + / +) o GSTT1 (GSTT1 + / - y GSTT1 + / +) se comunicaron a las enzimas presentes similar actividad [21] y los niveles de expresión [22] y se agruparon para el análisis estadístico.

3. ANALISIS ESTADISTICO

Asociación análisis en nuestro estudio de casos y controles se realizó mediante norma Chi-cuadrado (paquete estadístico Epistat, Epi Info versión 6) para detectar diferencias en los genotipos y alelos distribución entre nuestros grupos.

Corrección para comparaciones múltiples se llevó a cabo, y sólo el valor de corregir P <.05 fue considerado como significativo.

4. RESULTADOS
4,1. Los estudios de casos y análisis de control

La asociación entre el genotipo GST y la susceptibilidad se estudió a 105 niños asmáticos no relacionados que residen en la parte norte de Túnez, con un grupo control de 112 niños sanos.

Tabla 1 se resumen las características clínicas de los sujetos llevó a cabo en este estudio. En total, el 35% de niños asmáticos y el 22% de los niños nonasthmatic fueron fumadores pasivos. Con una edad media de 11,5 (rango entre 5 y 16 años), 70,32% de los niños asmáticos fueron diagnosticados como atópica.

El cuadro 2 se resumen los datos encontrados en relación con el genotipo frecuencias para el RFLP en el gen GSTP1, así como las deleciones homocigóticas de la GSTM1 y GSTT1 genes. Genotipo frecuencias (GSTP1, GSTM1 y GSTT1) fueron dentro del equilibrio de Hardy-Weinberg para el control de la población.

Se encontró que el genotipo GSTM1 null se asoció significativamente con un mayor riesgo de asma (P = .002). De hecho, el genotipo GSTM1 null estuvo presente entre el 70,7% de los niños asmáticos y entre el 50,2% del grupo control.

En cuanto a la GSTP1, los homocigotos GSTP1 Val / Val genotipo fue menos frecuente entre los pacientes asmáticos que en el grupo control (10,7% versus 18,6%, P = .04). Los sujetos con el genotipo GSTP1Val/GSTP1Val registró un-2,33 veces menor riesgo de asma que aquellos con el genotipo GSTP1Ile/Ile (OR = 2,33, 95% CL 0.94-5.87). Entre tanto estudio de muestras, hubo una diferencia significativa en la frecuencia de los alelos GSTP1 (P = .02): niños asmáticos tuvieron una mayor prevalencia del alelo GSTP1Ile que los del grupo control (43,8% y 33,5%, resp.) .

La presencia del polimorfismo GSTT1 nulo se comparó en ambos grupos de muestra. La diferencia se mostró a nonsignificant (P> .05) entre los controles y los asmáticos, 29,5% y 37,5%, respectivamente, véase (Cuadro 2].

4,2. GST genes y atopia

Cuadro 3 se resume la asociación entre genes y GST atopia.

El genotipo GSTT1 nulo (GSTT1 * 0 / * 0) fue significativamente mayor en los casos de asma atópica que en nonatopic asmáticas (P = .008). En cuanto a la GSTM1, hubo un-1,5 veces mayor riesgo de asma atópica en los individuos con el genotipo GSTM1 nulo (OR = 1,5, IC 95%, 0,6-3,83), pero este aumento no fue significativo. No hay asociaciones significativas se han encontrado entre atopia y GSTP1 polimorfismo en presente estudio.

4,3. Polimorfismos de glutation S-transferasa M1, T1, y P1 en un control de la población de Túnez

GSTs citosólicas Humanos han sido bien documentados, sino que son polimórficos y étnicos han polimorfismo que dependen de las frecuencias. En comparación con la investigación llevada a cabo en otros países, la distribución de la GSTM1 nulo y el genotipo GSTT1 nulo entre nuestro grupo de control resultó ser, respectivamente, 50,2% y 29,5% (Cuadro 4]. Su polimorfismo GSTP1 frecuencias para la Ile / Ile genotipo registrado en 34,4%, a 47,1% para la Ile / Val genotipo, y en el 18,6% de los Val / Val genotipo (Tabla 2]. El alelo Ile frecuencia para este grupo particular se fijó en 0,562.

5. DISCUSIÓN

La glutatión S-transferasa (GST) super familia de enzimas tienen un papel vital en la fase II de biotransformación de xenobióticos y en la protección de las células de especies reactivas del oxígeno (ROS) de su capacidad para utilizar sustratos de una amplia gama de productos de estrés oxidativo [6]. El estrés oxidativo se informó de que el componente clave de la inflamación. La inflamación se consideró una característica de la enfermedad del asma cuando se atacaron las vías respiratorias. Por lo tanto, en defecto desintoxicante ROS pueden influir en el desarrollo y la gravedad del asma.

Los resultados de nuestros trabajos sugieren la presencia de las asociaciones de GSTM1, T1 y P1 con el asma infantil y la atopia. Al comparar niños asmáticos a controles sanos hemos demostrado una asociación significativa entre los sujetos que carecen de actividad GSTM1 y el asma (P = .002). Numerosos estudios han demostrado una asociación significativa entre los sujetos que carecen de GSTM1 actividad y el riesgo de desarrollar una forma de enfermedad pulmonar [30 - 32]. Para los asmáticos, la asociación con el genotipo GSTM1 nulo ha sido reportado en población caucásica [11, 18, 33, 34], pero no en grupos asiáticos [35].

En cuanto a la GSTP1, también hemos encontrado diferencias significativas entre nuestros dos muestras de estudio en relación con el genotipo frecuencias de los polimorfismos GSTP1Ile105Val. De hecho, los niños asmáticos tienen una baja frecuencia de GSTP1Val alelo en comparación con niños sanos (P = .002). El papel defensivo de la GSTP1 en los casos de asma se informó en varios estudios [9, 12 - 15]. Se informó de que la presencia de GSTP1Val/Val confirió un genotipo seis veces menor riesgo de asma que hizo GSTP1Ile/Ile y que la frecuencia del genotipo GSTP1Val/Val negativamente correlacionado con la severidad de la disfunción de las vías respiratorias [9]. Aynacioglu et al. [12] también han informado de que la frecuencia de GSTP1 Val homocigotos fue significativamente menor en el grupo de pacientes con asma que en el control de personas (3,8% frente al 12,1%, P = .01). Por otra parte, un estudio reciente [11] ha encontrado que el GSTP1 Val / Val fue más frecuente entre las asmáticas que el grupo control (22,8% y 7,8%, respectivamente) y que los sujetos con el GSTP1 homocigotos Val / Val ha genotipo un 3,55 veces mayor riesgo de tener asma atópica en comparación con nonatopic asma (OR = 3,55, IC del 95%, 1,10-12,56), ver [11]. Aunque, el GSTP1 derivados de la enzima contribuye más del 90% de la actividad GST [36], se ha constatado por numerosos estudios [9, 12 - 15] y confirmada por nuestra conclusión de que se protege a los niños contra la enfermedad del asma en desarrollo. Sin embargo, se ha informado de que la Val105 variante tiene un mayor catalizador para la eficiencia de hidrocarburos aromáticos policíclicos diol epóxidos, pero su eficacia para el 1-cloro-2, 4-dinitrobenzene es menor en comparación con la variante Ile105 [37]. Por lo tanto, parece ser posible que GSTP1 desempeña un papel en el asma enfermedad por la modulación de la producción de ROS.

En este estudio, para el genotipo GSTT1 nulo, asociación significativa entre los niños atópicos y asmáticos nonatopic niños asmáticos (P = .008), ver (Tabla 2]. Aunque nuestras conclusiones son corroboradas por varios estudios sobre las poblaciones de los caucásicos [11, 33], otros estudios no han podido establecer esta asociación [17, 18, 34, 38]. Varios estudios han sugerido que los individuos con el GSTT1 * 0 / * 0 (GSTT1 null) genotipo pueden ser más susceptibles a daños genotóxicos y enfermedades pulmonares que los individuos con el gen GSTT1 [30, 39].

Resultados contradictorios se encontraron en lo que respecta a GSTT1, GSTP1, GSTM1 y [11, 17, 34, 35, 39]; etnia es la razón más importante para estas diferencias. Es por ello que hemos tomado en consideración la interdisciplinariedad y la intraethnic características en el análisis de nuestros resultados.

En poblaciones con control intra e interétnicos diferencias, frecuentes los polimorfismos genéticos supresión de GSTM1 (GSTM1 * 0 / * 0) y GSTT1 (GSTT1 * 0 / * 0) se han notificado [5]. La distribución del genotipo GSTM1 nulo y GSTT1 nulo de nuestra saludable muestra de control se encontró 50,2% y 29,5%, respectivamente, véase (Cuadro 2].

La frecuencia del genotipo GSTM1 nulo en nuestra controles sanos (50,2%) parece estar dentro de la gama de frecuencias, para las poblaciones caucásicas (Cuadro 4]. De hecho, el GSTM1 supresión gama de frecuencias, respectivamente, de 50,4% a 58,00%, 49% a 63% y 20% a 33% en caucásicos, asiáticos, africanos y los grupos de control [5].

En cuanto a GSTT1 nulo tipo, la frecuencia del genotipo supresión de Túnez en nuestro grupo control se fija en 29,5%. Al igual que la población de Egipto, Túnez tiene una frecuencia ligeramente mayor que la registrada por los europeos de raza caucásica (entre 13% y 22,3%) y africanos (entre 19% y 26%). La frecuencia de la supresión genotipo en la población de Túnez se acerca más a la de los americanos caucásicos (10% -36%) y es considerablemente inferior a los reportados para la población asiática (45% a 53%).

En conclusión, hemos demostrado que los polimorfismos de genes GST encontrados previamente a ser asociados con el asma y atopia en caucásicos y asiáticos también están los temas relacionados con el asma y atopia en los niños tunecinos. Por lo tanto, los genotipos GST pueden ser útiles con el fin de optimizar el futuro tratamiento del asma en los casos de pacientes con un perfil de riesgo.

Estamos especialmente agradecidos a todos los niños que participaron en este estudio y queremos dar las gracias a ellos. Esta labor fue apoyada por una beca del Ministère de l'Enseñanza et de la Recherche Scientifique: DGRST.