BMC Genomics, 2007; 8: 111-111 (más artículos en esta revista)

Gene-resolución análisis de ADN copia número variación utilizando microarrays de expresión oligonucleótido

BioMed Central
Herbert Auer (hauer@pcb.ub.es) [1], David Newsom L (newsomd@ccri.net) [1], Norma J Nowak (Norma.Nowak @ RoswellPark.org) [2], Kirk M McHugh (McHughK @ ccri.net) [3], Sunita Singh (singhs@ccri.net) [3], Chack Yung-Yu (YuC@ccri.net) [4], Yan Yang (yangy@ccri.net) [4], Gail D Wenger (WengerG@chi.osu.edu) [1], Julie M-Gastier Foster (gastierj@chi.osu.edu) [1], Karl Kornacker (kornacker@midohio.twcbc.com) [1]
[1] Centro para el cáncer infantil, Columbus Children's Research Institute y The Ohio State University, Columbus, Ohio, EE.UU.
[2] Roswell Park Cancer Institute y la Universidad en Buffalo, Nueva York, EE.UU.
[3] Centro de Biología Celular y del Desarrollo, Columbus Children's Research Institute y The Ohio State University, Columbus, Ohio, EE.UU.
[4] Center for Molecular y Genética Humana, Columbus Children's Research Institute y The Ohio State University, Columbus, Ohio, EE.UU.

Este es un artículo de acceso abierto distribuido bajo los términos de la licencia Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0], que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original es debidamente citados.

Resumen
Fondo

Array basado en la hibridación genómica comparada (aCGH) es un alto rendimiento método para medir la escala del genoma de ADN el número de copias cambios. ACGH métodos actuales han limitado la resolución, la sensibilidad y la reproducibilidad. Microarrays para aCGH están disponibles sólo para unos organismos y aCGH combinación de datos con datos de expresión, resulta engorroso.

Resultados

Se presenta un método novedoso de la utilización comercial de oligonucleótidos microarrays de expresión para aCGH, permitiendo número de copias de ADN y mediciones de los perfiles de expresión para ser combinados usando la misma plataforma. Este método produce aCGH datos de ADN genómico sin reducción de complejidad con un tiempo medio de resolución de aproximadamente 17500 pares de bases. Debido a la bien definida la naturaleza de las sondas de oligonucleótidos, la amplificación de ADN y supresión puede definirse a nivel de genes individuales y puede ser fácilmente combinada con los datos de expresión génica.

Conclusión

Un nuevo método de análisis de genes de resolución del ejemplar número variación (graCNV) los rendimientos de alta resolución, mapas de número de copias de ADN y los cambios es aplicable a una amplia gama de organismos comerciales para que oligonucleótido microarrays de expresión están disponibles. Debido a la normalización de los microarrays de ADN, graCNV resultados pueden ser fiable en comparación entre los laboratorios y puede ser fácilmente combinada con los datos de expresión génica utilizando la misma plataforma.

Fondo

Array basado en la hibridación genómica comparada (aCGH) permite la identificación del genoma de ADN a escala ganancias y pérdidas en los cánceres y las enfermedades genéticas [1 - 3]. Una plataforma ideal aCGH debe poseer las siguientes características: 1) debe estar disponible para estudiar una amplia gama de organismos. Por desgracia, aCGH microarrays están comercialmente disponibles a la alimentación humana y sólo los estudios del ratón, dejando de lado otros organismos modelo para el número de copias de ADN estudios. 2) La plataforma aCGH debe ser comercialmente disponibles en todo el mundo para que los resultados de diferentes laboratorios fácilmente comparables. En casa de microarrays con frecuencia muestran menos reproducibilidad de los productos comerciales [4, 5]. El Microarray Consorcio de Control de Calidad (MAQC) estudio puso de relieve una vez más que en casa de microarrays de generar un mucho mayor coeficiente de variación de las señales de expresión en comparación con los productos comerciales [6]. Comparación de los resultados obtenidos en laboratorios independientes con frecuencia es problemático cuando diferentes sondas se utilizan en distintos laboratorios. 3) Las sondas deberán span corto regiones que proporcione información detallada sobre las regiones de número de copias variación (CNV); clones BAC, utilizados como sondas aCGH [7], debido a su longitud media de la sonda está decenas de miles de nucleótidos, inherentemente no puede medir pequeñas amplificado suprimido o regiones. 4) La plataforma debe proporcionar pequeño espacio entre las sondas para generar mapas de alta densidad de CNVs; La única comercialmente disponible BAC aCGH gama de medidas disponibles con un tiempo medio de resolución de una megabase [8]. 5) las mediciones individuales deben proporcionar datos fiables para evitar la necesidad de un promedio de múltiples mediciones, resultando en una disminución de resolución. Long oligonucleótido arrays [8, 9] y SNP microarrays [10, 11] dependen de un promedio de múltiples señales de sondas [9, 10] para eliminar falsos positivos mediciones, resultando en una disminución de resolución. 6) CNV mediciones deben ser de fácil correlación con los datos de expresión cuando las mismas muestras se estudian en la genómica y transcriptomic nivel. Clones BAC y diseñado para sondas de medición SNP no son inherentemente diseñada específicamente para interrogar a los genes transcritos. Por lo tanto, la combinación de número de copias de ADN y la expresión de datos de bioinformática necesita un fuerte apoyo [11]. 7) El procedimiento analítico debe interrogar a todo el genoma, el ADN de etiquetado protocolo para SNP microarrays depende de la reducción de complejidad, dejando de lado una gran parte del genoma de análisis [12, 13].

Aquí presentamos el análisis de genes de resolución del ejemplar número variación (graCNV), utilizando un método más frecuentemente utilizado la plataforma de microarrays de expresión para aCGH. Para los humanos y los estudios del ratón, esta plataforma ofrece más de 50000 mediciones en todo el genoma (U133 Plus 2,0 y 430 2,0 GeneChips, respectivamente, ambos Affymetrix). Por otra parte, la misma tecnología está disponible para más de una docena de otros organismos comparables con la cobertura del genoma. Las sondas de oligonucleótidos son breves y abarcan sonda fija en promedio a corto regiones cromosómicas. Sin reducción de complejidad, el ADN genómico se encuentra fragmentado, etiquetados y hibridizada a estos microarrays. Después de volver a la anotación de sonda fija para el interrogatorio de ADN genómico, WPP, un análisis de los datos algoritmo desarrollado originalmente para el análisis de expresión, se utiliza para el cálculo del número de copias de ADN variación. Dado que la gran mayoría de aCGH datos disponibles en la actualidad se ha generado utilizando microarrays de BAC [14], graCNV resultados han sido comparados con los resultados de BAC microarrays con alta cobertura del genoma [15].

Resultados
Propiedades de la U133 Plus 2,0 Expresión Array como una herramienta aCGH

El U133 Plus 2,0 gama ofrece más de 54000 sonda fija el interrogatorio el genoma humano y más de 39000 de la sonda fija CNVs medida directamente dentro de los genes transcritos (Tabla 1]. Con más de 19000 genes medidos en el 2,0 Plus U133 serie, la mayoría de las previsiones 20000 a 25000 genes humanos [16] está cubierta. Probe establece interrogar a corto regiones y la densidad de conjuntos de sonda es elevada. El 19K BAC microarrays utilizado para la comparación tiene aún mayor cobertura del genoma, pero sondas son mucho más tiempo (Tabla 1].

Beneficios de la WPP algoritmo

RMA, un estándar de análisis de datos algoritmo para el cálculo de estimaciones de expresión GeneChips de Affymetrix [17] se utilizó inicialmente para el cálculo del número de copias de ADN diferencias. Análisis de componentes principales (PCA) de RMA datos se agrupan de la normal de control AND juntos pero separados SK-N-SH / G y SK-N-SH / L (Fig. 1B]. Estas dos líneas celulares se obtuvieron a partir de la misma línea celular (SK-N-SH) y sólo se han propagado por dos laboratorios diferentes para unos diez pasajes independiente. Por lo tanto, SK-N-SH / G y SK-N-SH / L deben ser similares entre sí y deben grupo juntos. PCA de WPP agrupan las estimaciones normales de control AND juntos, claramente diferenciada de las líneas celulares y dentro de las líneas celulares, SK-N-SH / G y SK-N-SH / L mostró más estrechamente relacionados con los resultados (Fig. 1A]. La agrupación jerárquica de WPP estimaciones del mismo modo los grupos relacionados con las muestras de (Fig. 1c), mientras que las estimaciones de RMA de nuevo separados los dos estrechamente relacionados con las líneas celulares SK-N-SH / G y SK-N-SH / L (Fig. 1D]. Por lo tanto, un nuevo análisis se realizó a través WPP estimaciones de número de copias del ADN.

Detección de número de copias grandes variaciones en las regiones cromosómicas

Para las grandes regiones cromosómicas, Circular binario Segmentación (CBS) rendimientos similares de amplificación de imágenes y supresión de la tasa de mortalidad infantil-32 células de neuroblastoma (Fig. 2] la tasa de alcoholemia de arrays y arrays de expresión. Dos regiones altamente amplificado en el cromosoma 2 (uno en torno a la posición física 15 megabases (Mb) y una en torno a 68 Mb) son bien conocidas en neuroblastoma [18]. El amplicón a 15 Mb contiene el oncogén MYCN y su estado de amplificación se utiliza para la clínica sub-clasificación de neuroblastoma [19, 20]. Las supresiones de 1p y 11Q, así como las ganancias de 17q son también características de neuroblastoma [19, 20] y todos esos número de copias se observaron variaciones en la tasa de mortalidad infantil-32 células de ambas plataformas. Las principales diferencias observadas entre el número de copias mediciones de la tasa de alcoholemia arrays y arrays de expresión afectan a las regiones centroméricas (cromosomas 9, 10, 14, 15 y 21). Estas regiones son altamente polimórficas en el ADN genómico normal [21, 22], por lo que especulan que estas diferencias son causadas por las diferentes normales de control AND utilizados para ambas plataformas. Para el resto de líneas de células SK-N-AS, SK-N-SH / G y SK-N-SH / L, BAC aCGH y graCNV también proporcionó imágenes de similar número de copias para las grandes variaciones regiones cromosómicas (Fig. 3 y datos no se muestra). Por SK-N-SH / G y SK-N-SH / L, dos sub-culturas de SK-N-SH, observó el panorama general de número de copias en comparación con la variación normal del ADN es muy similar, excepto por un período adicional de amplificación en 1q presentes en SK-N-SH / L (Fig. 3]. Esta amplificación se observó por ambas plataformas CGH.

Alta resolución análisis de las variaciones de número de copias

En la resolución más alta, la tasa de alcoholemia aCGH y graCNV de nuevo facilitar este tipo de imágenes de las supresiones y amplificaciones en las líneas celulares de cáncer. En la tasa de mortalidad infantil-32 celdas, dos recientemente descubiertos sub-amplicones a 67 y 69 Mb del cromosoma dos [23] han sido identificados por la CBS en graCNV datos, mientras que sólo el sub-amplicón a 67 Mb se identificó en la tasa de alcoholemia aCGH datos (Fig. 4A y 4C]. En SK-N-SH / G células, identificó la segmentación de datos graCNV una deleción de menos de un Mb a 39,5 Mb del cromosoma ocho (Fig. 4B], que no se detectan automáticamente en la tasa de alcoholemia aCGH datos (Fig. 4D]. graCNV proporciona información independiente de cuatro conjuntos de sonda a esta supresión. BAC aCGH, tal como se utiliza en este documento, con más del 50 por ciento del genoma cobertura de información de un sólo clon BAC. BAC aCGH proporcionó información sobre otras dos amplicones en 2p (uno de 29,6 Mb y uno en 53,5 Mb) en la tasa de mortalidad infantil-32 células. Estas regiones no están cubiertos por el U133 Plus 2,0 array (datos no presentados).

Detección de número de copias variaciones normales entre las AND genómico a un solo gen locus

ADN genómico de las personas normales y sanos se ha descubierto en los últimos años para albergar un número elevado número de copias de la variante regiones (para revisión ver [24]]. Como ejemplo, mostramos una región en el cromosoma 6, a saber el puerto bien caracterizado de la CNV C4/CYP21A2 locus [25]. Normal, individuos sanos de 2, 4, 5 y 6 copias del locus C4/CYP21A2 han sido identificados por pulsos electroforesis en gel de campo (Fig. 5B]. Este gen a nivel de la CNV está representado en la graCNV datos (Fig. 5C].

Conexión de la CNV y de expresión de datos

graCNV utiliza arrays de expresión CNV mediciones y, por tanto, el mismo microarray puede ser utilizado para el análisis de la expresión génica. Genómica y transcriptomic datos se pueden combinar fácilmente. Como ejemplo, mostramos combinado número de copias de ADN y la expresión de los datos megabladder modelo murino. Aproximadamente un 1 Mb región del cromosoma 16 se duplicaron en este ratón mutante (Fig. 6E], identificados por el análisis FISH. graCNV mostró Il1rap, un gen dentro del amplicón a ser excluidos de mayor número de copias (Fig. 6A], un hallazgo confirmado por PCR cuantitativa (Fig. 6B]. Expresión análisis mostró cuatro de los cinco genes amplificados a ser overexpressed en su conjunto embriones mutantes (Fig. 6C], mientras que la vejiga (el órgano de choque) mostró un exceso de expresión de tres genes sólo (Fig. 6D].

Discusión

Nuestro estudio muestra que la utilizan con más frecuencia comercial oligonucleótido plataforma de microarrays de expresión (Affymetrix) puede ser utilizado para la medición del número de copias variación. Después de volver a la anotación de sonda fija, estos arrays de expresión ofrecer una alta resolución de plataforma para el análisis de la CNV.

Muchos aCGH plataformas dependen de un promedio de las mediciones de loci adyacentes (media móvil) para eliminar el ruido y evitar falsos positivos informes de variación de número de copias [2, 9, 12, 26]. graCNV por otra parte, los informes de corregir el sesgo medio de las mediciones de sondas once adyacentes dentro de un conjunto de sonda. Por lo tanto, graCNV muestra bajo falsas las tasas de descubrimiento (véase la disposición 1] y un promedio de más no es vital. Affymetrix arrays de expresión para muchos genes más de una sonda de medición establecidos. Para permitir la fácil interpretación de los resultados, un promedio de resultados de múltiples sonda de medición establecido el mismo gen. Una mayor resolución de la CNV análisis podría realizarse cuando el recién liberado arrays de expresión para la medición de cada uno de los exones (GeneChip Human exón 1,0 ST arrays, Affymetrix) se utilizarían.

Para muestra de etiquetado, hemos utilizado la química estándar para el análisis de SNP el mismo proveedor, la hibridación y el lavado de protocolos también están bien establecidos por muchos laboratorios para el análisis de SNP. Por lo tanto, debe ser fácil de adaptar graCNV de otros laboratorios. Affymetrix ofrece actualmente microarrays de expresión de más de 20 organismos y graCNV se puede aplicar a todos los de estos organismos. Además, proporciona graCNV número de copias de información comparable a los datos generados usando uno de los más altos de densidad BAC aCGH arrays disponibles.

Hibridación de ADN genómico a arrays de expresión produce mayores antecedentes cruz-la hibridación (indicado por las señales relativamente alto para desajuste sondas, los datos no presentados) que la hibridación de la etiqueta mRNA transcripciones. Estamos especular que la razón por la cual el algoritmo no RMA para identificar la estrecha similitud de dos líneas celulares derivadas de la misma donante fue RMA porque no la secuencia correcta de las diferencias en un segundo plano. WPP, el algoritmo introducido aquí por la CNV mediciones, utiliza las señales sonda desajuste de la secuencia específica de corrección de fondo y se ha utilizado con éxito para el análisis de expresión de uno de nuestros laboratorios desde hace varios años.

Debido al hecho de que graCNV utiliza un chip de muestra por principio, la gama de CNVs normal dentro de genómica AND pueden tomarse en consideración para la medición de las enfermedades relacionadas con CNVs y un software libre para este cálculo se presenta en nuestra página web [27].

Conclusión

En el presente trabajo se describe un novedoso método de análisis de genes de resolución del ejemplar número variación (graCNV) dando de alta resolución de los mapas de ADN el número de copias y modificaciones aplicables a una amplia gama de organismos comerciales para que oligonucleótido microarrays de expresión están disponibles. Los resultados son comparables a la tasa de alcoholemia aCGH genoma con una alta cobertura. Debido a la normalización de microarrays de ADN, graCNV resultados puedan compararse entre los laboratorios y puede ser fácilmente combinada con los datos de expresión génica utilizando la misma plataforma.

Métodos
Fuentes de ADN

Para el análisis de cáncer relacionados con alteraciones genómicas, el ADN genómico de líneas celulares de neuroblastoma IMR-32, SK-N-AS y SK-N-SH (todos proporcionada por ATCC), se analizó. SK-N-SH células se propagan en dos laboratorios diferentes para al menos diez pasajes. Las líneas de células resultantes fueron analizados como SK-N-SH / G y SK-N-SH / L. Como línea de base normal de los individuos humanos, el ADN genómico de las muestras de sangre periférica de cuatro mujeres (C2, C4, C5 y C6) fue colectado después de consentimiento informado. ADN genómico se aisló de animales de una cepa del ratón (mouse megabladder), que fue el resultado de mutagénesis durante la generación de ratones transgénicos. La caracterización genética de la megabladder ratón utilizando clones BAC que contiene el transgén reveló el cromosoma 16 en aproximadamente 26,4 Mb a ser el sitio de inserción mutación. Análisis FISH de metafase los cromosomas más de manifiesto esta región del cromosoma 16 al ser trasladadas en el cromosoma 11. Por lo tanto, los ratones de tipo salvaje contienen dos copias de la región genómica en torno a 26,4 Mb en el cromosoma 16, mutantes heterocigotos contenía tres copias y homocigotos mutantes que figuran cuatro ejemplares. El megabladder ratón se describen en detalle en otros lugares.

Re-anotación de expresión array

Probe conjuntos fueron alineados para la creación de 35 versión del genoma humano mediante la aplicación de montaje independiente Blat [28] a "concatemers" formado por concatenar la no superposición de porciones individuales de 25-mer sonda secuencias de una sonda conjunto. Si Blat no informar de cualquier partido para un concatemer de un determinado conjunto sonda, la sonda fija se eliminó más de anotación. Homología de cada alineación se calcula como el porcentaje de concatemer bases combinado y la genómica con la ubicación más alta homología se utiliza para la anotación más. El refFlat.txt.gz archivo [29] contiene las posiciones físicas de los lugares de genes de acuerdo con el genoma humano asamblea versión Build 35 y se ha utilizado para la identificación de conjuntos de sonda interrogar a los genes. Cuando la genómica con la ubicación más alta homología con una sonda conjunto se superponen con un gen de esta base de datos, la sonda fue anotado establecidos para medir este gen particular. Por múltiples conjuntos de sonda de medición el mismo gen, log2 número de copias medida por las diferencias individuales sonda se establece en promedio.

Procesamiento de ADN genómico para graCNV usando arrays de expresión

20 μ g de ADN genómico fue digerido usando EcoRI (New England Biolabs). La fragmentación y la utilización de biotina etiquetado transferasa terminal se realizaron con GeneChip Mapping 10K Xba Kit de ensayo (Affymetrix). Humanos muestras se hibridó a U133plus2.0 GeneChips (Affymetrix) y el ratón muestras se hibridó a GeneChips personalizado que contiene 4400 conjuntos de sonda de medición de preferencia genes ubicados en los cromosomas 11 y 16 (Affymetrix). Hibridación y otras condiciones fueron ligeramente modificados de los que parecen indicar Mapping de 10K para Arrays (Affymetrix) y el lavado de condiciones se llevaron a cabo como se sugiere para 100K Cartografía Arrays. Una descripción detallada de preparación de muestras está disponible en archivo adicional 1.

El análisis de los datos de arrays de expresión

CEL archivos fueron generados a partir de imágenes escaneadas (archivos DAT), utilizando 1,4 SMOC software (Affymetrix). Probe conjunto de señales o bien fueron generados utilizando el algoritmo de RMA en ArrayAssist 3.4 (Stratagene) o utilizando la in-house WPP algoritmo desarrollado. WPP (comportado bien las estimaciones de la expresión génica diferencial Plus sonda a nivel de p-valores Plus extensible cuantil escala) el software es una versión mejorada de RMA [17]. WPP ofrece los siguientes procedimientos de análisis avanzadas que aumentan significativamente la fiabilidad y la interpretación de calcularse las diferencias: 1) la sonda de nivel no paramétrico p-valores se utilizan para evaluar la significación estadística de las diferencias individuales calculado; 2) estrictamente monotónica cuantil escala se utiliza para normalizar PM y MM sonda de intensidad entre arreglos de distribución; 3) exclusión automática de uninformative y misinformative sondas se utiliza para aumentar la exactitud y la precisión de las diferencias calculadas. Una descripción detallada del algoritmo de WPP está disponible en archivo adicional 1. Las mediciones de los cuatro humano normal muestras de ADN se utilizaron como base de referencia para la medición del número de copias variación en las líneas celulares. CNVs de las líneas celulares se calcularon en relación con la mediana de las señales normales de muestras.

Análisis de componentes principales y análisis de conglomerados jerárquico

Análisis de agrupamiento jerárquico en el software SPSS, se aplicó a log2 transformado número de copias estimaciones de la sonda fija utilizando una medida de correlación de Pearson con más de distancia vecino. Para excluir el género diferencias específicas, ligada al X y Y-genes ligados fueron excluidos. Principio análisis de componentes en el software SPSS, se aplicó con rotación varimax para log2 transformado número de copias estimaciones para 2000 establece la sonda con la más amplia gama de valores de los cromosomas autosómicos.

La construcción del BAC Humanos CGH array

Hemos preparado detección de ADN de secuencia de soluciones conectadas RPCI-11 la tasa de alcoholemia de la ligadura mediada por PCR, tal como se describe anteriormente [30]. El conjunto que figura ~ 19000 clones BAC que fueron elegidos en virtud de STS su contenido, la secuencia final y la asociación con el cáncer [15]. Cada clon fue descubierto en doble ejemplar en amino-silanated diapositivas de vidrio (Schott Nexterion typeA +) con un MicroGrid ll TAS arrayer (Apogent Descubrimiento). El BAC de ADN productos han ~ 80 μ m de diámetro puntos con 150 μ m de centro a centro de espaciamiento de la creación de una serie de elementos ~ 39000. El impreso se desliza la noche a la mañana se secaron y posteriormente la radiación UV-crosslinked (350 mJ) en un Stratalinker 2400 (Stratagene) inmediatamente antes de la hibridación. Una lista completa de los RPCI-11 clones BAC manchas en la 19k gama está disponible en línea [31].

Etiquetado y de hibridación de ADN para BAC aCGH

Una μ g de referencia y muestra de prueba de ADN genómico (ADN genómico agrupado de cinco personas) fueron etiquetados individualmente fluorescente utilizando la CGH BioArray sistema de etiquetado (Enzo Ciencias de la Vida). Inicialmente, el ADN fue desnaturalizado por la presencia del primer al azar a 99 ° C durante 10 minutos en un thermalcycler, seguido de un enfriamiento rápido a 4 ° C. Los tubos fueron trasladados al hielo, y se les realizó el etiquetado con la adición de dNTP cyanine 3-mix (dNTP o cyanine-5) y Klenow. Las muestras se incubaron durante la noche a 37 ° C en un thermalcycler. Los nucleótidos no incorporados fueron retirados QIAquick utilizando una columna de purificación de PCR (Qiagen) y la sonda marcada se eluye con 2 × 25 ul lavados. Antes de hibridación, el ensayo y de referencia fueron las sondas resuspendido en 110 μ l SlideHyb Buffer # 3 (Ambion), que contiene 5 μ l de 20 μ g / μ l Cot-1 y 5 μ l de 100 μ g / μ l tRNA de levadura (Invitrogen), climatizada a 95 ° C durante 5 minutos y se coloca en hielo. Hibridación a la 19k CGH arrays se realizaron durante 16 horas a 55 ° C utilizando una estación de hibridación GeneTAC (Genomic Solutions, Inc), tal como se describe [32]. Después de la hibridación, las diapositivas son automáticamente lavarse en la estación de GeneTAC con la reducción de las concentraciones de la cooperación Sur-Sur y EDS.

Digital Adquisición de Datos y Análisis de la tasa de alcoholemia aCGH

El hibridizada aCGH diapositivas fueron digitalizadas mediante un escáner GenePix 4200A (Molecular Devices) para generar alta resolución (5 μ m) para las dos imágenes Cy3 (prueba) y Cy5 (control) canales. Análisis de imágenes se realizó a través de ImaGene (versión 6.0.1) de software biológico, Inc loess corregida log 2 relación de los antecedentes-resta test / control se calcula para cada clon para compensar la no-lineal bruto aCGH perfiles en cada una de las muestras . Mapeo de información se añadió a la resultante de prueba log 2 / los valores de control. El mapeo de datos para cada BAC se encuentra la consulta de la secuencia del genoma humano [33] y examinados para las regiones de gran escala variación (LSV) en el genoma humano [8, 26, 34, 35].

Comparación de número de copias segmentación resultados arrays de expresión y la tasa de alcoholemia arrays

Dado que la tasa de alcoholemia aCGH microarrays y la graCNV microarray (U133 Plus GeneChip 2,0) se han anotado de acuerdo con el genoma humano asamblea versión 35, las coordenadas de los segmentos número de copias se compararon directamente. Copiar número de segmentación log2 ratios se realizó en R utilizando el paquete DNAcopy que se aplica v1.8.1 CBS (Circular Segmentación binario) [36, 37], uno de los mejores algoritmos de segmentación [38]. El undo.splits opción se ajusta a "sdundo".

Análisis de microarrays de expresión

Para los perfiles de expresión, 25 ng de ARN total por muestra fue procesada utilizando amplificación isotérmica SPIA Sistema Biotina (NuGEN Technologies, Inc) y 2,2 μ g de cDNA fue hibridada por microarrays. Microarrays utilizados se Custom GeneChips (Affymetrix), que contienen conjuntos de sonda para medir las transcripciones de ratón cromosomas 11 y 16. Después de 16 horas de la hibridación a 45 ° C, el lavado y la tinción de microarrays se realizó con un Fluidics Station 450 (Affymetrix); GeneChips fueron digitalizadas en un escáner GeneChip 3000 (Affymetrix). CEL archivos fueron generados a partir de archivos DAT usando software SMOC (Affymetrix). Todas las medidas de la muestra y procesamiento de microarrays se realizaron de acuerdo a las recomendaciones del fabricante. Para el cálculo de la expresión génica diferencial, log2 expresión diferencial de múltiples conjuntos de sonda por genes, cuando se promedió más de un conjunto sonda estaba disponible por gen.

PCR cuantitativa

Muestras de cola (<1 cm) se han cortado con tijeras de cada animal en la colonia megabladder ratón. Colas fueron digeridos y se aisló el ADN utilizando Spin Doctor Aislamiento de ADN genómico kit (Gerard Biotech) de acuerdo con el protocolo del fabricante. El ADN fue resuspendido en buffer de resuspensión incluido en el kit. Las concentraciones de las muestras fueron determinados por Nanodrop ND1000 espectrofotómetro (Nanodrop), y la densidad óptica 260/280 nm ratios fueron evaluados. ADN genómico fue almacenada a 4 ° C hasta su posterior utilización. Mutant ratones contienen un transgén artificial, además de las copias adicionales de la región determinada del cromosoma 16. Genotipado de los ratones de PCR cuantitativa se realizó mediante transgén primers específicos (5'-CAACCGACTCTGCATTCATCTC-3 '(avance) y 5'-CTCCAGTACAGCCCTCATGTTTG-3' (al revés) y sonda 5'-6FAM AAGCTTGATATCGAATTC MGBNFQ-3 '. Glucagón El gen fue utilizado como control interno con los primers 5'-CACAACATCTCGTGCCAGTCA-3 '(avance) y 5'-ATCTGCATGCAAAGCAATATAGCT-3' (al revés), y la sonda se 5'-VICT GGGATGTACAATTTCAA MGBNFQ-3 '. Trabajo concentraciones de primers y sondas fueron 18 μ M y 5 μ M, respectivamente. Las reacciones de PCR múltiple se crearon con 20 ng de DNA y PCR TaqMan Universal Master Mix, n º AmpErase UNG (Applied Biosystems). reacciones fueron realizadas en triplicado, utilizando la serie ABI 7500 Sequence Sistema de Detección (Applied Biosystems) . La desnaturalización inicial se llevó a cabo a 50 ° C durante 2 min, seguido de 95 ° C durante 10 min (desnaturalización), seguido por 40 ciclos de PCR reacciones a 95 ° C durante 15 segundos y 60 ° C durante 1 min. La amplificación los datos fueron analizados mediante el sistema ABI 7500 Sequence software de detección de la versión 1.2.3 (Applied Biosystems). El genotipo fue determinado por la presencia de 0 frente a 1 frente a 2 copias del transgén en el tipo silvestre, heterocigotos y homocigotos ratones, respectivamente. Copia de números genes endógenos se determinaron utilizando SYBR Green TaqMan o química (ambos de Applied Biosystems). 10 ng de DNA genómico se utilizaron por reacción de amplificación y las condiciones de SYBR Green ensayos fueron las siguientes: 50 ° C durante 2 min, 95 ° C durante 10 min seguido por 40 ciclos de PCR a 95 ° C durante 15 segundos, 54 ° C durante 30 segundos y 72 ° C durante 35 segundos. Los datos se recogieron a 72 ° C durante 35 segundos. TaqMan datos de glucagón se utilizaron para la normalización. Primers se generados por las siguientes secuencias: 2310061A09Rik (5 'GCCATCTGCATATTCTTTGCTAGCA 3' adelante y 5'ACATGGTTTAATGGTAGACTGGGCA 3 'al revés); Cldn1 (5'CTCAACCTCCCAACTGTTAAGATGA 3' adelante y 5'AACCTCTCCTATAACTGTCAGCTTC 3 'al revés); Ostn (5'GAGTGTTTGCTTCAACTGTGTCAGA 3' hacia adelante y 5 'AACAAGCCAGGCAGTAACTTCTTTT 3', al revés); Uts2d (5'GAGTGTTTGCTTCAACTGTGTCAGA 3 'hacia adelante y 5' TAGGCTGGTAGAAGTAAACAAGCCA 3 'al revés), 2610529H08Rik (5'TGGCGTCTAGGGAACTGAGTTTCTT 3' adelante y 5'TGAGGAAACAGCAGTACACGATAAC 3 'al revés), D16Bwg1543e (5'GCTGGCTGCAGGGAACAATCTATTT 3' adelante y 5'GATGTAGACATATGAGTGGTAGTGA 3 'al revés), B230343J05Rik (5'TGTGATTCATCATCGCTACAGGGAA 3' adelante y 5'AACCTTCTCAAAAGCAAGGCCTTGT 3 'al revés). amplificación condiciones para TaqMan ensayos fueron como se ha descrito anteriormente para la genotipificación. comerciales "Primer sonda mezclas" (Applied Biosystems) utilizados para Il1rap (ILRAP5-K1), Fgf12 (FGF12-1-A2) y Cldn16 (CLDN-I55S4).

Microarray datos se depositan como GEO adhesión # GSE7364 [39].

Autores de las contribuciones

HA diseñó el estudio y escribió el manuscrito, DLN realizado graCNV, NJN realizado BAC aCGH análisis, siempre que el KMM megabladder modelo, SS realizó PCR cuantitativa, siempre CYY material genético e información sobre CNVs normal de los individuos, AA realizó el sur de blots de las personas normales, GDW citogenético realizado la investigación de líneas celulares, JMG siempre la información clínica y ha ayudado a escribir el manuscrito, KK desarrollado algoritmos de análisis de datos y se lleva a cabo el análisis de datos. Todos los autores leído y aprobado el manuscrito final.

Material complementario
Archivo Adicional 1
Métodos complementarios. El archivo contiene dos secciones, una descripción detallada de ADN / microarray de transformación y de la WPP algoritmo.
Agradecimientos

Damos las gracias a Albert de la Chapelle valiosa para los debates y Long-Sheng Chang para proporcionar SK-N-SH / L y SK-N-AS ADN. Parte de este estudio fue apoyado por donaciones de RO1 AR050078 NIAMS y PO1 DK55546 de NIDDK (a CYY y AA), y de conceder RO1 DK00907 de NIH (KMM).