Bioinorganic Chemistry and Applications, 2007; 2007: (más artículos en esta revista)

Platinum (II) y paladio (II) de piridina-2-Carbaldehyde Thiosemicarbazone como alternativa Antiherpéticos simple virus de Agentes

Hindawi Publishing Corporation
D. Kovala-Demertzi [1], T. Varadinova [2], p. Genova [3], p. Souza [4], MA Demertzis [1]

Este es un artículo de acceso abierto distribuido bajo la licencia Creative Commons Attribution License, que permite el uso ilimitado, distribución y reproducción en cualquier medio, siempre que la obra original esté debidamente citados.

Resumen

La citotoxicidad y la actividad antivirus de Pd (II) y Pt (II) con piridina-2-carbaldehyde thiosemicarbazone (HFoTsc) contra el VHS de replicación fueron evaluados en cuatro cepas VHS y dos cepas peso Victoria (HSV-1) y BJA (HSV -2) Y dos ACV R mutantes con diferentes mutaciones genéticas tk R-100 (CT A, HSV-1) y PU (CT N, HSV-2). Los experimentos se realizaron en células MDBK continua y cuatro HSV 1 y HSV 2 cepas se utilizaron, dos sensibles para el aciclovir y dos mutantes resistentes. Los cinco complejos de HFoTsc, [Pt (FoTsc) Cl], [Pt (FoTsc) (H 2 FoTsc)] Cl 2, [Pt (FoTsc) 2], [Pd (FoTsc) (H 2 FoTsc)] Cl 2, y [Pd (FoTsc) 2], resultaron ser eficaces inhibidores de la replicación de HSV. El más prometedor, activo, selectivo y anti-HSV agente resultó ser complejo [Pt (FoTsc) (H 2 FoTsc)] Cl 2. Este complejo puede ser útil en el tratamiento de infecciones por HSV, ya que es resistente a ACV mutantes. PCR estudio de principios de inmediato 300 bp ReIV Us1 región revela que el complejo [Pt (FoTsc) (H 2 FoTsc)] Cl 2 reprimidas concretamente en peso HSV-1 genoma 2 horas después de la infección, no inducir la apoptosis y necrosis en las 8 horas después La infección por el virus. El objetivo resultó ser muy probablemente el virus, en lugar de la célula huésped de ADN.

1. INTRODUCCIÓN

Herpes simplex virus (HSVs) son altamente patógenos humanos adaptado con un rápido ciclo lítico y la capacidad de invadir las neuronas sensoriales. Los principales agentes facial recurrente de herpes genital y lesiones son HSV-1 y HSV-2, mientras que el herpes genital (GH) es la más común de infecciones de transmisión sexual en el mundo [1 - 3]. Por otra parte, GH es el principal factor de aumento de tres a cinco veces el riesgo de transmisión del VIH, estimulando la replicación del VIH y, finalmente, conducen a la progresión del SIDA [4 - 6]. Aciclovir (ACV) es Un promedicamento y es la primera de nucleósidos-terapéutico efectivo para el tratamiento de la enseñanza primaria y VHS infecciones recurrentes [7]. HSV represión efectiva ACV indirectamente con el VIH reduce la carga. ACV tiene que ser fosforilados por la timidina kinasa viral (TK) y posteriormente por quinasas celulares con el fin de inhibir competitivamente la DNA polimerasa HSV y poner fin a la cadena de ADN viral elongación. Sin embargo, bajo la administración sistemática, parece mutantes resistentes con alta frecuencia y de sus principales fuentes son inmunes de las personas en peligro [7 - 9]. Las dos causas más comunes de la resistencia son las mutaciones en la timidina kinasa (TK) de genes, aproximadamente el 95% a 96% de los ACV resistentes (R ACV) son aislados HSV-timidina quinasa-(CT), deficiente (CT N) o los conocimientos tradicionales - parcial (CT P) y el resto de las cepas aisladas son por lo general los conocimientos tradicionales alterado (CT A) mutantes incapaces de phosphorylate la prodrug, pero no la timidina [9]. El problema para un tratamiento eficaz de infecciones HSV sigue abierta, ya que la resistencia a ACV y la resistencia cruzada con otros análogos de los nucleósidos con aumento relativamente alta frecuencia.

Los primeros antivirales son thiosemicarbazones, Tscs. La bioactividad de Tscs se debe a la inhibición de ribonucleotide reductasa (RR) y debido a complexation con metales esenciales [10 - 12]. La actividad de Pt (II) y Pd (II) complejos de piridina-2-carbaldehyde (HFoTsc) contra la replicación de tipo salvaje (WT) HSV-1, ha sido recientemente mencionado por Varadinova et al. [13]. La actividad antiviral de los complejos de platino con agentes antivirales aciclovir, penciclovir, famciclovir y se ha informado recientemente [14 - 16].

El objetivo del presente estudio fue evaluar comparativamente la actividad de los complejos de Pd (II) y Pt (II) con piridina-2-carbaldehyde thiosemicarbazone (HFoTsc) contra el VHS de replicación. Se prestó especial atención a la eficacia de los compuestos contra la CAV R virus.

2. EXPERIMENTAL
2,1. Metal complejos

Los disolventes son purificados y secado de acuerdo a procedimientos estándar. El ligando HFoTsc, 1, y los complejos de Pt (II) y Pd (II) [ PtCl (FoTsc) ], 2, [Pt (FoTsc) (H 2 FoTsc)] Cl 2 , 3, [Pt (FoTsc) 2] , 4, [PdCl (FoTsc)] , 5, [Pd (FoTsc) (H 2 FoTsc)] Cl 2 , 6, y [Pd (FoTsc) 2] , 7, se prepararon (ver Esquema 1] de algunos de nosotros, tal como se describe en la literatura [13, 17, 18].

Todos los compuestos en primer lugar, se disuelve en DMSO (Koch-Light Laboratories Ltd, Inglaterra) hasta la concentración de 1 M (soluciones madre). Diluciones en serie de diez veces (100-0.000001 μ M) se hicieron a partir de ellos células en el medio de cultivo DMEM (Gibco, EE.UU.) suplementado con 5% de suero bovino (BS; BioWhittaker, Alemania) y antibióticos (penicilina G, 100 unidades / mL, Balkanpharma, Bulgaria).

2,2. Las células y los virus

Continua Madin-Darbey bovina riñón (MDBK) las células fueron utilizados en los experimentos. Las células fueron cultivadas a 37 ° C en medio DMEM complementado con un 10% de PB y antibióticos. Durante los experimentos, BS contenido se redujo a 5%. Antivirales experimentos se realizaron en los siguientes cuatro virus: dos silvestres (peso) cepas Victoria (HSV-1) y BJA (HSV-2) y dos ACV R mutantes con diferentes conocimientos tradicionales mutaciones genéticas R-100 (CT A, HSV-1) y PU (CT N, HSV-2). Los virus son cultivados en monocapas de células MDBK. Culturas fueron cosechadas en pleno efecto citopático (CPE), se congeló, descongelados y almacenados a -70 ° C.

2,3. La citotoxicidad y (VHS) ensayos

Confluentes de monocapas de células fueron lavadas y cubiertas con los medios de comunicación que contienen los compuestos y cultivadas a 37 ° C durante 48 horas. Efecto citopático (CPE) fue leído por microscopía de unstained monocapas de células. Número de células fue contado por el azul Trypan-método de exclusión del colorante.

La concentración citotóxica CC 50 (concentración de la prevención de la muerte del 50% de las células) y la máxima concentración no tóxico, MNC, se calcula a partir de dosis-respuesta curvas. La máxima concentración que produce el no citotoxicidad que no altera la morfología de monocapas de células y la tasa de supervivencia fue reconocido como MNC.

La actividad antiviral de los complejos 1-7 contra el VHS de replicación se evaluó sobre la base de sus efectos sobre el infecciosas HSV título. MDBK células se cultivaron en placas de 96 pocillos y fueron infectados con el virus en particular, diez veces diluciones seriadas. Después de 1 hora de virus embargo, las células infectadas fueron cubiertos con el medio y la prueba compuesto por diez veces diluciones seriadas (a partir de MNC) y cultivadas a 37 ° C durante 48 horas (para las cepas en peso) ó 72 horas (para ACV R mutantes). Concentraciones inhibitorias necesarias para inhibir el virus de rendimiento en un 50% (IC 50) fueron calculados a partir de la dosis y curvas de regresión fueron indicativos para la lucha contra el HSV actividad. Con el fin de poder comparar los compuestos sobre la base de su inhibición selectiva de la replicación del virus frente a la citotoxicidad, los índices selectivos (SS) se calcula como el 50 y el CC CI 50 ratio. Los datos se compararon con el de ACV.

2,4. Direct PCR para la determinación del efecto sobre la expresión de los principios inmediatos (IE) reiterando la región IV (ReIV)

Infectados y burlado de las células infectadas cultivadas en compuestos libres de mediano sirvió como control. Amplificación por PCR primers 22 bp (Applied Biosystems, Calif, EE.UU.) fueron diseñados de acuerdo a Maertzdorf et al. [21] para amplificar 300 bp Us1 ReIV región de HSV-1 genoma posiciones 132333-132634. Las secuencias (5 '→ 3') de la cartilla se ReIVUs1F-5'TCCGACGACAGAAACCCACC3 'y ReIVUs1R-5'GTCCCGGAGGACCACAGTGG3 ». PCR se realizó en un listo-a-go-PCR bolas thermocycle (Amersham Pharma-Biotech, NJ, EE.UU.).

A 2 μ l de muestra de ADN suspensión fue agregado a la reacción de las mezclas y se superpone con 25 μ l de aceite mineral (CinnaGen Inc, Irán). Amplificación por PCR se llevó a cabo de la siguiente manera: un primer paso de desnaturalización de 94 ° C durante 5 minutos seguido por 35 ciclos de desnaturalización alterna (94 ° C durante 30 segundos), primer recocido (60 ° C durante 60 segundos), primer y extensión ( 72 ° C durante 60 segundos). Un paso de extensión final de 5 minutos a 72 ° C fue incluido. La PCR se realizaron en 10 μ l de volumen. En pocas palabras, 2 μ l de cada muestra se han añadido a un tubo que contiene 100 μ l de buffer de lisis (Applied Biosystems) y almacenados a -20 ° C durante la noche. Después de centrifugación a 12000 rpm durante 5 minutos, el amortiguador de lisis fue retirado, "pellets" se nucleolysis resuspendido en buffer (300 μ l) fenol (Sigma Corporation of America, NY, EE.UU.), pH 7,8; 300 μ l de cloroformo: alcohol isoamyl = 24 : 1 (Sigma Corporation of America), y centrifugar a 12000 rpm durante 5 minutos. Se extrajo el ADN de resuspending los pellets en un 10% SDS (Sigma Corporation of America) 10 mg / ml de proteinasa K (Biotech Pharma, EE.UU.), 10 mM Tris (Sigma Corporation of America) y 0,1 mM EDTA (Sigma Corporation of America) a pH 7,4 y centrifugar a 12000 rpm durante 5 minutos. Un volumen de 2 μ l de sobrenadantes que contienen 50-100 ng de ADN resultante de la suspensión fue utilizado por la mezcla de PCR. La mezcla de reacción contenía 5 U / μ l clonado recombinante termoestable STS Taq ADN polimerasa (Applied Biosystems), correspondiente primers en una concentración de 20 μ l / ml cada una, y 5 mm / μ l deoxynucleoside trifosfato (Biotech Pharma). Amplicones fueron electrophoresed en un 2% en gel de agarosa y se visualizaron por tinción con bromuro de etidio.

2,5. Apoptosis y necrosis en las células noninfected y en las células infectadas con el VHS

Los métodos de tinción de una cadena de doble hélices de ADN se han utilizado con el 0,1% de solución de naranja de acridina, y las mitocondrias para una solución del 0,1% de Janus B verde se ha utilizado. Un modelo eucariotas de las células infectadas con el virus HSV se utilizó y las siguientes modificaciones en el objeto de adaptar el método a la correspondiente sistema se adaptaron: (1) la fijación de las células con metanol no con formaldehído; (2) después de un procedimiento estándar de La tinción con vistas a una mayor conservación de los preparativos, el tratamiento con glicerol PBS = 1: 1 se utiliza. Los experimentos se llevaron a cabo a las 8 horas de la infección en el período inicial de la morfogénesis de virus activo. Los siguientes se han utilizado como controles: (1) las células no infectadas y no tratadas con los compuestos investigados; (2) las células no infectadas, pero tratados con compuestos; (3) células infectadas con el VHS y cultivadas en un medio sin un inhibidor.

Los indicadores de la falta de apoptosis y necrosis fueron (1) la fluorescencia verde manzana del citoplasma y los núcleos de acuerdo a la prueba de tinción con naranja de acridina; (2) una distribución difusa de la mitocondria, brillando en verde de acuerdo a la prueba de tinción con Janus Verde B.

Los indicadores de apoptosis son un brillante de los núcleos en amarillo-rojo en un caluroso del citoplasma en verde-amarillento, con una marginación de la cromatina y una eyaculación del núcleo contenido.

3. RESULTADOS Y DISCUSIÓN

CC 50 y MNC se calcularon los valores de dosis-respuesta y las curvas se presentan en la Tabla 1. Todos los compuestos 1-7 exposición menor citotoxicidad de ACV. MNC osciló entre 1-100 μ M. Entre ellos, el aumento de la citotoxicidad exposiciones [Pt (FoTsc) 2] y [Pd (FoTsc) Cl] . Estos dos complejos son 50 veces, [Pd (FoTsc) (H 2 FoTsc)] Cl 2 y [Pd (FoTsc) 2] son 500 veces, y HFoTsc, [Pt (FoTsc) Cl] y [Pt (FoTsc) (H 2 FoTsc)] Cl 2 son 5000 veces menos citotóxico que ACV. Cuanto menos compuestos citotóxicos se HFoTsc (1) y su Pt (II) complejos de 2 y 3. La estructura de 3 corresponde a [M (FoTsc) (H 2 FoTsc)] X 2 [22 - 24]. Obviamente, la protonadas ligando en forma zwitterion H 2 + FoTsc disminuye la citotoxicidad de Pt (II) pero no de Pd (II) , Complejo 6.

Los datos presentados en la Tabla 1 muestran que la citotoxicidad de compuestos 1-7 fue predeterminado por la compleja especificidades.

La actividad de los compuestos 1-7 se evaluó peso contra el VHS-1, cepa Victoria, la infección en las células cultivadas, y los datos se compararon con el de ACV. El complejo 5 no muestran ningún efecto sobre el virus infeccioso rendimiento y se excluyen de nuevas investigaciones. El resto de los compuestos 1-4, 6-7 fueron evaluados en relación con peso HSV-2 cepa BJA y dos ACV R mutantes con diferentes mutaciones genéticas CT-R-100 (CT A) y PU (CT N), véase el cuadro 2 .

Los compuestos 1-4 y 6-7 efectivamente inhibe el crecimiento de peso y de ACV R, HSV-1 y HSV-2 cepas y el efecto se comprobó que estaban predeterminadas por ambos virus complejos y especificidades. La forma más eficaz inhibidor de la wt HSV-1 de crecimiento fue el ligando 1 mientras complejo 4 fue más sensible a peso HSV-2. Por el contrario, el crecimiento de ACV R virus fue reprimido con eficacia los complejos de 2 y 6. Los complejos de Pt (II) y Pd (II) HFoTsc y se organizan en función de su eficacia contra las cuatro cepas de HSV en el siguiente orden:

de peso HSV-1: 1> 4> 3> 2> 7 »6;

en peso para el VHS-2: 4> 6> 1 = 3 »2> 7;

R CAV para mutantes R-100 y PU: 2 = 6 »4> 3 = 7.

La selectividad de los compuestos 1-7 se muestra en la Tabla 2 y se constató que se predeterminado por ambos virus complejos y especificidades. Complejos 1-7 se organizan en función de su selectividad en el siguiente orden contra las cuatro cepas:

de peso HSV-1: 1> 3 ≥ ACV> 4> 27 »6;

en peso para el VHS-2: 3> 4> ACV> 16 »2> 7;

de ACV cepa R-100 R: 4> 2 = 6> 3> ACV> 1> 7;

de ACV R cepa PU: 2> 3> 6 CAV => 1> 7 = 4.

El complejo 3 fue más sensible a las cepas VHS en peso, mientras que el complejo 2 fue más sensible a ACV R mutantes. El complejo fue 7 el menos activo y selectivo inhibidor de la replicación de HSV y el complejo de 3 selectivamente inhibe la replicación de peso y ACV R virus.

La importante actividad y la selectividad de 3 se debe probablemente a la influencia negativa sobre varios objetivos viral. Esto se basa en el hecho de que en solución, [M (FoTsc) (H 2 FoTsc)] X 2 disociar los complejos a los complejos metálicos [M (FoTsc) Cl] y el ligando protonadas H 2 + FoTscCl [22, 23], por lo tanto, al mismo tiempo la represión específica para el virus RR y la síntesis de ADN de la progenie.

Virus específicos de las proteínas se identificaron a las 15 horas por Western blot. Once virus específicos de las proteínas se identificaron en el control viral: VP5, VP22, VP23, α-TIF, los conocimientos tradicionales, GB, GC, GE, GD, GH, y GG. En los compuestos de 1, 3 y 4, VP23, los conocimientos tradicionales, GG / GD, α-TIF, GH, y GE no se identificó, véase el cuadro 3. Estos datos sugieren que los compuestos de 1, 3 y 4 también suprimir la morfogénesis, la célula-célula propagación, y transactivation genomas de virus.

En vista del hecho de que HFoTsc y 3 no sólo son eficaces y los inhibidores selectivos de VHS, sino que también suprimir la expresión de la estructura esencial de las proteínas β (E) y γ (L), cinética de los grupos, cuya síntesis es imposible sin α, IE proteínas, el efecto de 3 sobre la expresión de la α inmediatamente antes, IE genes por medio de un directo de PCR se estudió. Un directo de multiplicación fue utilizado por PCR con un cebador, la determinación de la región 300 bp, correspondiente a ReIV región de Us1. Los resultados de la electroforesis en gel de ADN viral extraído de células infectadas por el control y tratamiento durante 2 horas después de la infección por el VHS-1 con MNC de [Pt (FoTsc) (H 2 FoTsc)] Cl 2 , 3 y HFoTsc y 1 se muestran en la Figura 1. Tal como se esperaba, se observó que el ADN de las células MDBK control aparece como una banda correspondiente al ADN genómico (Figura 1, carril 3). La incubación del HSV-1 las células infectadas con el MNC de [Pt (FoTsc) (H 2 FoTsc)] Cl 2 , 3 o la HFoTsc 1, ligando dado lugar a un "frotis de ADN," que muestra la fragmentación inespecífica de ADN (Figura 1, carriles 5 y 6, resp.). Los resultados directos recibidos por PCR demuestran que [Pt (FoTsc) (H 2 FoTsc)] Cl 2 , 3 (carril 5), y el ligando HFoTsc 1 (carril 6) reprimir la expresión de la α, IE genes del virus. En conjunto, estos datos sugieren que en las células infectadas MDBK, la destrucción inespecífica de ADN viral es, evidentemente, causado por Pt (II) iones [25, 26] y puede deberse a una inducción de la apoptosis.

El efecto de 3 a la muerte celular programada se evaluó morfológicamente con el fin de estudiar si el observado es la fragmentación del ADN celular y / o específica para el virus. El uso de acridina naranja y verde Janus B tinción cambios morfológicos que conduzcan a irreparable marginación de la cromatina, una eyaculación del núcleo de contenido y otros indicadores de apoptosis no se encontraron en peso HSV-1 ni en el modelo de las células infectadas por el 8 horas después de la acción de [Pt (FoTsc) (H 2 FoTsc)] Cl 2 , 3. Se observó que el complejo 3 HSV específicamente afecta simultáneamente la supresión de la replicación del virus específicos de RR y la DNA polimerasa y la expresión del genoma del virus inmediatamente después de entrar en la célula hospedadora núcleo. Esto explica también la respuesta inespecífica del virus a [Pt (FoTsc) (H 2 FoTsc)] Cl 2 .

Los datos experimentales muestran que [Pt (FoTsc) (H 2 FoTsc)] Cl 2 complejo es un prometedor anti-HSV agente que podría ser útil en el tratamiento de infecciones por HSV, sobre todo cuando el agente causal es resistente a ACV mutantes. El complejo de platino [Pt (FoTsc) (H 2 FoTsc)] Cl 2 disminuye la citotoxicidad de Pt (II) iones y dirige su actividad a viral y no a la célula hospedadora ADN.

Damos las gracias al Ministerio búlgaro de Educación y Ciencia y el Secretario General de la Investigación y la Tecnología de Grecia para la financiación de un proyecto bilateral.